SERS-ECL dual-mode biosensor for detecting lipopolysaccharide

Abstract

According to the SERS-ECL dual-mode biosensor for detecting lipopolysaccharide, an LPS signal is converted into a nucleic acid signal, and meanwhile, a C-rich long chain is generated by utilizing RCA to be combined with high-activity Ag < + > at the tip of Au (at) AgNC to be separated from a cube, so that endpoints of the cube are passivated, electron transfer between a core and a shell is reduced, hot spots are reduced, and SERS signals are reduced; and a C-Ag < + >-C structure formed by combination is subjected to in-situ reduction by using NaBH4 to generate AgNC, electron transfer is realized under the action of a co-reactant, and an ECL signal is increased. Compared with a single-mode sensor, the SERS-ECL dual-mode sensor can realize self-calibration of a biosensor, and the detection accuracy is improved. In addition, the detection sensitivity of the LPS is improved through accurate identification and rolling circle amplification of the LBA. The biosensing platform has a wide detection range from 1 fg / mL to 1 ng / mL, and the SERS (Surface Enhanced Raman Scattering) detection limit and the ECL detection limit are 0.2915 fg / mL and 0.1433 fg / mL respectively.

Description

Technical Field

[0001] The present invention relates to the technical field of biological analysis and detection, and in particular to a SERS-ECL dual-mode biosensor and an application thereof in preparing a detection system for lipopolysaccharide (LPS). Background Art

[0002] Pathogenic bacterial infections and related foodborne illnesses constitute a major public health problem worldwide, and the detection and identification of these bacterial pathogens is essential for adopting treatment options and establishing appropriate control measures. Gram-negative bacteria are commonly found in the environment. Over the years, their early and effective identification and differentiation from Gram-positive or other types of microorganisms has received increasing attention.

[0003] Lipopolysaccharide (LPS) is a major component of the outer membrane of Gram-negative bacteria and a major target of the innate immune system. The recognition of LPS by macrophages, granulocytes, and dendritic cells and the subsequent triggering and activation of intracellular signal transduction cascades are the main causes of the activation of early innate host defense against Gram-negative bacterial invasion. Since LPS is a unique pathogen-associated molecular pattern on Gram-negative bacteria, it has the potential to be used as a target biomarker for Gram-negative bacterial identification.

[0004] In recent years, many LPS detection methods have been developed. However, compared with single-mode output biosensors, dual-mode biosensors have attracted more and more attention and favor from researchers. This is because the two detection systems have independent signal transduction channels, which can correct errors caused by human or external environment and improve the accuracy of the sensor. Among the many dual-mode detection methods, SERS is usually selected as one of the dual-mode sensors due to its advantages such as excellent sensitivity and response speed. In recent years, ECL, as an emerging optical analysis tool in biosensors, has also attracted people's research interest. Summary of the invention

[0005] The purpose of the present invention is to realize sensitive detection of lipopolysaccharide LPS by using two complementary modes, SERS and ECL. The present invention designs a detection strategy based on the action of bifunctional nucleic acid chains on Au@AgNC, and constructs a SERS-ECL dual-mode system for detecting lipopolysaccharide. Specifically, the present invention adopts the following technical solutions:

[0006] A SERS-ECL dual-mode biosensor for detecting lipopolysaccharide of the present invention is prepared by the following method:

[0007] (1) Preparation of Au@Ag NC nanocubes modified with Raman dyes;

[0008] (2) using the template strand and the primer strand to prepare a circular template under the action of T4 ligase, exonuclease I (EXOI) and exonuclease III (EXOIII);

[0009] (3) Hairpin HP was modified on the electrode surface and MCH was added to prevent nonspecific binding;

[0010] (4) The LBA aptamer was annealed and incubated with the probe N, and then incubated with LPS to release the probe N. Phi29 enzyme, dNTP, and Mg were then added. 2+ and step (2) incubating the circular template on the electrode to perform a rolling circle amplification reaction;

[0011] (5) Adding the Raman dye-modified Au@Ag NC nanocubes obtained in step (1) to the electrode and etching.

[0012] For the above-mentioned SERS-ECL dual-mode biosensor, preferably, in step (1), gold nanoparticles AuNPs are first prepared, and then Au@Ag NC nanocubes are prepared, which are silver-coated gold nanostructures.

[0013] For the above-mentioned SERS-ECL dual-mode biosensor, preferably, in step (2), the template strand and the primer strand are first annealed and combined at 85-95° C. and cooled to room temperature before adding the enzyme.

[0014] For the above-mentioned SERS-ECL dual-mode biosensor, preferably, in step (3), the hairpin HP is modified on the electrode surface by placing the hairpin HP on the electrode for incubation. The electrode is first deposited with gold, and then the hairpin is modified. This is a common practice for hairpin modification, and its principle is generally based on the combination of gold-sulfur bonds, so that the hairpin HP containing thiol is modified on the electrode deposited with gold.

[0015] For the above-mentioned SERS-ECL dual-mode biosensor, preferably, after releasing the probe N in step (4), ultrafiltration tube centrifugation is performed to obtain the clear liquid.

[0016] As a more preferred technical solution, the SERS-ECL dual-mode biosensor of the present invention can be prepared by the following method:

[0017] (1) Synthesis of Au@Ag NC nanocubes: First, NaBH4 was added to the aqueous solution of HAuCl4 and CTAC to obtain Au seeds; then, HAuCl4, CTAC (hexadecyltrimethylammonium chloride), and AA (ascorbic acid) solutions were mixed with the Au seeds to obtain AuNPs; AgNO3 solution and CTAC solution were mixed with AuNPs, and then excess AA was added to obtain Au@Ag NC nanocubes; then, Raman dye 4-NTP (4-nitrothiophenol) was added to obtain Raman dye-modified Au@Ag NC nanocubes;

[0018] (2) Form a circular template in the ep tube: Mix (10 μL, 10 μM) template strand with (10 μL, 10 μM) primer strand and 10 mM Mg 2+ Anneal at 90°C for 10 min and cool to room temperature before adding 0.2U of T4 ligase and reacting at 16°C overnight. Then add 0.2U of exonuclease I and 0.2U of exonuclease III to cut the unreacted DNA chain and reaction byproducts, and finally inactivate the enzyme at 65°C for 20 min. It is best to store the formed circular template in a 4°C refrigerator.

[0019] (3) Place the electrode in HAuCl4 electrolyte for electrochemical deposition for 60 seconds until dry, then add (10 μL 3 μM) hairpin HP to the electrode and incubate for 4 h-6 h, then add 1 mM MCH and incubate for 30 min to prevent nonspecific binding;

[0020] (4) (10 μL, 10 μM) LBA aptamer and (10 μL, 10 μM) probe N were mixed in 10 mM Mg 2+ The mixture was incubated at 37°C for 3 h under the action of 20 μL lipopolysaccharide at 37°C for 1 h. After centrifugation with an ultrafiltration tube, the supernatant was collected and 0.01 U of Phi29 enzyme, 0.02 mM dNTP, 10 mM Mg were added. 2+ and (10 μL, 10 nM) circular template from step (2), perform rolling circle amplification in an ep tube at 37°C for 1 h. After the reaction, place the ep tube at 65°C for 15 min to inactivate the enzyme;

[0021] (5) Add 10 μL of Raman dye-modified Au@Ag NC and etch for 4-6 h in the dark at room temperature. It is observed that the solution changes from orange to slightly pink.

[0022] For the SERS-ECL dual-mode biosensor described above, preferably, the synthesis of Au@Ag NC in step (1) can be divided into three steps according to the literature method: the first step is the preparation of CTAC-encapsulated gold nanoparticles. First, 0.6 mL of ice NaBH4 is added to 10 mL of aqueous solution of HAuCl4 (0.25 mM) and CTAC (100 mM) to obtain 3 nm Au seeds. Then the Au seeds are aged at 27 ° C for 3 h to ensure that NaBH4 is completely dispersed to generate Au seeds covered by CTAC. The second step is the growth of gold seeds. HAuCl4 (6 mL, 0.5 mM), CTAC (6 mL, 200 mM), AA (4.5 mL, 100 mM) are added to (3 mL, 3 nm) Au seeds and mixed to obtain larger particles of AuNPs. Finally, the product is centrifuged at 14500 rpm for 30 min for water washing. The third step is the preparation of Au@Ag nanocubes. A certain amount of AgNO3 (10 mM) solution and CTAC (40 mM) solution were mixed in a volume ratio of 1:1, added to the grown AuNPs, heated to 60 °C, and then added with excess AA and stirred at 60 °C for 4 h to obtain Au@AgNCs, which were centrifuged and washed and finally dispersed in 10 mL of CTAC solution.

[0023] In addition, in step (1), the Raman dye 4-NTP is used at 10 -4 M is preferred. At the same time, Au@Ag NC is mixed with 10 -4 The mixture was stirred overnight at room temperature to modify the Raman dye. Finally, the excess dye was washed and placed in a 4°C refrigerator for later use.

[0024] In addition, the present invention also provides the use of the SERS-ECL dual-mode biosensor in detecting lipopolysaccharide. Preferably, SERS detection is performed using a 785nm laser, a laser intensity of 10%, 3 scans, and a scan time of 10s. On the other hand, ECL detection is performed by adding 6μL, 100μM AgNO3 to the electrode and incubating it in the dark for 30min, then adding 6μL, 100μM NaBH4 to reduce it in the dark for 2h, and finally scanning and measuring at 800V in 0.05mM K2S2O8, and the scanning range is -1.6V-0V.

[0025] Preferably, in the above-mentioned SERS-ECL dual-mode biosensor, in step (4), the aptamer bound to lipopolysaccharide is filtered by an ultrafiltration tube, and an ultrafiltration tube with a pore size of 10KDa is selected.

[0026] The template strand and primer strand are designed by ourselves, and are SEQ ID No.1 and SEQ ID No.2 in the sequence list, respectively, and the sequences are as follows:

[0027] Template chain:

[0028] 5'-AAAGGGTCTAGGGGGGGGGGGGGGGATATAAAGGGTCGGGGTT-3'

[0029] Primer strand:

[0030] 5'-TAGACCCTTTAACCCCGACC-3'

[0031] The hairpin HP was designed by ourselves and is SEQ ID No.3 in the sequence list. The sequence is as follows:

[0032] 5'-CAGATGATATAAAGGGTCAGTGTGTGCTGACCCTTTATAT-3'

[0033] Referring to Analytical Biochemistry 424 (2012) 12–20, lipopolysaccharide-related aptamers were screened as analytical objects and synthesized by Shanghai Bioengineering Co., Ltd. The lipopolysaccharide aptamer LBA is SEQ ID No. 4 in the sequence list, and the sequence is as follows:

[0034] 5'-CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT -3'.

[0035] The probe N sequence was designed by ourselves, which is SEQ ID No.5 in the sequence list, and the sequence is as follows:

[0036] 5'-CTGACCCTTTATATCATCTGG -3'

[0037] In addition, as another implementation scheme, the SERS-ECL dual-mode biosensor of the present invention can be prepared by the following method:

[0038] (1) Polish the electrode with alumina slurry, rinse thoroughly with ultrapure water, ultrasonically treat in ethanol and water, and dry at room temperature;

[0039] (2) Place the electrode in an electrolyte (25 mM HAuCl4) and electrochemically deposit for 60 seconds, then add 10 μL of 3 μM hairpin HP to the electrode and incubate for 4 h to 6 h;

[0040] (3) Add 1 mM MCH and incubate for half an hour;

[0041] (4) 10 μL of probe N released by different concentrations of lipopolysaccharide was placed on the electrode and incubated for 3 h;

[0042] (5) 10 nM circular template, 0.01 U Phi29 DNA polymerase, 0.02 mM dNTP (deoxyribonucleoside triphosphate), 10 mM Mg 2+ A total of 10 μL was dropped on the electrode surface and incubated for 1 h;

[0043] (6) 10 μL of Au@AgNC modified with Raman dye was dropped on the electrode surface and etched in the dark for 4 h. Finally, SERS measurement was performed using a 785 nm laser, a laser intensity of 10%, 3 scans, and a scan time of 10 s.

[0044] (7) Add 6 μL of 100 μM AgNO3 to the electrode and incubate in the dark for 30 min, then add 6 μL of 100 μM NaBH4 and reduce in the dark for 2 h. Finally, perform scanning measurement at 800 V in 0.05 mM K2S2O8, with a scanning range of -1.6 V to 0 V.

[0045] In the present invention, since the nucleic acid amplification method of rolling circle amplification is adopted, a strong signal output can be achieved with a trace amount of lipopolysaccharide, which is conducive to the rapid detection of early infection samples.

[0046] The principle analysis of the present invention is as follows:

[0047] 1. Detect lipopolysaccharide using lipopolysaccharide aptamers.

[0048] Antigen-antibody specific binding is the most widely used, but it is time-consuming and laborious to extract antibodies from animals, and the quality of each batch is difficult to guarantee. Compared with antibodies, the small size of aptamers, the relative molecular stability under various analytical conditions, the high affinity and specificity for the target, and the ability to maintain activity under field deployable conditions make aptamers an attractive choice for ultra-trace capacitive sensing capture molecules. The use of released probe N to start rolling circle amplification not only has an amplifying effect on the reaction, but the amplified cytosine can not only serve as an etchant for Au@AgNC to reduce the SERS signal, but also as a template for the generation of AgNC to increase the ECL signal, realizing a biosensor with two complementary modes.

[0049] 2. Basis for the formation of circular template

[0050] In order to achieve the synthesis of circular templates, 18 paired bases were set in the design of the padlock chain (template chain) and the primer chain. Under the action of T4 ligase, the phosphate group at the 5' end of the padlock chain and the hydroxyl group at the 3' end formed a phosphodiester bond. Then exonuclease III and exonuclease I were introduced. Exonuclease III can act on the paired part of the primer chain and the padlock chain, and gradually remove bases along the 3'-5' direction until the primer chain is completely cut. Exonuclease I degrades the unreacted DNA single strand from the 3'-5' direction. For the sequence of the starting rolling circle on the hairpin probe, the design should not only avoid the ring directly opening the hairpin when there is no target, but also make the sequence on the ring meet the requirements of etching and carrying silver clusters, prevent background interference, and improve assembly efficiency.

[0051] 3. Au@AgNC etching basis

[0052] DNA has been widely used to guide the growth and assembly of nanoparticles due to its extensive surface interactions and good programmability. DNA can be used as an etchant to precisely tune the morphology and optical properties of plasmonic nanoparticles, where polycytosine DNA as an anchor can etch silver nanoparticles (AgNPs) in a highly controllable manner and serve as a template for the synthesis of silver nanoclusters. According to previous reports, the affinity of AgNPs for nucleobases ranges from cytosine (C) > guanine (G) > adenine (A) > thymine (T). When C-rich DNA is also used as an etchant, the silver shell in Au@AgNC can be etched into silver nanoparticles, making the silver nanoparticles gradually smaller.

[0053] 4. Basis for in-situ reduction of AgNC

[0054] It is common to use DNA as a template for forming metal nanoclusters. This patent uses the fact that cytosine can react with Ag. + Combine to form C-Ag + -C structure, under the action of reducing agent sodium borohydride, C-Ag + -C is in situ reduced to AgNC. Through the G-rich sequence on the padlock chain, the phi29 enzyme, dNTP, Mg 2+ Under the catalytic action of , etc., according to the principle of base complementary pairing, a C-rich sequence is formed on the rolling circle amplification chain. + Can specifically bind to form C-Ag + -C structure, which is in situ reduced to generate silver nanoclusters (AgNC) under the action of sodium borohydride. In the ECL reaction system, AgNC directly reacts with the co-reactant potassium persulfate (K2S2O8) to produce AgNCs −• and SO4 −• , followed by AgNCs −• SO4 −•Oxidation to generate AgNCs * , while AgNCs * It is the excited state of AgNC. When the excited state transitions to the ground state, the light intensity released is captured by the ECL instrument to generate ECL signal. The whole ECL process is described as follows:

[0055] AgNCs + e - → AgNCs −• (1)

[0056] S2O8 2- + e - → SO4 2- + SO4 −• (2)

[0057] AgNCs −• + SO4 −• → AgNCs * + SO4 2- (3)

[0058] AgNCs * → AgNCs +hν (4)

[0059] The present invention converts LPS signals into nucleic acid signals and simultaneously utilizes RCA to generate C-rich long chains combined with highly active Ag at the tip of Au@AgNC. + The detachment from the cube leads to the passivation of the cube endpoints, the reduction of electron transfer between the core and shell, the reduction of hot spots, and the decrease of SERS signal. + -C structure, and then in situ reduction with NaBH4 to produce AgNC, electron transfer is achieved under the action of co-reactant, and the ECL signal increases. Compared with single-mode sensors, SERS-ECL dual-mode sensors can realize self-calibration of biosensors and improve detection accuracy. In addition, the precise recognition and rolling circle amplification of LBA improve the detection sensitivity of LPS. The biosensor platform has a wide detection range from 1 fg / mL to 1ng / mL, and the detection limits of SERS and ECL are 0.2915fg / mL and 0.1433fg / mL, respectively.

[0060] The present invention firstly expands the contact area of ​​the biosensor platform by using a thin layer of electrochemically deposited gold as the substrate, while reducing the use of gold nanoparticles; secondly, DNA is selected as an etchant and template, and the non-toxic and harmless characteristics of biomaterials are utilized to avoid the environmentally unfriendly characteristics of organic or inorganic reagents. Finally, a SERS-ECL dual-mode biosensor with excellent stability and high sensitivity is successfully constructed by etching Au@AgNC with cytosine and growing AgNC as a template. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 Schematic diagram of the principle of DNA nanomachine-mediated anisotropic morphological evolution of Au@Ag nanocubes for SERS-ECL biosensing for LPS detection.

[0062] Figure 2 To investigate the feasibility of using polyacrylamide gel electrophoresis to analyze nucleic acids;

[0063] Figure 3 TEM images of Au@AgNC etched at different times and its UV and in-situ reduced AgNC images;

[0064] Figure 4 To optimize the etching time of Au@AgNC;

[0065] Figure 5 The graph and linear relationship between the concentration of lipopolysaccharide LPS and the SERS intensity and ECL intensity;

[0066] Figure 6 To evaluate the stability and specificity of the SERS-ECL dual-mode biosensor. DETAILED DESCRIPTION

[0067] The following embodiments are further descriptions of the content of the present invention as an explanation of the technical content of the present invention, but the essential content of the present invention is not limited to the following embodiments. Ordinary technicians in this field can and should know that any simple changes or replacements based on the essential spirit of the present invention should fall within the scope of protection required by the present invention.

[0068] Example 1

[0069] Circular template design, composition.

[0070] First, (10 μL, 10 μM) of phosphate-modified template strand, (10 μL, 10 μM) of primer strand, and 10 mM Mg 2+ Place in a 0.6mL ep tube and anneal at 90℃ for 10min. After slowly cooling to room temperature, add 0.2U of T4 ligase and react at 16℃ overnight. Under the action of T4 ligase, the phosphate group at the 5' end of the template chain and the hydroxyl group at the 3' end form a phosphodiester bond for cyclization. Then place the ep tube at 65℃ for 15min to inactivate T4 ligase. Finally, add 0.2U of EXOI and 0.2U of EXOIII to the ep tube and incubate at 37℃ for 3h to remove the unreacted template chain or primer chain, then heat to 65℃ and incubate for 20min to inactivate EXOI and EXOIII.

[0071] Design and synthesis of RCA reactions.

[0072] A short binding chain probe N was designed based on the LPS aptamer sequence designed in the literature. This binding chain should not only be able to bind tightly to the LPS aptamer chain and be completely released in the presence of LPS, but also be able to trigger the next-level hairpin reaction. (10μL, 10μM) lipopolysaccharide aptamer LBA and (10μL, 10μM) probe N were mixed in 10mM Mg 2+ The cells were incubated at 37°C for 3 h under the action of LPS (20 μL, different concentrations) and LBA-N (1 μM, 40 μL) for 1 h at 37°C to release probe N.

[0073] First, the GCE electrode was polished with alumina slurry, then the GCE was thoroughly rinsed with ultrapure water, ultrasonically treated in ethanol and water, and then dried and cleaned at room temperature. The GCE electrode was placed in an electrolyte (25mM HAuCl4) for electrochemical deposition for 60S to dry, and then (10μL 3μM) hairpin HP was added to the electrode and incubated for 6h. The solution on the electrode was shaken off, and 1mM MCH was added and incubated for half an hour to prevent nonspecific binding. After shaking off the solution on the electrode, probe N released from lipopolysaccharide of different concentrations was added and incubated at 37°C for 3h. After shaking off the solution on the electrode, (10μL, 10nM) circular template, 0.01U Phi29 enzyme, 0.02mM dNTP, 10mM Mg were added to the electrode. 2+ Rolling circle amplification was performed at 37°C for 1 h. Finally, 10 μL of Au@AgNC modified with Raman dye 4-NTP was added to the electrode, and after etching for 4 h at room temperature in the dark, the Raman signal was measured at a laser intensity of 10%, with 3 scans and a scan time of 10 s for SERS detection.

[0074] For ECL detection, (7 μL, 100 μM) AgNO3 was added to the etched electrode and stored in the dark at 4°C for 30 minutes to form C-Ag + -C structure. Then (7μL, 100μM) NaBH4 solution was added to form AgNC under dark conditions. Finally, the electrode was placed in 0.05M K2S2O8 (0.1M, PH=7) PBS electrolyte, and the ECL measurement of the electrode was performed under 800V photomultiplier tube in the scanning range of -1.6V-0V.

[0075] like Figure 2 Shown is the use of polyacrylamide gel electrophoresis (PAGE) to analyze DNA structures alone.

[0076] Figure 2Middle: 10% PAGE analysis of RCA. Channel 1, aptamer chain LBA; Channel 2, release chain N; Channel 3, hairpin HP; Channel 4, template chain; Channel 5, primer chain; Channel 6, template chain + primer chain + T4; Channel 7, template chain + primer chain + T4 + EXOIII + EXOI (circular template); Channel 8, LBA+N; Channel 9, N+HP; Channel 10, HP+circular template; Channel 11, N+HP+circular template; Channel 12, RCA.

[0077] like Figure 2 A band with a slower mobility than that of channels 1 and 2 appeared in channel 7, indicating that the hairpin HP was opened by probe N. The mobility of the band in channel 5 was lower than that of channels 3 and 4, indicating that the template chain and the primer chain were combined under the action of T4 ligase. The migration rate of the band in channel 6 was faster than that of channel 5, indicating that exonuclease III and exonuclease I successfully cut off the primer chain. The appearance of the new band in channel 8 proved the successful combination of N, HP and the circular template. Channel 9 shows that no new band will be produced in the absence of LPS release chain. The formation of a DNA chain with a huge molecular weight above channel 10 shows that the reaction can proceed normally.

[0078] like Figure 3 The TEM images of Au@AgNC etched at different times are shown. The TEM images show that C-rich DNA can significantly etch Au@AgNC. The formation of the silver layer of Au@AgNC guided by DNA depends on cytosine and Ag. + The specific interaction between the two. An Ag + Can bind to multiple cytosines in C-rich DNA to form C-Ag + - C mismatch induces DNA bending. Due to the decrease in structural freedom, the bent DNA will generate a stress that forces the bound Ag + Released from Au@AgNC, thus initiating DNA directional etching. Therefore, the etching of Au@AgNC starts from the corners and then the edges. (A) 0h, (B) 4h, (8)h, (D) 12h, (E) AgNC, (F) UV corresponding to different etching times.

[0079] like Figure 4 The figure shows the optimized etching time of Au@AgNC. In order to study the moment with the highest etching efficiency, the probe N released by lipopolysaccharide of the same concentration was added to the electrode to trigger rolling circle amplification. The SERS signal was measured every 2 hours. Based on the slope of each point and the detection time, we chose 4h as the SERS signal detection time.

[0080] like Figure 5The graph and linear relationship between LPS concentration and SERS intensity and ECL intensity are shown. Adding LPS in a concentration range of 1fg / mL to 1ng / mL can significantly reduce the SERS intensity and enhance the ECL intensity. This makes the SERS and ECL intensities linearly related to the logarithm of the LPS concentration. (A) ECL spectrum and LPS concentration spectrum, (B) ECL corresponding linear relationship, (C) SERS spectrum and LPS concentration spectrum, (D) SERS corresponding linear relationship.

[0081] like Figure 6 The stability and specificity of the SERS-ECL dual-mode biosensor are evaluated as shown. The SERS intensity of 15 points was randomly selected, and the relative standard deviation (RSD) of the sensing platform was 1.9%. The stability of the same electrode was measured by scanning 20 circles, and the RSD was 1.58%. 1 ng / mL LPS was compared with 10 ng / mL ascorbic acid, leucine, alanine, and glucose to evaluate the specificity. It was found that even in the presence of interferences, the SERS-ECL dual-mode nucleic acid sensor was still sensitive to the detection of LPS.

[0082] It should be noted that the above-mentioned technical contents of the present invention are only for explanation and clarification to enable those skilled in the art to understand the technical essence of the present invention, so the technical contents are not used to limit the substantial protection scope of the present invention. The substantial protection scope of the present invention shall be subject to the claims. Those skilled in the art should know that any modification, equivalent substitution and improvement based on the substantial spirit of the present invention shall be within the substantial protection scope of the present invention.

Claims

1. A SERS-ECL dual-mode biosensor for detecting lipopolysaccharide is prepared by the following method: (1) Preparation of Au@Ag NC nanocubes modified with Raman dyes; (2) using the template strand and the primer strand to prepare a circular template under the action of T4 ligase, exonuclease I and exonuclease III; (3) Hairpin HP was modified on the electrode surface and MCH was added to prevent nonspecific binding; (4) First, the LBA aptamer was annealed with the probe N, then incubated with LPS to release the probe N, and then placed on the electrode for incubation. Then, Phi29 enzyme, dNTP, and Mg were added. 2+ and step (2) incubating the circular template on the electrode; (5) Adding the Raman dye-modified Au@Ag NC nanocubes obtained in step (1) to the electrode and etching.

2. The SERS-ECL dual-mode biosensor according to claim 1, characterized in that: Step (1) first prepares gold nanoparticles AuNPs, and then prepares Au@AgNC nanocubes.

3. The SERS-ECL dual-mode biosensor according to claim 1, characterized in that: Step (2) The template strand and the primer strand are annealed at 85-95°C.

4. The SERS-ECL dual-mode biosensor according to claim 1, characterized in that: Step (3) of modifying the hairpin HP on the electrode surface is to place the hairpin HP on the electrode for incubation.

5. The SERS-ECL dual-mode biosensor according to claim 1, characterized in that: Step (4) After releasing the probe N, the ultrafiltration tube is centrifuged to obtain the clear liquid.

6. The SERS-ECL dual-mode biosensor according to claim 1, characterized in that: Prepared by the following method: (1) Synthesis of Au@Ag NC nanocubes: First, NaBH4 was added to the aqueous solution of HAuCl4 and CTAC to obtain Au seeds; then, HAuCl4, CTAC, and AA solutions were mixed with the Au seeds to obtain AuNPs; AgNO3 solution and CTAC solution were mixed with AuNPs, and then excess AA was added to obtain Au@AgNC nanocubes; then, Raman dye 4-NTP was added to obtain Raman dye-modified Au@Ag NC nanocubes; (2) Form a circular template in the ep tube: Mix 10 μL, 10 μM template strand with 10 μL, 10 μM primer strand and 10 mM Mg 2+ After annealing at 90°C for 10 min and cooling to room temperature, 0.2 U of T4 ligase was added and reacted at 16°C overnight. Then, 0.2 U of exonuclease I and 0.2 U of exonuclease III were added to cut the unreacted DNA strands and reaction byproducts, and finally the enzyme was inactivated at 65°C for 20 min. (3) Place the electrode in 25 mM HAuCl4 electrolyte for electrochemical deposition for 60 seconds until dry, then add 10 μL of 3 μM hairpin HP to the electrode and incubate for 4 h to 6 h, then add 1 mM MCH and incubate for 30 min to prevent nonspecific binding; (4) 10 μL, 10 μM LPS aptamer LBA and 10 μL, 10 μM probe N were mixed in 10 mM Mg 2+ The cells were incubated at 37°C for 3 h under the action of 20 μL lipopolysaccharide at 37°C for 1 h, and the supernatant was collected after centrifugation with an ultrafiltration tube. 0.01 U of Phi29 enzyme, 0.02 mM dNTP, 10 mM Mg 2+ and 10 μL, 10 nM circular template from step (2), and perform rolling circle amplification in an ep tube at 37°C for 1 h. After the reaction, place the ep tube at 65°C for 15 min to inactivate the enzyme; (5) Add 10 μL of Raman dye-modified Au@Ag NC and etch for 4-6 h in the dark at room temperature.

7. Use of the SERS-ECL dual-mode biosensor according to claims 1-6 in detecting lipopolysaccharide.

8. The use according to claim 7, characterized in that The SERS detection was performed using a 785 nm laser, a laser intensity of 10%, 3 scans, and a scan time of 10 s.

9. The use according to claim 7, characterized in that For ECL detection, 6 μL of 100 μM AgNO3 was added to the electrode and incubated in the dark for 30 min, then 6 μL of 100 μM NaBH4 was added for reduction in the dark for 2 h, and finally a scanning measurement was performed at 800 V in 0.05 mM K2S2O8 with a scanning range of -1.6 V to 0 V.

Images