Primer pair and kit for detecting nosema bombycis and nosema nacaka and application of primer pair and kit

Abstract

The invention relates to the technical field of pathogen detection, in particular to a primer pair and a kit for detecting nosema bombycis and nosema nacaka and application of the primer pair and the kit. The primer pair qNSU provided by the invention can simultaneously detect N.bombycis and V.necatrix BM, is strong in specificity, can distinguish N.bombycis and V.necatrix BM according to the length of an amplified fragment, and can also be combined with a specific probe to carry out multiple qPCR, so that the detection of the two microsporidia can be realized in the same detection system, and the primer pair qNSU has the advantages of high sensitivity (the sensitivity is 10fg / mu L to 0.5 pg / mu L), rapidness, accuracy and simplicity in operation, and has a good application prospect. A reliable method is provided for detection and prevention and control of pebrine, convenience is provided for silkworm egg production, and elimination of qualified silkworm eggs is avoided.

Description

Technical Field

[0001] The invention relates to the technical field of pathogen detection, in particular to a primer pair, a kit and applications thereof for detecting Bombyx mori microsporidia and Proteus nakadactyla. Background Art

[0002] Bombyx mori pebrine disease is the most serious epidemic disease in the silkworm industry, causing huge economic losses to the silkworm industry. Its pathogen is Nosema bombycis (N. bombycis), which can not only spread horizontally to cause group infection, but also spread through germs to cause infection in the next generation. In order to effectively control the outbreak of Bombyx mori pebrine disease in silkworm production, all silkworm-raising countries and regions have listed it as the only statutory quarantine object. In the 1860s, Louis Pasteur discovered and used the characteristics of Bombyx mori pebrine disease spread through germs, and established the mother moth microscopic examination method, which eliminated diseased moth eggs and then supplied healthy eggs to ensure the healthy production of the silkworm industry. This detection method has been used since its establishment. As the research progresses, researchers have found that another microsporidian, Vairimorpha necatrix BM (V. necatrix BM), can also infect silkworms and infect groups through horizontal transmission, causing economic losses, but cannot spread through germs to infect the next generation. However, in the silkworm seed production process, it is difficult to distinguish these two microsporidia through morphology, which results in the silkworm eggs of the mother moth being misidentified as diseased moth eggs after being infected with V. necatrixBM, and then being eliminated, affecting the efficiency of silkworm seed production.

[0003] At present, the main method commonly used to identify N. bombycis and V. necatrix BM is to observe the microsporidia in the sample using scanning electron microscopy and transmission electron microscopy technology, and to roughly determine its type by its fine structure and spore size. This method is difficult, the sample preparation is cumbersome, and it requires large-scale precision instruments and professional technicians to complete, making it difficult to promote and use in the sericulture industry. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a primer pair, a kit and an application thereof for detecting N. bombycis and V. necatrix BM. The primer pair provided by the present invention can specifically amplify the ribosomal small subunit of N. bombycis and V. necatrix BM, can distinguish N. bombycis and V. necatrix BM according to the length of the amplified fragment, has the advantages of simple operation and high efficiency, and is suitable for promotion and use in the silkworm industry.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides a primer pair qNSU, comprising qNSU-F and qNSU-R; the nucleotide sequence of the qNSU-F is shown in SEQ ID NO.1; the nucleotide sequence of the qNSU-R is shown in SEQ ID NO.2.

[0007] The present invention provides a kit, comprising the primer pair qNSU and a probe as described in the above technical solution; the probe is labeled with a fluorescent group and a quenching group;

[0008] The probes include one or more of a pNSU probe, a Nosema-pNS225 probe, and a Vairimorpha-pNS225 probe;

[0009] The nucleotide sequences of the pNSU probe, Nosema-pNS225 probe and Vairimorpha-pNS225 probe are shown in SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7, respectively.

[0010] Preferably, the fluorescent group includes CY5, FAM or HEX; the quenching group includes HBQ1 or MGB.

[0011] Preferably, the quenching group and the fluorescent group labeled on the same probe are paired, and the pairing includes: HBQ1 and CY5 pairing, MGB and FAM or HEX pairing.

[0012] Preferably, when there are two or more probes in the kit, the fluorescent groups labeled on different probes are different.

[0013] The present invention provides the use of the primer pair qNSU described in the above technical solution or the kit described in the above technical solution in 1) or 2):

[0014] 1) The direct purpose is non-diagnostic and non-therapeutic detection of Nosema bombycis and / or Vairimorpha necatrix BM;

[0015] 2) Prepare products for detecting Nosema bombyx mori and / or Proteus naka.

[0016] The present invention provides a method for detecting Bombyx mori Nosema and / or Proteus nakataensis for non-diagnostic and non-therapeutic purposes, comprising the following steps:

[0017] Using the genomic DNA of the sample to be tested as a template, qNSU is amplified by PCR using the primers described in the above technical solution to obtain an amplified product; judging based on the size of the amplified product:

[0018] When the size of the amplified product is 225 bp, the sample to be tested contains B. mori nematodes;

[0019] When the size of the amplified product is 241 bp, the sample to be tested contains Nakamoproteus.

[0020] The present invention provides a method for detecting Bombyx mori Nosema and / or Proteus nakataensis for non-diagnostic and non-therapeutic purposes using the kit described in the above technical solution, comprising the following steps:

[0021] Using the genomic DNA of the sample to be tested as a template, qPCR amplification is performed using the primer pair qNSU and the probe in the kit, wherein the qPCR amplification is single-plex qPCR amplification or multiplex qPCR amplification, and the primer pair qNSU is the primer pair qNSU described in the above technical solution or the primer pair qNSU in the kit; determining the detection result of the probe according to the amplification result:

[0022] When the amplification result of the sample to be tested has a specific amplification curve and the Ct value is ≤38, the detection result of the probe is positive; when the amplification result of the sample to be tested has no specific amplification curve or no Ct value, the detection result of the probe is negative;

[0023] When the amplification result of the sample to be tested has a specific amplification curve, and 38<Ct value≤40, the sample to be tested is preliminarily determined to be a positive suspected sample; the positive suspected sample is retested, and when a specific amplification curve appears in the retest, and the Ct value is ≤40, the detection result of the probe is positive; when there is no Ct value or no specific amplification curve in the retest, the detection result of the probe is negative;

[0024] Determine whether the sample to be tested contains Nosema bombyx mori and / or Proteus naka according to the detection results of the probe:

[0025] When the detection result of the pNSU probe is positive, the sample to be tested contains Bombyx mori and / or Proteus nakamura; when the detection result of the pNSU probe is negative, the sample to be tested does not contain Bombyx mori and Proteus nakamura;

[0026] When the detection result of the Nosema-pNS225 probe is positive, the sample to be tested contains Bombyx mori microparticles; when the detection result of the Nosema-pNS225 probe is negative, the sample to be tested does not contain Bombyx mori microparticles;

[0027] When the detection result of the Vairimorpha-pNS225 probe is positive, the sample to be tested contains Nakamomorpha; when the detection result of the Vairimorpha-pNS225 probe is negative, the sample to be tested does not contain Nakamomorpha.

[0028] Preferably, the reaction procedure of the qPCR amplification is: 37°C for 2 min, 95°C for 30 s; 40 cycles, the conditions of each cycle are 95°C for 20 s, 60°C for 30 s, and fluorescence is collected.

[0029] Preferably, when the multiplex qPCR amplification is dual qPCR amplification, the reaction system of the dual qPCR amplification is: 18.5 μL qPCR reaction solution, 0.5 μL qNSU-F, 0.5 μL qNSU-R, 0.25 μL of each of the two probes and 5 μL of template; when the multiplex qPCR amplification is triple qPCR amplification, the reaction system of the triple qPCR amplification is: 18.25 μL qPCR reaction solution, 0.5 μL qNSU-F, 0.5 μL qNSU-R, 0.25 μL of pNSU probe, 0.25 μL of Nosema-pNS225 probe, 0.25 μL of Vairimorpha-pNS225 probe and 5 μL of template.

[0030] Beneficial effects:

[0031] The invention provides a primer pair qNSU, comprising qNSU-F and qNSU-R; the nucleotide sequence of the qNSU-F is shown in SEQ ID NO.1; the nucleotide sequence of the qNSU-R is shown in SEQ ID NO.2. The primer pair qNSU provided by the invention takes the ribosomal small subunit sequence of N. bombycis and V. necatrix BM as a target, and is designed to obtain a broad-spectrum primer capable of simultaneously detecting N. bombycis and V. necatrix BM, has strong specificity, can only amplify the genomic DNA of N. bombycis and V. necatrix BM, and cannot amplify other pathogens of silkworm (including Enterococcus faecalis, Bacillus thuringiensis, Beauveria bassiana, Bombyx mori nuclear polyhedrosis virus, Bombyx mori densovirus and Bombyx mori epidemic malarial virus), can distinguish N. bombycis and V. necatrix BM according to the length of the amplified fragment, is easy to operate, has high detection efficiency, and is suitable for popularization and use in the silkworm industry.

[0032] Further, the kit provided by the present invention contains the primer pair qNSU and probe of the above technical solution, and the probe includes one or more of the pNSU probe, the Nosema-pNS225 probe and the Vairimorpha-pNS225 probe. Among them, the pNSU probe can detect N.bombycis and V.necatrixBM at the same time, with higher sensitivity, and can be used to detect whether the silkworm is infected by microsporidia during the breeding process, so as to avoid the microsporidia infecting the silkworm and causing group infection through horizontal transmission, thereby causing losses in silkworm production; the Nosema-pNS225 probe can only specifically detect N.bombycis, and can be used for the detection of mother moths and silkworm eggs during the production of silkworm seeds, so as to avoid the elimination of healthy eggs; the Vairimorpha-pNS225 probe can only specifically detect V.necatrix BM, and can be used for the detection and differentiation of microsporidia during silkworm seed production and silkworm breeding, as well as for detecting whether the silkworm is infected by microsporidia during the breeding process, so as to avoid the microsporidia infecting the silkworm and causing group infection through horizontal transmission, thereby causing losses in silkworm production. The above three probes can also be used in combination for multiplex qPCR (2-plex or 3-plex), so that the detection of two microsporidia can be achieved in the same detection system, which has the advantages of high sensitivity (sensitivity of 10fg / μL to 0.5pg / μL), rapidity, accuracy and simple operation. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0034] Figure 1 The electrophoresis results verify the broad spectrum and specificity of qNSU primers;

[0035] Figure 2 The electrophoresis results are for verification of the broad spectrum of qNM 183 primers;

[0036] Figure 3 This is the specificity verification result of the broad-spectrum probe (pNSU);

[0037] Figure 4 This is the specificity verification result of the N. bombycis specific probe (Nosema-pNS225);

[0038] Figure 5 This is the specificity verification result of the V.necatrix BM-specific probe (Vairimorpha-pNS225);

[0039] Figure 6 The results of qPCR sensitivity tests of different probes;

[0040] Figure 7 This is the result of triple qPCR sensitivity test;

[0041] Figure 8 The electrophoresis results are for the verification of the specificity of the qN RPB1-269 primer;

[0042] Fig. 9 This is the result of the qN RPB1-269 primer sensitivity test;

[0043] Fig.10 The electrophoresis results are for the specific verification of the qV RPB1-252 probe;

[0044] Fig.11 This is the sensitivity test result of qV RPB1-252 probe;

[0045] Fig.12 The sensitivity test results of dual qPCR of pNSU probe and Nosema-pNS225 probe;

[0046] Fig.13 The sensitivity test results of dual qPCR of pNSU probe and Vairimorpha-pNS225 probe;

[0047] Fig.14 The sensitivity test results of dual qPCR of Nosema-pNS225 probe and Vairimorpha-pNS225 probe are shown in Figure 2. DETAILED DESCRIPTION

[0048] The present invention provides a primer pair qNSU, comprising qNSU-F and qNSU-R; the nucleotide sequence of the qNSU-F is shown in SEQ ID NO.1; the nucleotide sequence of the qNSU-R is shown in SEQ ID NO.2.

[0049] The primer pair qNSU provided by the invention can detect N. bombycis and V. necatrix BM simultaneously, has strong specificity, can distinguish N. bombycis and V. necatrix BM according to the length of the amplified fragment, has simple operation and high detection efficiency, and is suitable for popularization and use in the sericulture industry.

[0050] The present invention provides a kit, comprising the primer pair qNSU and a probe as described in the above technical solution; the probe is labeled with a fluorescent group and a quenching group;

[0051] The probes include one or more of a pNSU probe, a Nosema-pNS225 probe, and a Vairimorpha-pNS225 probe;

[0052] The nucleotide sequences of the pNSU probe, Nosema-pNS225 probe and Vairimorpha-pNS225 probe are shown in SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7, respectively.

[0053] As an embodiment, the fluorescent group includes CY5, FAM or HEX; the quencher group includes HBQ1 or MGB. As an embodiment, the quencher group and the fluorescent group labeled on the same probe are paired, and the pairing includes: HBQ1 and CY5 are paired, and MGB is paired with FAM or HEX.

[0054] As an embodiment, when there are more than two probes in the kit, the fluorescent groups labeled on different probes are different. By labeling different fluorescent groups on different probes, the present invention can enable multiple probes to perform multiple qPCR reactions in the same reaction system, thereby improving detection efficiency.

[0055] The pNSU probe in the kit provided by the present invention can detect N. bombycis and V. necatrix BM at the same time, has higher sensitivity than that of the Nosema-pNS225 probe and the Vairimorpha-pNS225 probe, and can be used to detect whether the silkworm is infected by microsporidia during the breeding process, so as to avoid the microsporidia infecting the silkworm and causing group infection through horizontal transmission, thereby causing losses in the silkworm production; the Nosema-pNS225 probe can only specifically detect N. bombycis, and can be used to detect mother moths and silkworm eggs during the silkworm seed production process, so as to avoid the elimination of healthy eggs; the Vairimorpha-pNS225 probe can only specifically detect V. necatrix BM, and can be used to detect and distinguish microsporidia during silkworm seed production and silkworm breeding, and to detect whether the silkworm is infected by microsporidia during the breeding process, so as to avoid the microsporidia infecting the silkworm and causing group infection through horizontal transmission, thereby causing losses in the silkworm production. The above three probes can also be used in combination for multiplex qPCR (2-plex or 3-plex), so that the detection of two microsporidia can be achieved in the same detection system, which has the advantages of high sensitivity (sensitivity of 10fg / μL to 0.5pg / μL), rapidity, accuracy and simple operation.

[0056] Based on the above advantages, the present invention provides the use of the primer pair qNSU described in the above technical solution or the kit described in the above technical solution in 1) or 2): 1) the direct purpose is non-diagnostic and non-therapeutic detection of Bombyx mori and / or Nakaproteus; 2) preparation of products for detecting Bombyx mori and / or Nakaproteus. The present invention can use the primer pair qNSU described in the above technical solution or the kit described in the above technical solution to detect whether mulberry leaves, feed, silkworm seats and other silkworm breeding environments contain Bombyx mori and / or Nakaproteus, with the direct purpose being non-diagnostic and non-therapeutic.

[0057] Based on the above advantages, the present invention provides a method for detecting Bombyx mori Nosema and / or Proteus nakata for non-diagnostic and non-therapeutic purposes, comprising the following steps:

[0058] Using the genomic DNA of the sample to be tested as a template, qNSU is amplified by PCR using the primers described in the above technical solution to obtain an amplified product; judging based on the size of the amplified product:

[0059] When the size of the amplified product is 225 bp, the sample to be tested contains B. mori nematodes;

[0060] When the size of the amplified product is 241 bp, the sample to be tested contains Nakamoproteus.

[0061] As an embodiment, the nucleotide sequence of the amplified product obtained by amplifying Bombyx mori Nosema with the primer pair qNSU is shown in SEQ ID NO.16, which is as follows:

[0062] 5'-GAATACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCG GGGTAATTTACCAGGTATAACATGGTATAATATTTTATCATGATAGTGGTGCATGGCCGTTTCCAATGGATGCTGTGAAGTAATGATTAATTTCAACAAGATGTGAGACCCTCATTTAGACAGATGTAGTGATACATATGAAGGAGAGGATTAAAACAGGTCCGTTATGCCCTAAGATA-3';

[0063] As an embodiment, the nucleotide sequence of the amplified product obtained by amplifying Nakamoproteus by the primer pair qNSU is shown in SEQ ID NO.17, which is as follows:

[0064] 5'-GAATACCACAAGGAGTGGATTGTGCGGCTTAATTTGACTCAACGCG AGGTAACTTACCAATATTTTATTCGGAGAAGATTTTTAATCTGAGAATGATAATAGTGGTGCATGGCCGTTTTCAATGGATGCTGTGAAGTTTTGATTAATTTCAACAAGACGTGAGACCCTTTTATTAATAGACAGACACAATCAGTGTAGGAAGGAAAGGATTAAAACAGGTCCGTTATGCCCTCAGACA-3'.

[0065] As an embodiment, the method for determining the size of the amplified product includes electrophoresis or sequencing. As another embodiment, the electrophoresis includes agarose gel electrophoresis or polyacrylamide gel electrophoresis (SDS-PAGE).

[0066] The present invention provides a method for detecting Bombyx mori Nosema and / or Proteus nakataensis for non-diagnostic and non-therapeutic purposes using the kit described in the above technical solution, comprising the following steps:

[0067] Using the genomic DNA of the sample to be tested as a template, qPCR amplification is performed using the primer pair qNSU and the probe in the kit, wherein the qPCR amplification is single-plex qPCR amplification or multiplex qPCR amplification, and the primer pair qNSU is the primer pair qNSU described in the above technical solution or the primer pair qNSU in the kit; determining the detection result of the probe according to the amplification result:

[0068] When the amplification result of the sample to be tested has a specific amplification curve and the Ct value is ≤38, the detection result of the probe is positive; when the amplification result of the sample to be tested has no specific amplification curve or no Ct value, the detection result of the probe is negative;

[0069] When the amplification result of the sample to be tested has a specific amplification curve, and 38<Ct value≤40, the sample to be tested is preliminarily determined to be a positive suspected sample; the positive suspected sample is retested, and when a specific amplification curve appears in the retest, and the Ct value is ≤40, the detection result of the probe is positive; when there is no Ct value or no specific amplification curve in the retest, the detection result of the probe is negative;

[0070] Determine whether the sample to be tested contains Nosema bombyx mori and / or Proteus naka according to the detection results of the probe:

[0071] When the detection result of the pNSU probe is positive, the sample to be tested contains Bombyx mori and / or Proteus nakamura; when the detection result of the pNSU probe is negative, the sample to be tested does not contain Bombyx mori and Proteus nakamura;

[0072] When the detection result of the Nosema-pNS225 probe is positive, the sample to be tested contains Bombyx mori microparticles; when the detection result of the Nosema-pNS225 probe is negative, the sample to be tested does not contain Bombyx mori microparticles;

[0073] When the detection result of the Vairimorpha-pNS225 probe is positive, the sample to be tested contains Nakamomorpha; when the detection result of the Vairimorpha-pNS225 probe is negative, the sample to be tested does not contain Nakamomorpha.

[0074] As an embodiment, the reaction procedure of the qPCR amplification is: 37°C for 2 min, 95°C for 30 s; 40 cycles, the conditions of each cycle are 95°C for 20 s, 60°C for 30 s, and fluorescence is collected.

[0075] As an embodiment, when the multiplex qPCR amplification is a dual qPCR amplification, the reaction system of the dual qPCR amplification is: 18.5 μL qPCR reaction solution, 0.5 μL qNSU-F, 0.5 μL qNSU-R, 0.25 μL of each of the two probes and 5 μL of template; when the multiplex qPCR amplification is a triple qPCR amplification, the reaction system of the triple qPCR amplification is: 18.25 μL qPCR reaction solution, 0.5 μL qNSU-F, 0.5 μL qNSU-R, 0.25 μL of pNSU probe, 0.25 μL of Nosema-pNS225 probe, 0.25 μL of Vairimorpha-pNS225 probe and 5 μL of template.

[0076] The above technical solution describes that determining whether the sample to be tested contains Bombyx mori and / or Proteus naka according to the detection results of the probes only lists the judgment criteria for using different probes alone or in combination, and it cannot be understood as the protection scope of using the three probes in combination. When used specifically, different probes can be used alone or in combination according to the purpose of detection, and single-plex qPCR or multiplex qPCR can be performed in combination with the above judgment criteria, including:

[0077] 1) When detecting whether the mother moth or silkworm eggs are infected by microsporidia during the silkworm breeding process, or whether the sample to be tested (such as mulberry leaves, feed, silkworm seats and other silkworm breeding environments) contains microsporidia, there is no need to distinguish between Bombyx mori and Nakamorpha, one or more of the pNSU probe, Nosema-pNS225 probe and Vairimorpha-pNS225 probe can be used to perform single-plex qPCR or multiplex qPCR, and the judgment can be made according to the above judgment criteria;

[0078] 2) When used for the detection of mother moths and silkworm eggs in the silkworm seed production process to avoid the elimination of healthy eggs, a combination of pNSU probe and Nosema-pNS225 probe, or a combination of Nosema-pNS225 probe and Vairimorpha-pNS225 probe, or a combination of pNSU probe, Nosema-pNS225 probe and Vairimorpha-pNS225 probe can be used to perform single-plex qPCR or multiplex qPCR, and judgment is made according to the above judgment criteria. When the combination of pNSU probe and Nosema-pNS225 probe is used, only when the test result of pNSU probe is positive and the test result of Nosema-pNS225 probe is negative, it can be judged that the sample to be tested contains or is only infected with Nakamorpha, thereby avoiding the elimination of healthy eggs.

[0079] 3) When detecting whether mother moths or silkworm eggs are infected by Bombyx mori during silkworm breeding, or whether the sample to be tested (mulberry leaves, feed, silkworm breeding environment such as silkworm beds) contains Bombyx mori, to avoid horizontal or vertical transmission causing group infection, a combination of pNSU probe and Vairimorpha-pNS225 probe, or a combination of Nosema-pNS225 probe and Vairimorpha-pNS225 probe, or a combination of pNSU probe, Nosema-pNS225 probe and Vairimorpha-pNS225 probe can be used to perform single-plex qPCR or multiplex qPCR, and judgment is made according to the above judgment criteria, wherein when the combination of pNSU probe and Vairimorpha-pNS225 probe is used, only when the detection result of pNSU probe is positive and the detection result of Vairimorpha-pNS225 probe is negative, it can be judged that the sample to be tested only contains or is only infected with Bombyx mori.

[0080] The method provided by the present invention is a method for detecting Bombyx mori microsporidia and / or N. bombycis BM based on single-plex qPCR amplification or multiple-plex qPCR amplification, which can quickly detect whether the sample to be tested is infected with N. bombycis or V. necatrix BM, especially multiple-plex qPCR can quickly detect whether the sample to be tested is infected with N. bombycis or V. necatrix BM at one time, and can simultaneously identify the type of infected microsporidia, which not only provides a reliable method for the detection and prevention of microsporidia, but also provides convenience for silkworm seed production and avoids the elimination of qualified silkworm seeds.

[0081] To further illustrate the present invention, the primer pairs, kits and applications thereof for detecting Bombyx mori Nosema and Nakaproteus provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0082] Preparation Example

[0083] The pathogens used in the following examples and comparative examples (Bombyx mori, Microsporidia nakamoe, Enterococcus faecalis, Bacillus thuringiensis, Beauveria bassiana, Bombyx mori densovirus and Bombyx mori epidemic malarial virus) were collected and identified by the inventors of the present application according to conventional methods.

[0084] Among them, Bombyx mori microsporidia is disclosed in the literature [Pan G., Xu J., Tian L., Xia Q., Liu SL, Zhang G., Li S., Li C., Liu H., Liu Y. Comparative genomics of parasitic silkworm microsporidia reveal an association between genome expansion and host adaptation [J]. Bmc Genomics, 2013, 14 (1): 186-186.].

[0085] Nakamomorpha is disclosed in the literature [Meng XZ, Luo B., Tang XY, He Q., Xiong T.R., Fang ZY, Pan G., Li T., Zhou ZYPathological analysis of silkworm infected by two microsporidia Nosema bombycis CQ1 and Vairimorpha necatrix BM[J]. Journal of Invertebrate Pathology, 2017: S0022201117303026.]

[0086] Bombyx mori nuclear polyhedrosis virus is disclosed in the literature [Fan Y., Bao J., Fu X., Wu P., Chen J., Huang Y., Wei J., Pan G., Li C., Zhou Z. The NPC Families Mediate BmNPV Entry[J]. Microbiol Spectr, 2022, 10(4): e0091722.].

[0087] Example 1

[0088] 1. Primer design and verification

[0089] Primer qNSU targeting the N. bombycis ribosomal small subunit sequence and the V. necatrix BM ribosomal small subunit sequence was designed and synthesized. The primer sequences are as follows:

[0090] qNSU-F: 5'-GAATACCACAAGGAGTGGA-3' (SEQ ID NO. 1);

[0091] qNSU-R: 5'-TATCTTAGGGCATAACGGA-3' (SEQ ID NO. 2);

[0092] Primer qNM 183 targeting the N. bombycis hypothetical protein gene was designed and synthesized. The primer sequence is as follows:

[0093] qNM 183-F: 5'-GAAATCAATCCATCTCAAC-3' (SEQ ID NO. 3);

[0094] qNM 183-R: 5'-AAGACAGCCTATCACAAAC-3' (SEQ ID NO. 4).

[0095] 1.1 Verification of the broad spectrum of primers

[0096] 1) N. bombycis and V. necatrix BM genome extraction: centrifuge at 3500rpm for 5min, discard the supernatant, and enrich the microsporidia; add 500μL 2% CTAB and 25μL proteinase K, mix thoroughly, and incubate at 56℃ for 2h; the incubated sample is cooled to room temperature, an equal volume of genome extraction solution is added, vortexed and centrifuged at 12000rpm for 10min at 4℃; the upper layer is transferred to a new 1.5mL centrifuge tube, an equal volume of genome extraction solution is added again, vortexed and centrifuged at 12000rpm for 10min at 4℃; the upper layer is transferred to a new 1.5mL centrifuge tube, 0.8 times the volume of isopropanol is added, gently inverted and mixed 5 times, and placed at -20℃ for 30min; centrifuged at 12000rpm for 10min and the supernatant is removed; add 500μL Mix 75% ethanol by inversion for 3 times; centrifuge at 12000 rpm for 5 min and remove the supernatant; open the cap of the 1.5 mL centrifuge tube, and add 50 μL ddH2O to dissolve the genome after all the ethanol has evaporated.

[0097] 2) PCR verification: Use the primers designed in step 1, N. bombycis and V. necatrix BM genomes as templates, and ddH2O as a negative control to perform PCR amplification. Perform gel electrophoresis on the amplified products to verify the broad spectrum of the primers.

[0098] The reaction system is: 12.5μL amplification buffer, 2.5μL 10× high specificity buffer, 0.5μL TaKaRa DNA polymerase (TaKaRa-bio, Japan), 1 μL each of upstream and downstream primers, 1 μL genomic DNA template, and 8 μL ddH2O;

[0099] The reaction procedure was as follows: pre-denaturation at 98°C for 2 min; denaturation at 98°C for 10 s, annealing at 56°C for 15 s, extension at 68°C for 20 s, 30 cycles; and final extension at 68°C for 3 min.

[0100] The results are as follows Figure 1 Middle A and Figure 2 As shown in the results, only the primer qNSU designed for the small ribosomal subunit can simultaneously detect N. bombycis (amplified product size is 225bp) and V. necatrix BM (amplified product size is 241bp), which can be used for the detection of microsporidia in the silkworm industry.

[0101] 1.2 Primer specificity verification

[0102] Other pathogens of silkworm were selected for primer specificity verification, including Enterococcus faecalis, Bacillus thuringiensis, Beauveria bassiana, Bombyx mori nuclear polyhedrosis virus, Bombyx mori densovirus and Bombyx mori epidemic malarial virus.

[0103] (1) Enterococcus faecalis, Bacillus thuringiensis, and Beauveria bassiana genomes: the same procedure as in step 1.1 for extracting microsporidian genomes;

[0104] (2) Extraction of the genome of Bombyx mori nuclear polyhedrosis virus and Bombyx mori densovirus:

[0105] Take 200 μL of virus suspension, add 500 μL of 2% CTAB and 25 μL of proteinase K, mix thoroughly and incubate at 56°C for 2 h; the subsequent extraction steps are the same as the microsporidia genome extraction steps in step 1.1;

[0106] (3) Obtaining cDNA of Bombyx mori epidemic malarial virus: Take 200 μL of virus suspension, extract RNA using Trizol method, and convert it into cDNA according to conventional methods.

[0107] Using the primer qNSU in step 1, the genomes of Enterococcus faecalis, Bacillus thuringiensis, Beauveria bassiana, Bombyx mori nuclear polyhedrosis virus and Bombyx mori densovirus, and the cDNA of Bombyx mori epidemic malarial virus were used as templates, and ddH2O was used as a negative control. PCR amplification was performed. The amplification system and amplification procedure were the same as those in step 1.1. 2). The amplified products were subjected to gel electrophoresis. The results are shown in FIG. Figure 1 Middle B.

[0108] The results showed that qNSU could only amplify N. bombycis but not other pathogens of silkworm, indicating that the primer had high specificity and could be used for the detection of microsporidia in silkworm.

[0109] Example 2

[0110] qPCR probe design and validation

[0111] The genomic DNA of N. bombycis and V. necatrix BM were used as templates, respectively, and the primer qNSU in Example 1 was used for amplification. Broad-spectrum detection probes were designed for the conserved regions of N. bombycis and V. necatrix BM in the amplified products. The probe sequences were:

[0112] pNSU: 5'-TGTGCGGCTTAATTTGACTCAACCC-3' (SEQ ID NO. 5), labeled with CY5 at the 5' end and HBQ1 at the 3' end;

[0113] A specific probe for detecting N. bombycis was designed based on the N. bombycis specific sequence in the amplified product. The probe sequence is:

[0114] Nosema-pNS225: 5'-ATATGTATCACTACATCTGTCTA-3' (SEQ ID NO. 6), labeled with FAM at the 5' end and MGB at the 3' end;

[0115] A specific probe for detecting V.necatrix BM was designed based on the specific sequence of V.necatrix BM in the amplified product. The probe sequence is:

[0116] Vairimorpha-pNS225: 5'-CCTACACTGATTGTGTCTGTC-3' (SEQ ID NO. 7), labeled with HEX at the 5' end and with MGB at the 3' end.

[0117] 2.1 Probe broad spectrum and specificity verification

[0118] The specificity of each probe was verified using N. bombycis and V. necatrix BM genomic DNA as templates and ddH2O as negative control:

[0119] The template to be tested was added to the qPCR amplification reaction system, and the reaction system was as follows: 18.75 μL qPCR reaction solution, 0.5 μL qNSU-F, 0.5 μL qNSU-R, 0.25 μL probe and 5 μL template;

[0120] The reaction program was: 37°C for 2 min, 95°C for 30 s, and 40 cycles (95°C for 20 s, 60°C for 30 s to collect fluorescence).

[0121] Result analysis:

[0122] Under the Cy5, FAM, and HEX signal channels, if the amplification result of the sample has a specific amplification curve and the Ct value is ≤38, it is judged as positive; if the amplification result of the sample has no specific amplification curve or no Ct value, it is judged as negative;

[0123] When the amplification result of the sample has a specific amplification curve and the Ct value is 38<Ct value≤40, it is preliminarily judged as a positive suspected sample;

[0124] The samples initially judged suspicious were retested. When the Ct value of the retest was ≤40 and a specific amplification curve appeared, it was finally judged as positive. When the retest result showed no Ct value or specific amplification curve, it was finally judged as negative.

[0125] Results Figures 3 to 5The broad-spectrum probe (pNSU) can simultaneously detect N. bombycis and V. necatrix BM ( Figure 3 ), the N. bombycis-specific probe (Nosema-pNS225) can only detect N. bombycis ( Figure 4 ), the V.necatrix BM-specific probe (Vairimorpha-pNS225) can only detect V.necatrixBM ( Figure 5 ).

[0126] 2.2 qPCR sensitivity verification

[0127] The genomic DNA of N. bombycis and V. necatrix BM were diluted 10-fold from 1 ng / μL to 1 fg / μL and used as templates for qPCR amplification. ddH2O was used as negative control (denoted as N) to verify the detection sensitivity. The genomic DNA used for the broad-spectrum probe (pNSU) was the diluted N. bombycis. The qPCR amplification system and amplification procedure were the same as in step 2.1. The results are shown in Figure 6 .

[0128] The results show that the detection sensitivity of the broad-spectrum probe (pNSU) and the N. bombycis-specific probe (Nosema-pNS225) is 100fg / μL genomic DNA, which is equivalent to the genome extracted from 10 spores; the detection sensitivity of the V. necatrix BM-specific probe (Vairimorpha-pNS225) is 10fg / μL genomic DNA, which is equivalent to the genome extracted from 1 spore. It can be seen that the probe provided by the present invention has high sensitivity and can be used for the detection and quarantine of N. bombycis and V. necatrix BM in the process of sericulture and silkworm seed production.

[0129] 2.3 Triple qPCR detection sensitivity verification

[0130] In order to improve the detection efficiency, the three designed probes are used in the same detection system, so that it can not only detect whether there is microsporidia infection, but also determine the type of microsporidia infection at the same time.

[0131] After gradient dilution of N. bombycis and V. necatrix BM genomic DNA (1 ng / μL to 1 fg / μL), the two genomic DNAs of the same concentration were mixed at a volume ratio of 1:1 as the detection template, and ddH2O was used as the negative control (denoted as N).

[0132] The reaction system was: 18.25 μL qPCR reaction solution, 0.5 μL qNSU-F, 0.5 μL qNSU-R, 0.25 μL of each of the three probes and 5 μL template; the reaction program was: 37°C for 2 min, 95°C for 30 s; 40 cycles (95°C for 20 s, 60°C for 30 s to collect fluorescence).

[0133] The results are as follows Figure 7 As shown, the concentration on the horizontal axis is the concentration of the two genomic DNAs before mixing. In the same reaction system, the three probes can successfully collect fluorescence under the Cy5, FAM and HEX signal channels respectively, with high sensitivity. The detection sensitivity of the pNSU probe is 100fg / μL, the detection sensitivity of the Vairimorpha-pNS225 probe is 50fg / μL, and the detection sensitivity of the Nosema-pNS225 probe is 0.5pg / μL.

[0134] Example 3 Triple qPCR detection of infected female moths

[0135] The present invention collects 8 samples of mother moths infected with microsporidia (microsporidia are found under microscope) for microsporidia detection and identification of the infected species of microsporidia, and compares the qPCR results with the sequencing results.

[0136] 1) Extraction of genomic DNA from mother moth samples: Take 200 μL of mother moth grinding liquid, add 500 μL of 2% CTAB, 25 μL of proteinase K, mix thoroughly and incubate at 56°C for 15 min; after incubation, centrifuge at 12000 rpm for 3 min, transfer the supernatant to a new nucleic acid extraction column; add 700 μL of 75% ethanol, centrifuge at 12000 rpm for 1 min, repeat once and empty for 2 min; transfer the nucleic acid adsorption column to a new 1.5 mL centrifuge tube, add 50 μL ddH2O; centrifuge at 12000 rpm for 1 min, elute the genomic DNA into a 1.5 mL centrifuge tube, and complete the genomic DNA extraction.

[0137] 2) Triple qPCR detection and sequencing analysis of amplified products: Part of the genomic DNA was used for triple qPCR detection, and the other part was used for sequencing analysis. The amplification system and procedure for triple qPCR detection were the same as step 2.3 in the example.

[0138] 3) The main steps of sequencing analysis are:

[0139] The full-length universal primers for the small subunit of the microsporidia ribosome were selected, and the primer sequences were as follows:

[0140] qNSU-F1: 5'-CACCAGGTTGATTCTGCC-3' (SEQ ID NO. 8);

[0141] qNSU-R1: 5'-TTATGATCCTGCTAATGGTTC-3' (SEQ ID NO. 9);

[0142] The above-mentioned genomic DNA was used as a template, and PCR amplification was performed according to the amplification procedure and amplification system in step 1.1 of Example 1; the PCR amplification product was detected by nucleic acid gel, and a single DNA fragment at 1200-1300 bp was recovered;

[0143] The recovered DNA was connected to the pMD19-T vector, transformed into DH5α competent cells, and then spread on LB solid culture plates containing Amp resistance and inverted culture at 37°C overnight;

[0144] Pick 8 single colonies and inoculate them into 300 μL LB liquid culture medium containing Amp resistance; after culturing for 4 hours, perform electrophoresis on the bacterial solution;

[0145] The bacterial solution in which the DNA fragment was successfully connected to pMD19-T was selected for DNA sequencing, and the sequencing results were submitted to the NCBI website for comparison.

[0146] Result analysis:

[0147] The results are shown in Table 1. The triple qPCR test found that N. bombycis and V. necatrix BM could be detected in samples 1, 3, 4, and 5 at the same time, of which 1, 3, and 4 were mainly V. necatrix BM, and sample 5 was mainly N. bombycis. Only V. necatrix was present in sample 2, and only N. bombycis was present in samples 6, 7, and 8. The triple qPCR and sequencing results of samples 2, 4, 5, 6, 7, and 8 were consistent, while the triple qPCR test of samples 1 and 3 detected one more pathogen than the sequencing method. The sequencing method is mainly based on the common PCR amplification, and then the successfully amplified fragments are connected to the vector to make monoclonal colonies for sequencing. Therefore, the comprehensiveness of its pathogen identification is affected by the common PCR amplification results and the number of monoclonal colonies selected. In the present invention, 30 cycles of common PCR amplification are performed with universal primers for small ribosomal subunits. Therefore, when the amount of pathogens in the sample to be tested is small, the successful amplification has a certain randomness, especially for pathogen nucleic acids with Ct≥30 during qPCR detection. In the present invention, only 8 monoclonal colonies successfully transferred into the plasmid are randomly selected for sequencing. When selecting monoclonal colonies, the small number may lead to missed selection. Therefore, the accuracy, comprehensiveness and sensitivity of triple qPCR in identifying N. bombycis and V. necatrix BM are higher than those of sequencing.

[0148] Table 1 Ct values ​​of triple qPCR detection of female moth samples and sequencing verification results

[0149] Sample No. 1 2 3 4 5 6 7 8 pV 29.18 23.38 26.79 25.5 25.86 24.23 17.99 22.36 Vairimorpha-pNS225 29.8 23.56 27.04 25.71 30.08 0 0 0 Nosema-pNS225 31.9 0 33.86 36.89 25.18 23.29 17.45 21.41 Sequencing results Vn Vn Vn Vn; Nb Nb; Vn Nb Nb Nb

[0150] Note: Vn in Table 1 is V.necatrixBM and Nb is N.Bombycis.

[0151] Comparative Example 1

[0152] Targeting the RPB1 gene of N. bombycis, primer qN RPB1-269 was designed and synthesized. The primer sequence is as follows:

[0153] qN RPB1-269-F: 5'-TGCCATTAGTATGTTCCA-3' (SEQ ID NO. 10);

[0154] qN RPB1-269-R: 5'-TAGCAGGTTCTCCTACAC-3' (SEQ ID NO. 11).

[0155] PCR amplification was performed using N. bombycis and V. necatrix BM genomic DNA as templates and ddH2O as a negative control to verify the broad spectrum of primer qN RPB1-269; the amplification system and amplification procedure were the same as step 1.1 in Example 1. The results are shown in Figure 8 As shown, qN RPB1-269 can only detect N. bombycis, but cannot detect N. bombycis and V. necatrixBM at the same time.

[0156] The probe was designed based on the qN RPB1-269 amplified sequence. The probe sequence is as follows:

[0157] pRPB1269: 5'-TCCAGTGGGTGATGT-3' (SEQ ID NO. 12), labeled with FAM at the 5' end and MGB at the 3' end.

[0158] qPCR sensitivity test

[0159] The genomic DNA of N. bombycis was diluted 10-fold from 10 ng / μL to 10 fg / μL and used as a qPCR amplification template. ddH2O was used as a negative control (denoted as N). qN RPB1-269 was used as a primer and pRPB1269 was used as a probe to perform qPCR amplification to test its detection sensitivity. The qPCR amplification system and amplification procedure were the same as step 2.1 in Example 2.

[0160] The results are as follows Fig. 9As shown, the sensitivity of the primer probe is 1 pg / μL, which is 10 times lower than the sensitivity (100 fg / μL) of the qNSU primer combined with the N. bombycis specific probe (Nosema-pNS225) in Example 2 of the present invention.

[0161] Comparative Example 2

[0162] For the RPB1 gene of V.necatrix BM, primer qV RPB1-252 was designed and synthesized, and the primer sequence is as follows:

[0163] qV RPB1-252-F: 5'-TGGCAGATATTGTGAAAGC-3' (SEQ ID NO. 13);

[0164] qV RPB1-252-R: 5'-TGGCACTGAAATCTACCCT-3' (SEQ ID NO. 14).

[0165] PCR amplification was performed using N. bombycis and V. necatrix BM genomic DNA as templates and ddH2O as a negative control to verify the broad spectrum of the primers; the amplification system and amplification procedure were the same as step 1.1 in Example 1.

[0166] The results are as follows Fig.10 As shown, qV RPB1-252 could only detect V. necatrix BM, and could not detect N. bombycis and V. necatrix BM simultaneously.

[0167] The probe was designed based on the qV RPB1-252 amplified sequence. The probe sequence is as follows:

[0168] pV RPB1-252: 5'-TATGAATTAGAAGGGGCACCTGGTC-3' (SEQ ID NO. 15), HEX-labeled at the 5' end and HBQ1-labeled at the 3' end

[0169] qPCR sensitivity test

[0170] The genomic DNA of V.necatrix BM was diluted 10-fold from 10 ng / μL to 10 fg / μL and used as a qPCR amplification template. ddH2O was used as a negative control (denoted as N). qPCR amplification was performed using qV RPB1-252 as primers and pV RPB1-252 as probe to test its detection sensitivity. The qPCR amplification system and amplification procedure were the same as step 2.1 in Example 2.

[0171] The results are as follows Fig.11As shown, the amplification sensitivity of the primer probe is 1 pg / μL, which is 100 times lower than the sensitivity (10 fg / μL) of the qNSU primer combined with the V. necatrix BM specific probe (Vairimorpha-pNS225) in Example 2 of the present invention.

[0172] Example 4 Dual qPCR Sensitivity Verification

[0173] 1) Sensitivity validation of dual qPCR using pNSU probe and Nosema-pNS225 probe.

[0174] The genomic DNA of N. bombycis was diluted 10 times from 1 ng / μL to 1 fg / μL and used as a template for qPCR amplification. ddH2O was used as a negative control (denoted as N). Dual qPCR amplification was performed using qNSU as primers and pNSU and Nosema-pNS225 as probes to test the detection sensitivity. The qPCR amplification system was: 18.5 μL qPCR reaction solution, 0.5 μL qNSU-F, 0.5 μL qNSU-R, 0.25 μL of each of the two probes and 5 μL of template. The amplification procedure was the same as step 2.1 in Example 2. The results are shown in Figure 2. Fig.12 As shown in the results, it can be seen that the detection sensitivity of the pNSU probe is 100 fg / μL, and the detection sensitivity of the Nosema-pNS225 probe is 100 fg / μL.

[0175] 2) Establishment of dual qPCR sensitivity verification using pNSU probe and Vairimorpha-pNS225 probe.

[0176] The genomic DNA of V.necatrix BM was diluted 10 times from 1 ng / μL to 1 fg / μL and used as a template for qPCR amplification. ddH2O was used as a negative control (denoted as N). Dual qPCR amplification was performed using qNSU as primers and pNSU and Vairimorpha-pNS225 as probes to test the detection sensitivity. The amplification system was the same as step 1) and the amplification procedure was the same as step 2.1 in Example 2. The results are shown in Fig.13 As shown in the results, it can be seen that the detection sensitivity of the pNSU probe is 100 fg / μL, and the detection sensitivity of the Vairimorpha-pNS225 probe is 100 fg / μL.

[0177] 3) Establishment of dual qPCR sensitivity validation with Nosema-pNS225 probe and Vairimorpha-pNS225 probe.

[0178] After gradient dilution of N. bombycis and V. necatrix BM genomic DNA (1 ng / μL to 1 fg / μL), the two genomic DNAs of the same concentration were mixed at a volume ratio of 1:1 as the detection template, and ddH2O was used as a negative control (denoted as N). Dual qPCR amplification was performed using qNSU as primers and Nosema-pNS225 and Vairimorpha-pNS225 as probes to test its detection sensitivity; the amplification system was the same as step 1), and the amplification procedure was the same as step 2.1 in Example 2. The results are shown in Fig.14 As shown, the concentration on the horizontal axis is the concentration of the two genomic DNAs before mixing. The results show that the detection sensitivity of the Nosema-pNS225 probe and the Vairimorpha-pNS225 probe is 50fg / μL.

[0179] In summary, the primer pair qNSU provided by the present invention can simultaneously detect N. bombycis and V. necatrix BM, has strong specificity, can distinguish N. bombycis and V. necatrix BM according to the length of the amplified fragment, and can also be combined with specific probes for multiplex qPCR, so that the detection of the two microsporidia can be achieved in the same detection system, which has the advantages of high sensitivity, rapidity, accuracy and simple operation. It not only provides a reliable method for the detection and prevention of microsporidia, but also provides convenience for silkworm seed production and avoids the elimination of qualified silkworm seeds.

[0180] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A primer pair qNSU, characterized in that It comprises qNSU-F and qNSU-R; the nucleotide sequence of the qNSU-F is shown in SEQ ID NO.1; the nucleotide sequence of the qNSU-R is shown in SEQ ID NO.

2.

2. A kit, characterized in that: It comprises the primer pair qNSU and the probe according to claim 1; the probe is labeled with a fluorescent group and a quenching group; The probe comprises one or more of a pNSU probe, a Nosema-pNS225 probe, and a Vairimorpha-pNS225 probe; The nucleotide sequences of the pNSU probe, Nosema-pNS225 probe and Vairimorpha-pNS225 probe are shown in SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7, respectively.

3. The kit according to claim 2, characterized in that The fluorescent group includes CY5, FAM or HEX; the quenching group includes HBQ1 or MGB.

4. The kit according to claim 3, characterized in that The quenching group and the fluorescent group labeled on the same probe are paired, and the pairing includes: HBQ1 and CY5 pairing, MGB and FAM or HEX pairing.

5. The kit according to any one of claims 2 to 4, characterized in that When there are two or more probes in the kit, the fluorescent groups labeled on different probes are different.

6. Use of the primer pair qNSU according to claim 1 or the kit according to any one of claims 2 to 5 in 1) or 2): 1) The direct purpose is non-diagnostic and non-therapeutic detection of Nosema bombycis and / or Vairimorpha necatrix BM; 2) Prepare products for detecting Nosema bombyx mori and / or Proteus naka.

7. A method for detecting Nosema bombyx mori and / or Proteus nakata for non-diagnostic and non-therapeutic purposes, characterized in that: The following steps are involved: Using the genomic DNA of the sample to be tested as a template, qNSU is amplified by PCR using the primers described in claim 1 to obtain an amplified product; judging based on the size of the amplified product: When the size of the amplified product is 225 bp, the sample to be tested contains B. mori nematodes; When the size of the amplified product is 241 bp, the sample to be tested contains Nakaproteus.

8. A method for detecting Nosema bombyx mori and / or Proteus nakata for non-diagnostic and non-therapeutic purposes using the kit according to any one of claims 2 to 5, comprising the following steps: Using the genomic DNA of the sample to be tested as a template, qPCR amplification is performed using the primer pair qNSU and the probe in the kit, wherein the qPCR amplification is single-plex qPCR amplification or multiplex qPCR amplification, and the primer pair qNSU is the primer pair qNSU of claim 1 or the primer pair qNSU in the kit; determining the detection result of the probe according to the amplification result: When the amplification result of the sample to be tested has a specific amplification curve and the Ct value is ≤38, the detection result of the probe is positive; when the amplification result of the sample to be tested has no specific amplification curve or no Ct value, the detection result of the probe is negative; When the amplification result of the sample to be tested has a specific amplification curve, and 38<Ct value≤40, the sample to be tested is preliminarily determined to be a positive suspected sample; the positive suspected sample is retested, and when a specific amplification curve appears in the retest, and the Ct value is ≤40, the detection result of the probe is positive; when there is no Ct value or no specific amplification curve in the retest, the detection result of the probe is negative; Determine whether the sample to be tested contains Nosema bombyx mori and / or Proteus naka according to the detection results of the probe: When the detection result of the pNSU probe is positive, the sample to be tested contains Bombyx mori and / or Proteus nakamura; when the detection result of the pNSU probe is negative, the sample to be tested does not contain Bombyx mori and Proteus nakamura; When the test result of the Nosema-pNS225 probe is positive, the sample to be tested contains B. bombyx mori; When the test result of the Nosema-pNS225 probe is negative, there is no B. mori in the sample to be tested; When the detection result of the Vairimorpha-pNS225 probe is positive, the sample to be tested contains Nakamomorpha; when the detection result of the Vairimorpha-pNS225 probe is negative, the sample to be tested does not contain Nakamomorpha.

9. The method according to claim 8, characterized in that The reaction procedure of the qPCR amplification is: 37°C for 2 min, 95°C for 30 s; 40 cycles, the conditions of each cycle are 95°C for 20 s, 60°C for 30 s, and fluorescence is collected.

10. The method according to claim 8 or 9, characterized in that: When the multiplex qPCR amplification is a dual qPCR amplification, the dual qPCR amplification reaction system is: 18.5 μL qPCR reaction solution, 0.5 μL qNSU-F, 0.5 μL qNSU-R, 0.25 μL of each of the two probes and 5 μL of template; When the multiplex qPCR amplification is triple qPCR amplification, the reaction system of the triple qPCR amplification is: 18.25 μL qPCR reaction solution, 0.5 μL qNSU-F, 0.5 μL qNSU-R, 0.25 μL pNSU probe, 0.25 μL Nosema-pNS225 probe, 0.25 μL Vairimorpha-pNS225 probe and 5 μL template.

Images