Preparation method and application of euphorbia lathyris squalene synthase knockout mutant material

Abstract

The invention discloses a preparation method and application of a euphorbia lathyris squalene synthase knockout mutant material, and belongs to the field of plant genetic engineering. According to the invention, a squalene synthase gene of euphorbia lathyris is taken as a target gene, a CRISPR / Cas9 gene editing system is applied to euphorbia lathyris for the first time, gene editing and knockout are carried out on the squalene synthase gene, and a euphorbia lathyris squalene synthase knockout mutant material is obtained. According to the euphorbia lathyris squalene synthase knockout mutant material created by the method, the yield of macrocyclic diterpenes is remarkably increased, the production cost of the macrocyclic diterpenes can be reduced, and the euphorbia lathyris squalene synthase knockout mutant material has a wide application prospect.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and specifically relates to a preparation method and application of a squalene synthase (SS) knockout mutant material of Caper squalene. Background Art

[0002] Follower Euphorbia lathyris L.) is a perennial herbaceous medicinal plant that is distributed and planted in many countries around the world. The euphorbia pulcherrima contains important functional substances with special skeletons - macrocyclic diterpenoids. These compounds have attracted the attention of many pharmacologists due to their significant pharmacological activities, such as ingenol methylbutyrate (treatment of actinic keratosis, FDA approved for marketing) and euphorbia factor L3 (reversal of tumor multidrug resistance) (Abramovits et al., 2013; Zhu et al., 2018). Although the macrocyclic diterpenes in Caper fruit have great application prospects, their content in Caper fruit is low, and the yield of extraction and separation is less than 0.1%, which seriously restricts the comprehensive development and utilization of Caper fruit; at the same time, due to the long and cumbersome chemical synthesis reaction steps of macrocyclic diterpenes, the yield is less than 1.0%, resulting in high synthesis costs of macrocyclic diterpenoid compounds and the inability to achieve industrial production (Asaba et al., 2015; Nickel et al., 2004; Hashimoto et al., 2017; Tong et al., 2018). Therefore, it is urgent to create a new resource of Caper fruit with high yield of macrocyclic diterpenes.

[0003] Studies have shown that there is competition between triterpenes and macrocyclic diterpenes in the biosynthesis pathway, so the production of macrocyclic diterpenes can be increased by inhibiting triterpene synthesis genes. Squalene synthase is a key enzyme in the upstream triterpene synthesis pathway of Caper, so it is feasible to increase the production of macrocyclic diterpenes in Caper by knocking out the squalene synthase gene. Gene editing technology has been successfully used in the genetic modification of many plants and is characterized by precision and efficiency, but the current gene editing system for Caper is still immature. Summary of the invention

[0004] In view of the above shortcomings, the present invention provides a preparation method and use of a squalene synthase knockout mutant material of Caper squalene.

[0005] The present invention is achieved through the following technical solutions.

[0006] Knocking out the squalene synthase gene using gene editing technology increased the production of macrocyclic diterpenes in the hairy roots of Caper oleifera.

[0007] The method comprises the following steps: designing a specific target for targeting the squalene synthase gene of caper, constructing a pNK2-Cas9-U6 gene editing recombinant vector containing the specific target by gene editing technology, infecting the caper hypocotyl explant with Agrobacterium rhizogenes, transferring the recombinant vector into the caper, specifically knocking out the squalene synthase gene, obtaining squalene synthase knockout mutant hairy roots, and obtaining caper hairy root materials with high yield of macrocyclic diterpenes by LC-MS detection.

[0008] The target fragment connected to the pNK2-Cas9-U6 vector backbone is the target sequence of the squalene synthase gene.

[0009] The specific target sequence of the squalene synthase gene is obtained from the first exon of the squalene synthase gene, and the target sequence is (5'-3') GGGAGCAATTCTGAAGCATC.

[0010] The squalene synthase gene CDS sequence is as follows Figure 1 shown.

[0011] The caper macrocyclic diterpene high-yield material is obtained through a hairy root transformation system.

[0012] The gene editing material is identified as a caper mutant material by DNA sequencing of the target sequence.

[0013] The use refers to blocking the triterpene synthesis pathway in the terpene synthesis process by knocking out the squalene synthase gene, a key enzyme gene in triterpene biosynthesis, thereby increasing the yield of macrocyclic diterpenes and reducing production costs.

[0014] The increased production of macrocyclic diterpenes was confirmed by LC-MS analysis of the gene-edited knockout material of the Caper.

[0015] The present invention has completed the construction of the gene editing system of the caper for the first time, successfully created a knockout mutant material with squalene synthase as the target knockout gene, and found through LC-MS analysis that its macrocyclic diterpene production is significantly increased. The caper squalene synthase knockout mutant material has a high macrocyclic diterpene production and can reduce production costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The CDS sequence of the squalene synthase gene of the continuum. The underlined sequence is the target sequence used for gene editing.

[0017] Figure 2 This is the sequencing result of the squalene synthase gene editing knockout. The mutation is located at position 30 of the squalene synthase gene CDS, which is a homozygous mutation and the mutation type is an A base insertion mutation.

[0018] Figure 3 The hairy roots of the squalene synthase knockout mutant were obtained.

[0019] Figure 4 This is the result of LC-MS analysis of ingenol.

[0020] Figure 5 These are the results of LC-MS analysis of diterpenoid alcohols from Leptochloa chinensis. DETAILED DESCRIPTION

[0021] The specific embodiments of the present invention are further described in detail below, but the content of the present invention is not limited to the content included in the following embodiments.

[0022] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0023] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0024] Example 1: Construction of gene editing system.

[0025] According to the CRISPR target design principle, the CDS sequence of the squalene synthase gene was first aligned with the genome sequence on snapgene 4.1.9 software to determine the exons. The PAM sequence was selected on the first exon, and the PAM sequence was characterized by NGG or CCN, where N was any nucleotide. Exon sequences containing 20 bases upstream of NGG or downstream of CCN were screened, and candidate target sequences with a GC content of 50-65% were selected, and candidate target sequences should avoid multiple consecutive A or multiple C. The specific target sequence used in this experiment was (5'-3') GGGAGCAATTCTGAAGCATC.

[0026] The two primers used to synthesize the target sequence were SST1F and SST1R (Table 1), which were synthesized by Beijing Qingke Biotechnology Co., Ltd. The two primer sequences were denatured, annealed, and extended to form a double-stranded structure. The reaction system was 2×BioRunPfu PCR Mix: 10 µL, SST1F: 1 µL, SST1R: 1 µL, dd H2O: 8 µL. The PCR reaction conditions were: 98°C for 3 min; 98°C for 15 s, 55°C for 15 s, 72°C for 30 s, 25 cycles; 72°C for 5 min.

[0027] The pNK2-Cas9-U6 recombinant vector containing the editing target was obtained by seamless cloning Golden Gate technology. The pNK2-Cas9-U6 vector was purchased from Wuhan Boyuan Biotechnology Co., Ltd. The vector uses pNK2-Cas9 as the vector backbone and contains the U6 promoter suitable for dicotyledonous plants. The specific ligation reaction system is: 10×Reaction Buffer: 2µL, pNK2-Cas9-U6 (50 ng / µL): 2 µL, target product: 1 µL, BioRun Eco31Ⅰ: 1 µL, T4 DNALigase: 1 µL, dd H2O: 8 µL. After mixing, the above system was briefly centrifuged and incubated at 37°C for 30 min, then heated at 65°C and placed on ice for later use.

[0028] Table 1 Amplification primer sequences of target sequences Primer name Primer sequence (5'-3') SST1F cagt GGTCTCA TGCA GGGAGCAATTCTGAAGCATC SST1R cagt GGTCTCA AAAC GATGCTTCAGAATTGCTCCC

[0029] The ligation product was transformed into Escherichia coli. The specific operation was as follows: the competent Escherichia coli cells DH5α were taken out from -80℃ and thawed on ice. When the competent Escherichia coli cells were in an ice-water mixture state, the gene editing vector ligation product was added, ice bathed for 30 minutes, heat shocked at 42℃ for 45 seconds, and ice bathed for 2 minutes. 700 μL of antibiotic-free LB liquid culture medium was added to the centrifuge tube, and the culture was revived on a shaker at 37℃ for 1 hour, and then spread on an LB plate containing kanamycin. The culture was inverted and cultured at 37℃ for 12 hours, and a single clone colony was selected for expansion and sequencing. The sequencing primer was U6cef (5'-3'): TACAGCTAGAGTCGAAGTAG.

[0030] The sequencing results detected the squalene synthase target sequence, and the successfully constructed pNK2-Cas9-U6 gene editing recombinant vector was transferred to Agrobacterium rhizogenes MSU440 by heat shock method. The specific operation is as follows: After the competent Agrobacterium rhizogenes MSU440 was thawed on ice, the gene editing recombinant vector was added, ice bathed for 5 min, liquid nitrogen for 5 min, and heat shocked at 37°C for 5 min. After ice bathing for 5 min, 700 µL of antibiotic-free LB liquid medium was added to the competent cells, shaken at 28°C for 2 h, spread on LB plates containing kanamycin and streptomycin, and inverted at 28°C for 48-72 h. Positive clones were picked from the plate and cultured in 15 mL shaking tubes with LB liquid medium (containing 50 mg / L kanamycin and 50 mg / L streptomycin) at 28°C and 200 rpm.

[0031] Select plump-looking seeds of Caper sempervirens, rinse with running water for 20 minutes, soak in 75% ethanol for 45 seconds, soak in 0.1% mercuric chloride solution for 2 minutes, and rinse the seeds repeatedly with sterile water for more than 5 times. Place the seeds in 1 / 2 MS medium. After three days of storage in dark conditions, culture at 25°C with a 16 / 8 hour light / dark cycle for about 15 days, then cut the hypocotyl and culture for 5-7 days as explants.

[0032] The Agrobacterium rhizogenes containing the gene editing recombinant vector was expanded to 30 mL, and the OD 600 The value was 0.5-0.8, and the cells were collected by centrifugation at 4000rpm for 10 min. The cells were resuspended and diluted to 50 mL using 1 / 2 MS liquid medium, and 5 µL of 0.1M acetosyringone was added and placed on ice for 1 h. The hypocotyl explants of the spatholobus were picked and placed in the prepared bacterial solution for 5 min. The excess bacterial solution was removed by sterile filter paper. After the surface bacterial solution was dried on the clean bench, the hypocotyls were placed on 1 / 2 MS solid medium for co-culture. After 3 days of co-culture, the hypocotyls were transferred to a solid medium containing 200 mg / L cephalosporin for subculture. Hairy roots grew in about 2 weeks, and multiple subcultures were performed.

[0033] Example 2: Identification of gene-edited mutants by DNA sequencing.

[0034] Mutant verification primers were designed based on the approximately 200 bp above and below the target site of the squalene synthase gene editing in Caper spp. (Table 2). The CTAB method was used to extract the DNA of the hairy roots of Caper spp., and PCR amplification was performed using the DNA of the hairy roots of Caper spp. as a template, SS cxf and SS cxr as primers, and the PCR products were sequenced. The sequencing results were analyzed using snapgene 4.1.9 to determine the mutation type. The results showed that the gene editing homozygous knockout obtained was an A base insertion knockout mutation ( Figure 2 ).

[0035] Table 2 Primer sequences for mutant verification Primer name Primer sequence (5'-3') SS xf TGGACTCAATCCGTCGTTTTCG SS cxr TGGTTCTTCGAGCCCTTGATACTG

[0036] Example 3: LC-MS analysis of macrocyclic diterpene production in gene-edited knockout mutant materials.

[0037] The knockout hairy roots and blank hairy roots were placed in 40 mL of 1 / 2 MS medium for culture at 25°C and 120 rpm. After 15 days, the hairy root materials ( Figure 3 ) Freeze-dried for later use.

[0038] Take 20 mg of freeze-dried hairy root sample, add 10 mL of methanol for ultrasonic extraction, and collect the extract. Take 1 mL of the extract, add 5% KOH, and adjust the pH to about 13 with pH test paper, and hydrolyze at 40°C for 30 min. After the hydrolysis is completed, add 0.2 M acetic acid, adjust the pH to 7, and add water to 5 mL. Pass the hairy root extract sample through the SPE column, elute with 5 mL of water and 5 mL of methanol respectively, and centrifuge, and take the supernatant for LC-MS detection.

[0039] LC-MS detection was performed on an Agilent HPLC-Q-TOF-MS / MS (1260HPLC+6530 Q-TOF) instrument, with an Agilent Poroshell column (4.6 mm×100 mm, 2.7 µm), a column temperature of 30°C, a mobile phase consisting of water (containing 0.1% formic acid) and methanol, a single sample detection time of 50 min, a flow rate of 0.5 mL / min, and a sample volume of 5 µL per injection. Analysis using Agilent MassHunter Qualitative Analysis 10.0 software revealed that the production of macrocyclic diterpenoids such as ingenol (precursor to the synthesis of ingenol methylbutyrate) and euphorbia diterpenoids (mother nucleus of Euphorbia factor L3) in the hairy roots of the knockout body was significantly increased ( Figure 4 and Figure 5 ).

Claims

1. A preparation method and use of a squalene synthase knockout mutant material of Capparis spinulosa.

2. The method for preparing the knockout mutant material of squalene synthase of Caper squalene according to claim 1, characterized in that The preparation method is achieved by applying the CRISPR / Cas9 gene editing system and the caper hairy root transformation system.

3. The CRISPR / Cas9 gene editing system according to claim 2, characterized in that The vector used was obtained by recombinant modification based on the pNK2-Cas9-U6 plasmid, in which the cas9 vector was connected to the squalene synthase target sequence.

4. The target sequence according to claim 3, characterized in that Its PAM sequence is GGG, and the target sequence is (5'-3') GGGAGCAATTCTGAAGCATC.

5. The CRISPR / Cas9 gene editing system according to claim 2, characterized in that The primers used were designed based on the first exon region of the squalene synthase gene of the captorhinus.

6. The use according to claim 1, characterized in that The yield of macrocyclic diterpenes in the squalene synthase knockout mutant of Capparis spinosa was significantly increased, which can reduce production costs.

Images