Primer marking method based on fluorescence quenching and application

Abstract

The invention relates to the technical field of primer marking, in particular to a primer marking method based on fluorescence quenching and application. The primer labeling method is simple, and fluorescence labeling can be carried out only by manually adding a C-base-rich region to a C-base-rich region of a common primer or at the 5'tail end. And treating the fluorescence labeled primer by using a product amplification technology to form a double-stranded DNA structure. And then dissociating the double-stranded DNA structure through a fluorescent quantitative technology, and making a dissociation curve. And finally, analyzing the inverted dissociation curve to obtain the thermodynamic characteristics of double-chain dissociation of the primer when the temperature changes. The method has the characteristics of low background signal and good PCR product quenching effect. The method can be used in combination with a fluorescent probe method or a fluorescent dye method, and effectively widens the number of targets detected by a classical fluorescent probe technology or a fluorescent dye method technology. And the high sensitivity characteristic of a fluorescent probe method or a fluorescent dye method is not influenced.

Description

Technical Field

[0001] The present invention relates to the technical field of primer labeling, and in particular to a primer labeling method based on fluorescence quenching and application thereof. Background Art

[0002] Real-time fluorescence PCR detection technology has many advantages, such as high sensitivity, strong specificity, simplicity, rapidity, and low cost. It is the most commonly used method for biomolecule detection. At present, the multiplex fluorescence PCR method is basically detected by fluorescent probe technology or fluorescent dye method. Fluorescent probe technology is to mark the fluorescent group on the probe, such as TaqMan technology, Beacon technology, FRET technology, etc. These methods all achieve the detection of multiple targets through fluorescent molecules with different wavelengths of excitation light marked on the probe. The disadvantages are that different amplification fragment products cannot be distinguished in the same fluorescent channel, the ability to detect mutations is insufficient, and dissociation curve analysis cannot be performed. In addition, its detectable targets are limited, and the number of targets that can be detected in a single tube is restricted by the fluorescent channel. The fluorescent dye method is an indiscriminate labeling of double-stranded DNA products, which is often used to detect a single target, limiting its application in multiplex fluorescence PCR technology.

[0003] The patent document with patent number CN114875116A describes a self-quenching fluorescent primer and its design method and application, wherein the fluorescent label is on the primer instead of the probe, and the primer sequence is characterized in that the fluorescent group is labeled on the base that is tightly pressed against the G base, so that the primer fluorescence is quenched, and the amplified product carries a fluorescent signal. However, this scheme moves the fluorescent label position from the probe to the primer, and its principle is based on the fluorescence intensity being proportional to the amplified product, which is basically consistent with the principle of probe labeling and fluorescent dye labeling. Therefore, it is only an alternative to the fluorescent probe technology or the fluorescent dye method. In addition, the G base in the amplified product is still tightly pressed against the fluorescent group, and the fluorescence difference between the original primer and the product is small, and the sensitivity and discrimination are less than those of the fluorescent probe technology or the fluorescent dye method. Summary of the invention

[0004] In view of the problems existing in the background technology, a primer labeling method and application based on fluorescence quenching is proposed, which effectively broadens the number of targets detected by classical fluorescent probe technology or fluorescent dye technology without affecting the high sensitivity characteristics of fluorescent probe method or fluorescent dye method.

[0005] The present invention proposes a primer labeling method based on fluorescence quenching, the steps are as follows:

[0006] S1, fluorescent labeling in the C-rich region of the primer;

[0007] S2, using product amplification technology to treat the above fluorescent labeled primers to form a double-stranded DNA structure, at which time the G base complementary to the C base will quench the fluorescent labeled group;

[0008] S3. Dissociate the double-stranded DNA structure by using fluorescence quantitative technology, so that the G base is away from the corresponding fluorescent labeling group, the quenching effect disappears, and the fluorescent signal is released;

[0009] S4. Prepare a dissociation curve with the help of a quantitative instrument and form an inverted dissociation curve;

[0010] S5. Analyze the above-mentioned inverted dissociation curve to obtain the thermodynamic characteristics of double-stranded dissociation of the primer when the temperature changes.

[0011] Preferably, the fluorescent labeling position is a C-base-rich region of the primer itself or a C-base-rich region artificially added to the 5' end.

[0012] Preferably, when the terminal region of the primer is fluorescently labeled, the labeled fluorescent base is C, and the labeled sequence is C*C or C*CC; C* represents the labeled base C.

[0013] Preferably, when the internal region of the primer is fluorescently labeled, the labeled fluorescent base is T, and the labeled sequence is CT*C or CCT*CC; T* represents the labeled base T.

[0014] Preferably, the C-rich base sequence artificially added to the 5' end of the primer does not need to match the amplification template sequence.

[0015] Preferably, the selected fluorescent labeling group is any one of FAM, VIC, HEX, TET, ROX, TAMRA, JOE, Cy3 or Cy5.

[0016] Preferably, the temperature corresponding to the peak on the dissociation curve reflects the Tm value of the amplification product.

[0017] The present invention further proposes an application of the above-mentioned primer labeling method based on fluorescence quenching, which is applied to the field of multi-target detection by combining it with a fluorescent probe method or a fluorescent dye method.

[0018] Preferably, when detecting multiple targets, the target amplification products are identified by labeling primers with different fluorescence and combining the differences in the temperatures corresponding to the inverted peaks on the dissociation curves of different products.

[0019] Preferably, when detecting multiple targets, the differences in different fluorescence (N types) and different product dissociation temperatures (M types) are utilized to generate N*M different combinations.

[0020] Compared with the prior art, the present invention has the following beneficial technical effects:

[0021] The primer labeling method of the present invention is simple, and only requires fluorescent labeling in the C-base-rich region of the common primer or artificially adding the C-base-rich region at the 5' end. Then, the above-mentioned fluorescent-labeled primer is treated with product amplification technology to form a double-stranded DNA structure. Then, the double-stranded DNA structure is dissociated by fluorescence quantitative technology to prepare a dissociation curve. Finally, the above-mentioned inverted dissociation curve is analyzed to obtain the thermodynamic characteristics of the double-stranded dissociation of the primer when the temperature changes. The method has the characteristics of low background signal and good PCR product quenching effect. It can be used in combination with the fluorescent probe method or the fluorescent dye method to effectively broaden the number of targets detected by the classical fluorescent probe technology or the fluorescent dye method. And it does not affect the high sensitivity characteristics of the fluorescent probe method or the fluorescent dye method. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 A method flow chart of an embodiment of the present invention;

[0023] Figure 2 Graph showing the dissociation curves corresponding to different downstream primers in Example 2;

[0024] Figure 3 is the amplification curve diagram of the fluorescent dye method in Example 3;

[0025] Figure 4 is the dissociation curve diagram of the fluorescent dye method in Example 3;

[0026] Figure 5 is an amplification curve diagram of the combined fluorescent probe method in Example 4;

[0027] Figure 6 This is the dissociation curve diagram of the combined fluorescent probe method in Example 4. DETAILED DESCRIPTION

[0028] Example 1

[0029] like Figure 1 As shown, the present invention proposes a primer labeling method based on fluorescence quenching, and the present invention proposes a primer labeling method based on fluorescence quenching, and the steps are as follows:

[0030] S1. Fluorescently label the C-rich region of the primer: the fluorescent labeling position is the C-rich region of the primer itself or the C-rich region artificially added at the 5' end. When the terminal region of the primer is fluorescently labeled, the labeled fluorescent base is C, and the labeled sequence is C*C or C*CC; C* represents the labeled base C. When the internal region of the primer is fluorescently labeled, the labeled fluorescent base is T, and the labeled sequence is CT*C or CCT*CC; T* represents the labeled base T. The C-rich base sequence artificially added to the 5' end of the primer does not need to match the amplification template sequence. The selected fluorescent labeling group is any one of FAM, VIC, HEX, TET, ROX, TAMRA, JOE, Cy3 or Cy5;

[0031] S2, using product amplification technology to treat the above fluorescent labeled primers to form a double-stranded DNA structure, at which time the G base complementary to the C base will quench the fluorescent labeled group;

[0032] S3. Dissociate the double-stranded DNA structure by using fluorescence quantitative technology, so that the G base is away from the corresponding fluorescent labeling group, the quenching effect disappears, and the fluorescent signal is released;

[0033] S4. Prepare a dissociation curve with the help of a quantitative instrument and form an inverted dissociation curve;

[0034] S5. Analyze the above inverted dissociation curve to obtain the thermodynamic characteristics of double-stranded dissociation of the primers when the temperature changes. The temperature corresponding to the peak on the dissociation curve reflects the Tm value of the amplified product.

[0035] The following is an example of a primer sequence (Table 1):

[0036]

[0037]

[0038] Table 1

[0039] Note: * is the marked base, C* is marked on the base C, T* is marked on the base T.

[0040] Example 2

[0041] In this example, human genomic DNA was used as a module, different fluorescent primer labeling schemes were used, and the excellent labeling position was evaluated by dissociation curves.

[0042] 1. Primer sequences and marker positions (Table 2):

[0043] Primer name Primer sequences mark ABL-D1 GGGTCGGCTTACACTGATGT ABL-D2A C*CCACTTCACCCAATGTTGGGGTATT TAMRA ABL-D2B C*CTACTTCACCCAATGTTGGGGTATT TAMRA ABL-D2C CCT*CCTTCACCCAATGTTGGGGTATT TAMRA

[0044] Table 2

[0045] 2. Reaction conditions

[0046] (1) Using 50 ng of human genomic DNA as a template, ABL-D1 was combined with ABL-D2A, ABL-D2B or ABL-D2C. The amounts of amplification reagents and consumables and reaction conditions are shown in Tables 3 and 4:

[0047] Product Name (Manufacturer) Reaction volume Remark KAPAPROBEFAST 10ul Amplification reagents DNA 50ng Amplification template ABL-F 5pmol Upstream primer ABL-R 5pmol Downstream primer ddH2O Add to 20ul

[0048] Table 3

[0049]

[0050] Table 4

[0051] 3. Experimental results and analysis

[0052] After amplification using upstream primer ABL-D1 and downstream primer ABL-D2A, ABL-D2B or ABL-D22C, dissociation curve analysis was performed. There was a significant fluorescence change at around 79°C (Tm value of the amplified product) Figure 2 ). The results show that the fluorescence labeled in the C-rich base region of the primer can achieve an effective dissociation curve, and the quenching efficiency of the preferred labeling positions C*CC and CCT*CC is slightly higher than that of C*C.

[0053] Example 3

[0054] In this example, the ABL1 gene was detected by combining a fluorescent dye method, using human genomic DNA as a module, using the fluorescent dye method to evaluate the abundance of the target gene (ABL1), and using a dissociation curve to evaluate the availability of the labeled primer.

[0055] 1. Primer sequences and marker positions (Table 5):

[0056]

[0057] Table 5

[0058] 3. Reaction conditions

[0059] The amplification reagent was changed to an amplification reagent containing a dye-based fluorescent marker, and the rest was the same as in Example 2.

[0060] 4. Experimental results and analysis

[0061] (1) Amplification curve

[0062] The combined fluorescent dye method detects high coincidence among repeated samples, and the amplification curve has a good "shape". It can effectively quantify the target ( Figure 3 ).

[0063] (2) Dissociation curve

[0064] The dissociation curve is obtained through different fluorescence channels. As the temperature rises, the PCR product dissociates at a specific temperature, and the fluorescence value of the fluorescent dye (SYBR Green) channel decreases rapidly, thus forming a "positive peak", while the fluorescent labeled primer channel forms an "inverted peak" ( Figure 4 ).

[0065] Example 4

[0066] In this example, the abundance of the ABL1 gene was detected by combining a fluorescent probe method. Human genomic DNA was used as a module, the abundance of the target gene (ABL1) was detected by a fluorescent probe method, and the availability of the labeled primer was evaluated by a dissociation curve.

[0067] 1. Primer / probe sequences and marker positions (Table 6)

[0068]

[0069] Table 6

[0070] 2. Reaction conditions

[0071] The amplification system was added with 2.5 pmol of fluorescent probe ABL-DP, and the remaining steps and reagents were the same as those in Example 2.

[0072] 3. Experimental results and analysis

[0073] (1) Amplification curve

[0074] The combined fluorescent probe method detected a high degree of overlap in each repeated sample. The fluorescent probe (FAM) channel had a good "shape" of the amplification curve, which could effectively quantify the target. The fluorescent labeled primer (TAMRA) channel had a flat curve (slightly decreased at the end), no obvious signs of amplification, and no effect on the quantitative (FAM) channel ( Figure 5 ).

[0075] (2) Dissociation curve

[0076] The dissociation curve is obtained through the TAMRA fluorescence channel. As the temperature rises, the PCR product dissociates at a specific temperature, and the fluorescent labeled primer channel forms an "inverted peak". The temperature generated by the "inverted peak" and the TAMRA fluorescence channel can be used to distinguish different targets ( Figure 6 ).

[0077] A primer labeling method and application based on fluorescence quenching proposed in the present invention has the following working principle: since the fluorescent group rich in guanine (G base) can produce a quenching effect by electron transfer. Therefore, by artificially adding or labeling fluorescence at the position rich in C bases in the primer, a double-stranded DNA structure is formed by product amplification technology, and its complementary guanine (G base) will quench the fluorescent group. In the fluorescence quantitative experiment, the double-stranded structure dissociates, the G base is away from the fluorescent group, the quenching effect disappears, and the fluorescent signal is released. This fluorescence release will form a unique "inverted dissociation curve" on a common quantitative instrument, which is significantly different from the morphology of the dissociation curve formed by the conventional dye method and has obvious characteristics. The morphology of the inverted dissociation curve can also accurately reflect the thermodynamic characteristics of the double-stranded dissociation of the primer when the temperature changes, and the temperature corresponding to the peak value can reflect the Tm value of the amplified product. In addition, unlike the fluorescent dye method that non-specifically binds to the double-stranded amplification product, this method uses the fluorescent group labeled on the primer to analyze the dissociation curve, and the dissociation curve has amplification product specificity. When detecting multiple targets, primers can be labeled with different fluorescences, and combined with the different temperatures generated by the "inverted peaks" of different product dissociation curves, the target amplification products can be effectively identified. The differences in different fluorescences (N types) and different product dissociation temperatures (M types) can produce N*M different combinations, greatly expanding the number of targets that can be detected by fluorescence quantitative technology.

[0078] The embodiments of the present invention are described in detail above with reference to the accompanying drawings, but the present invention is not limited thereto, and various changes can be made within the knowledge scope of technicians in the relevant technical field without departing from the purpose of the present invention.

Claims

1. A primer labeling method based on fluorescence quenching, characterized in that: Here are the steps: S1, fluorescent labeling in the C-rich region of the primer; S2, using product amplification technology to treat the above fluorescent labeled primers to form a double-stranded DNA structure, at which time the G base complementary to the C base will quench the fluorescent labeled group; S3. Dissociate the double-stranded DNA structure by using fluorescence quantitative technology, so that the G base is away from the corresponding fluorescent labeling group, the quenching effect disappears, and the fluorescent signal is released; S4. Prepare a dissociation curve with the help of a quantitative instrument and form an inverted dissociation curve; S5. Analyze the above-mentioned inverted dissociation curve to obtain the thermodynamic characteristics of double-stranded dissociation of the primer when the temperature changes.

2. A primer labeling method based on fluorescence quenching according to claim 1, characterized in that: The fluorescent labeling position is the C-rich region of the primer itself or the C-rich region artificially added at the 5' end.

3. A primer labeling method based on fluorescence quenching according to claim 2, characterized in that: When the terminal region of the primer is fluorescently labeled, the labeled fluorescent base is C, and the labeled sequence is C*C or C*CC; C* represents the labeled base C.

4. A primer labeling method based on fluorescence quenching according to claim 2, characterized in that: When the internal region of the primer is fluorescently labeled, the labeled fluorescent base is T, and the labeled sequence is CT*C or CCT*CC; T* represents the labeled base T.

5. A primer labeling method based on fluorescence quenching according to claim 2, characterized in that: The C-rich sequence artificially added to the 5' end of the primer does not need to match the amplification template sequence.

6. A primer labeling method based on fluorescence quenching according to claim 1, characterized in that: The selected fluorescent labeling group is any one of FAM, VIC, HEX, TET, ROX, TAMRA, JOE, Cy3 or Cy5.

7. A primer labeling method based on fluorescence quenching according to claim 1, characterized in that: The temperature corresponding to the peak on the dissociation curve reflects the Tm value of the amplified product.

8. An application of the primer labeling method based on fluorescence quenching according to any one of claims 1 to 7, characterized in that: By combining with fluorescent probe method or fluorescent dye method, it can be applied in the field of multi-target detection.

9. The use of a primer labeling method based on fluorescence quenching according to claim 8, characterized in that: When detecting multiple targets, the target amplification products are identified by labeling the primers with different fluorescence and combining the different temperatures corresponding to the inverted peaks on the dissociation curves of different products.

10. The use of a primer labeling method based on fluorescence quenching according to claim 9, characterized in that: When detecting multiple targets, the differences in different fluorescence and product dissociation temperatures are used to generate a variety of different combinations.

Images