Closed dumbbell-shaped Met agonist and application thereof

Abstract

The invention belongs to the field of biomedical engineering, and particularly relates to a closed dumbbell-shaped Met agonist and application thereof. The Met agonist is a closed dumbbell-shaped DNA agonist used for regulating and controlling a Met signal channel, is named as cDA, is a closed nucleotide sequence and is dumbbell-shaped on the whole, ring parts at the two ends are connected together through a neck part in the middle, and the neck part sequence is composed of base pairs which are complementarily paired in the reverse direction. The invention also provides application of cDA in treatment of diabetic ulcer of human or animals. The cDA disclosed by the invention overcomes the defect that protein or a linear DNA agonist is easily subjected to enzymolysis at a physiological level, and the cDA has very strong nucleic acid enzymolysis resistance; the polypeptide is applied to vascular endothelial cells to regulate activation of a Met signal channel, and vascularization is promoted. The cDA shows good specificity, stability and high affinity, and can be developed into a vascularization promoting medicine and applied to disease treatment.

Description

Technical Field

[0001] The invention belongs to the field of biomedical engineering, and in particular relates to a closed dumbbell-shaped Met agonist and application thereof. Background Art

[0002] Angiogenesis is a complex process that drives the formation of new blood vessels, which supports many biological processes, including tissue regeneration, organ development, and provides conditions for many physiological activities. The complex mechanism of angiogenesis is carefully orchestrated by unique cell signaling pathways and transcriptional programs, triggered by a series of effective angiogenic factors. For example, Met protein (mesenchymal epithelial transition factor), which belongs to receptor tyrosine kinase, is mainly involved in epithelial-mesenchymal transition, embryonic development, and tissue repair after injury. Hepatocyte growth factor HGF is considered to be a potent angiogenic factor. As a key ligand of Met receptor under physiological conditions, HGF can regulate a variety of important biological functions such as cell movement, division, survival, and differentiation. Recent studies have revealed the role of recombinant HGF in complex processes such as wound healing, tissue regeneration, and angiogenesis. However, the clinical application of this protein-based angiogenic factor is still limited by inherent challenges such as short half-life, instability, and susceptibility to protease degradation in vivo. To address these limitations, alternative strategies are urgently needed to mimic the biological effects of HGF while addressing its inherent instability. A promising strategy is to develop DNA agonists that can replicate the function of recombinant HGF, wherein the DNA agonist refers to the agonist itself composed of DNA.

[0003] Synthetic DNA agonists are potential receptor-targeting drug molecules that can mimic protein-based ligand binding and regulation of cell surface receptors, thus providing a promising alternative for regulating angiogenesis-related cell behaviors. The design of such synthetic DNA agonists involves organizing receptor-binding aptamers into multivalent structures. Recently, researchers have increasingly used nucleic acid structures for multivalent ligand presentation to reveal the mechanisms of multivalency-enhanced interactions and generate high-affinity binders. When connected by nucleic acid scaffolds, DNA agonists are able to generate high collective affinity for corresponding receptors with multiple binding sites. Flexible scaffolds are constrained to arrangements that allow bridging binding sites, a strategy that has been elaborated in bivalent aptamer agonists. Compared with natural HGF, these DNA agonists have shown stronger biological activity and better stability, providing a potential solution to overcome the shortcomings of protein-based treatments. However, the flexible segments of the flexible scaffolds in synthetic DNA agonists may need to pay entropic costs, and these DNA agonists may contain sites that are easily invaded by nucleases, which greatly reduces their therapeutic effects for diseases.

[0004] Therefore, there is a need in the art to develop a new Met agonist, wherein the Met agonist refers to a DNA agonist that can specifically regulate the Met signaling pathway, in order to solve the problem of transient activity and molecular instability of existing angiogenic factors such as HGF in clinical applications, so as to improve drug stability and sustained activity, and enhance vascular regulation, generation and tissue repair capabilities; and secondly, to solve the problem that the existing DNA agonists containing flexible scaffolds have insufficient binding force and specificity, and are easily degraded by nucleases. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a nuclease-resistant and highly stable dumbbell-shaped Met agonist for regulating the activation of the Met signaling pathway and angiogenesis. The present invention establishes a new receptor regulation tool, overcomes the stability defects of traditional drugs, establishes a more stable and higher-affinity drug and applies it to the regulation of vascular endothelial cells at the signal and transcription levels, and observes obvious therapeutic effects at the in vivo level in zebrafish and diabetic ulcer mice.

[0006] Specifically, the present invention first provides a closed dumbbell-shaped Met agonist, which is a closed dumbbell-shaped DNA agonist for regulating the Met signaling pathway. The Met agonist is named cDA, which is a closed nucleotide sequence and is dumbbell-shaped as a whole. The loops at both ends are connected together by a neck in the middle, and the neck sequence is composed of reverse complementary paired base pairs.

[0007] In a specific embodiment, the loops at both ends of the cDA include 34 to 40 bases and are functional sequences; and the neck in the middle is a rigid linker, and includes multiple base pairs.

[0008] In a specific embodiment, the neck of the cDA includes 13 bp, and the cDA is constructed from a linear Met agonist named ssDA, and the base sequence of the ssDA is as follows:

[0009] ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGATCGTGT CACGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAGTGACACG.

[0010] In a specific embodiment, the 5' end of the ssDA is first phosphorylated, and then the 5' end and the 3' end of the ssDA are connected using DNA ligase to form the cDA. Preferably, T4 ligase and ssDA solution are first incubated at 16-22° C. for 1-2 hours, and then incubated at 65-75° C. for 5-10 minutes to obtain the cDA.

[0011] The present invention also provides a use of the closed dumbbell-shaped Met agonist as described above, wherein the closed dumbbell-shaped Met agonist is used in cell or living body therapy.

[0012] In a specific embodiment, the closed dumbbell-shaped Met agonist is used to regulate angiogenesis, preferably for the treatment of diabetic ulcers in humans or animals.

[0013] The closed dumbbell-shaped Met agonist of the present invention comprises a rigid linker, which forms a nano-scale rigid scaffold based on the principle of complementary base pairing. The rigid linker can provide better specificity and higher binding force for the Met agonist and the Met receptor.

[0014] In the present invention, when the Met receptor is present, cDA rapidly binds to the Met protein. Since the Met receptor is composed of two homologous subunits, the presence of the rigid neck linker in cDA brings the two subunits of the Met receptor closer together, thereby activating the Met signaling pathway and generating downstream cascade signals. When nucleases are present in the microenvironment, cDA can stably exist independently and maintain a closed dumbbell shape. In simple terms, the two rings in the Met agonist of the present invention are both bound to the Met receptor, which will pull the two subunits of the Met receptor together, and the rigid neck linker plays a rigid supporting role, making the binding strength of the Met agonist to the Met receptor higher. When ssDA captures the two subunits of the Met receptor, its neck will swing.

[0015] In the present invention, during the preparation of cDA, the phosphorylated ssDA is added to a buffer system to prepare a target agonist, and the gray value is detected after the reaction. The construction of cDA can be determined or the content of cDA can be calculated based on the gray value result.

[0016] In the present invention, the effect verification of the Met agonist includes: co-incubating the above-mentioned ring-shaped dumbbell-shaped Met agonist cDA with living cells or adding it to the vascularization regulation site of living tissue, detecting the signal activation intensity and the degree of vascularization after a period of time, and determining the effectiveness of cDA based on the observed results.

[0017] The present invention designs a closed dumbbell-shaped Met agonist, which is a rigid closed agonist based on DNA nanotechnology. Its structure includes a rigid linker and a loop functional domain that precisely targets both ends of the Met protein. This stable product is similar to a dumbbell in structure, which can block the interaction between nucleases and nucleic acid chains to avoid potential enzyme degradation events. Compared with existing vascularization regulation tools, this dumbbell-shaped Met agonist has at least the following advantages:

[0018] 1) It overcomes the defect that protein or linear DNA agonists are easily enzymatically hydrolyzed at physiological levels. The closed dumbbell-shaped Met agonist cDA has strong resistance to nuclease hydrolysis; the cDA is applied to vascular endothelial cells to regulate the activation of the Met signaling pathway and promote the occurrence of vascularization.

[0019] 2) Compared with the linear Met agonist ssDA at the same concentration, the closed dumbbell-shaped Met agonist cDA had more cellular transcriptome regulatory events, effectively promoting the occurrence of vascularization.

[0020] 3) The cDA described in the present invention exhibits good specificity, stability and high affinity, and can be developed into angiogenesis-promoting drugs and applied to disease treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematic diagram and electrophoresis diagram of the synthesis of closed dumbbell-shaped Met agonist cDA from chain ssDA.

[0022] Figure 2 This is a comparative analysis result of the anti-nuclease stability of Met agonists ssDA and cDA.

[0023] Figure 3 This is a comparative analysis result of serum stability of Met agonists ssDA and cDA.

[0024] Figure 4 This is a comparative analysis result of signal activation of Met agonists ssDA and cDA and traditional protein factor HGF.

[0025] Figure 5 This is a comparative analysis result of the regulation of Met agonists ssDA and cDA at the cellular transcription level.

[0026] Figure 6 This is a comparative analysis of the tubule-promoting effects of Met agonists ssDA and cDA and the traditional protein factor HGF.

[0027] Figure 7 This is a diagram showing the results of angiogenesis analysis of the Met agonist cDA at the in vivo level (zebrafish).

[0028] Figure 8 The figure shows the analysis results of the Met agonist cDA promoting wound healing at the in vivo level (diabetic ulcer mice). DETAILED DESCRIPTION

[0029] First, we tested the feasibility of the protocol for synthesizing closed dumbbell-shaped cDA from chain-like ssDA. Figure 1 Schematic diagram of the process of synthesizing the closed dumbbell-shaped Met agonist cDA from chain ssDA ( Figure 1a) and electrophoresis results ( Figure 1 b). The reaction was characterized by denaturing polyacrylamide gel electrophoresis (PAGE). After the reaction, a new band representing the cDA appeared on the denaturing PAGE, and the migration speed was faster (the starting point of the electrophoresis was at the top), see Figure 1 This finding is consistent with previous studies showing that closed DNA migrates faster than linear DNA of the same length in denaturing PAGE.

[0030] In addition, we evaluated the stability of cDA by in vitro exonuclease assay. Figure 2 This is a comparative analysis of the nuclease resistance of Met agonists ssDA and cDA. Figure 2 a is its electrophoresis diagram, Figure 2 b is Figure 2 Quantification of a. After 30 minutes of exonuclease treatment, the ssDA treatment group was completely degraded. In contrast, after the same treatment time, the band corresponding to cDA remained basically intact, indicating that the stability of cDA is significantly stronger than that of ssDA, and cDA has the ability to resist exonuclease degradation to a certain extent. In fact, serum contains a variety of nucleases that can quickly degrade nucleic acid drugs, resulting in reduced activity and half-life; therefore, the expected effect of anti-enzyme cleavage of cDA described in the present invention will be significantly better than that of ssDA.

[0031] The serum stability of the Met agonist cDA is directly related to its efficacy. To investigate this, we incubated ssDA and cDA in fetal bovine serum for 0-24 hours. Figure 3 This is a comparative analysis result of serum stability of Met agonists ssDA and cDA. Figure 3 a is its electrophoresis diagram, Figure 3 b is Figure 3 a Quantification of the two, where one star represents a significant difference of <0.05, two stars represent <0.01, and ns represents no significant difference. Electrophoresis showed that ssDA gradually degraded, indicating its poor serum stability. In contrast, cDA remained intact after 24 hours, indicating its stability in serum. This enhanced serum stability suggests that cDA may exhibit superior functionality in in vivo applications.

[0032] We investigated this cDA-induced MET activation event and assessed the feasibility of downstream intracellular signaling pathways. Figure 4 This is a comparative analysis result of signal activation of Met agonists ssDA and cDA and traditional protein factor HGF. Figure 4 a is its electrophoresis diagram, Figure 4 b is Figure 4 Quantization plot of a. Figure 4In the figure, p-Met is the phosphorylation of Met, p-AKT is the phosphorylation of AKT, p-ERK is the phosphorylation of ERK, tubulin is used as the internal reference, and the specific sites of p-Met and p-AKT are indicated in parentheses. Figure 4 The Control in b is blank, which means no activation. The figure shows that HGF also has a signal for Met, but it is not strong enough; HGF, ssDA and cDA all have strong signals for AKT and ERK. Figure 4 b Note: For Met, cDA has a stronger activation effect than ssDA and HGF; from the results of their activation functions on Met, AKT and ERK, the synthesis of cDA from ssDA in the present invention will not have any negative impact on the activation function of ssDA. The results show that cDA strongly promotes the phosphorylation of two signaling proteins, ERK1 / 2 (T202 / Y204) and AKT (S473). In summary, we have determined that cDA, as a stable DNA agonist, can activate Met signaling in human umbilical vein endothelial cells (HUVECs).

[0033] In addition, we chose to compare the changes in transcript levels induced by cDA as a rigid dimer agonist with those induced by ssDA, Figure 5 This is a comparative analysis result of the regulation of Met agonists ssDA and cDA at the cellular transcription level. Figure 5 Angiogenesis PCR array was used to detect the transcriptional response of 72 angiogenesis genes. Figure 5 a and Figure 5 b is the gene expression level diagram of the PCR array of 72 wells of ssDA and cDA, where the 72 wells represent 72 different genes, and the darker the color, the higher the expression level. Figure 5 c is Figure 5 a and Figure 5 b scaled quantization map, Figure 5 In c, the horizontal axis represents 72 different genes, and the vertical axis represents the relative expression of vascularization genes, specifically the ratio of cDA to ssDA. Figure 5 It can be seen that compared with ssDA, cDA induces a stronger transcriptional response level, with 40 genes having a ratio greater than 1, and their genes are upregulated, while the remaining 32 genes are at a low level; this indicates that compared with ssDA, cDA has a higher probability and degree of vascularization events. Specifically, essential genes such as vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF) and transforming growth factor-β (TGF-β) among these 72 genes were affected to varying degrees, indicating the potential application of cDA in promoting angiogenesis and accelerating repair behavior. In summary, the present invention has demonstrated that cDA has the ability to regulate the Met signaling pathway and a good transcriptional response, and has the potential to treat vascularization.

[0034] The activation of Met signaling promotes the tube formation of HUVECs. The present invention also evaluates the angiogenic activity of cDA by a tube formation assay of HUVECs. Figure 6 a. Figure 6 The results of the comparative analysis of the tubule formation promoted by Met agonists ssDA and cDA and the traditional protein factor HGF are shown in Figure 2. Specifically, HUVECs were seeded onto a matrigel-coated surface and incubated with DNA agonists for 18 hours, and then the formation of capillary-like networks was shown, and finally the branch length and node length were measured, see Figure 6 b and Figure 6 c. The results showed that DNA agonists could effectively promote tubule formation, and the branch length and node length of tubules were significantly increased.

[0035] Under physiological conditions, cells utilize cell surface receptors to respond to their specific ligands and transmit various signaling pathways in unpredictable ways. To investigate the therapeutic potential of cDA in vivo, a key consideration is whether cDA administration in damaged tissues can effectively deliver therapeutic results. Therefore, we chose to evaluate the vascularization of zebrafish intestinal vasculature after cDA administration. Figure 7 This is a diagram showing the results of angiogenesis-promoting analysis of the Met agonist cDA at the in vivo level. Figure 7 a is a fluorescence microscope photo of zebrafish at different doses as the cDA dosage increases. In the non-vascularization degree display band, the darker the color, the higher the incidence of non-vascularization events. Figure 7 b is correct Figure 7 Quantification of a. Figure 7 The results showed that vascular levels increased 1.84-fold after cDA treatment, indicating its suitability for in vivo treatment. Of note, using increased cDA concentrations, we have demonstrated a significant increase in the incidence of this event, namely 2.5-fold.

[0036] Finally, we evaluated the potential therapeutic effects of cDA in a mouse model of diabetic ulcer. Figure 8 The following is an analysis result of the effect of Met agonist cDA on wound healing in vivo (diabetic ulcer mice). Specifically, 48 hours after administration, cDA was evenly applied to the wound surface with a hyaluronic acid (HA) mixture and the dressing was fixed with gauze. The wound was then re-dressed every 48 hours and imaging was performed every 4 days for further analysis. Figure 8 a. The results showed that even a low dose of 40 nM cDA treatment group recovered faster than the normal control group in the mouse diabetic ulcer model. Figure 8 The rightmost column of a is a superposition of the five images preceding it. Figure 8 b is Figure 8a quantitative results, quantitative analysis showed that cDA significantly improved the wound closure rate, reaching about 54.5% in the low-dose group on the 4th day, while the high-dose group 200nM reached 60.9%. In contrast, the wound healing rate of the untreated control group (no drug was applied) was significantly lower, with a wound closure rate of only 8%. In addition, the wound healing rate of the HA control group (only HA was applied) was only 34.5%, which was also much lower than that of the cDA treatment group. This shows that cDA has the ability to act as a Met agonist or activator to regulate the disease. This trend remained consistent at all subsequent time points (e.g., days 8 to 12), and almost all groups achieved complete wound healing on day 16.

[0037] Example

[0038] This example verifies the construction of a dumbbell-shaped Met agonist cDA that is closed before and after the addition of T4 ligase.

[0039] In the present invention, the ssDA sequence with 5' end phosphorylated was purchased from a gene company, and its sequence is as follows:

[0040] ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGATCGTGTCACGGATGGTAGCTC GGTCGGGGTGGGTGGGTTGGCAGTGACACG.

[0041] In the examples of the present invention, 1×T4 reaction buffer was provided by BBI Life Sciences Ltd., and T4 ligase and phosphate buffer were both provided by Thermo Fisher Scientific.

[0042] 1) Preparation of ssDA solution: 20 μL reaction system contains 4 μM linear nucleic acid chain ssDA and 1× phosphate buffer (2.68 mM KCl, pH 8.9, 137 mM NaCl, 10.1 mM Na 2 HPO 4 , 1.76 mM NaH 2 PO 4 , prepared with deionized water).

[0043] 2) Prepare the reaction premix: one premix contains ssDA solution, T4 ligase, and 1×T4 reaction buffer.

[0044] 3) The reaction premix was incubated at 22°C for 2 hours and 70°C for 5 minutes to obtain a high-purity closed dumbbell-shaped Met agonist cDA. After the reaction, the synthesis of the DNA agonist was detected by nucleic acid electrophoresis. The results were as follows: Figure 1 As shown. Figure 1It can be seen that the embodiments of the present invention have linked the 5' end and 3' end of ssDA with phosphorylated 5' end together to form a high-purity closed dumbbell-shaped Met agonist cDA.

[0045] Comparative Example

[0046] The reaction premix prepared in step 2) contains only ssDA solution, enzyme-free water and 1×T4 reaction buffer, and does not contain T4 ligase. In the comparative example, enzyme-free water was used instead of T4 ligase in the example, and the other steps were the same as the example. The results are shown in Figure 1 Enzyme-free water is commercially available water that does not contain biological enzymes and is used exclusively for control experiments.

[0047] Depend on Figure 1 It shows that in the control example without T4 ligase, the molecular weight of the target nucleic acid chain remains unchanged, and no phosphodiester bond is formed in the DNA; while in the example, the addition of T4 ligase plays a catalytic role, and the Met agonist cDA formed usually forms a supercoiled structure, which is more compact, has less friction in the gel, and can pass through the gel pores more easily. Therefore, compared with the linear nucleic acid chain ssDA, it will be in a more forward position.

[0048] It will be easily understood by those skilled in the art that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A closed dumbbell-shaped Met agonist, which is a closed dumbbell-shaped DNA agonist for regulating the Met signaling pathway. The Met agonist is named cDA, which is a closed nucleotide sequence and is dumbbell-shaped as a whole. The loops at both ends are connected together by a neck in the middle, and the neck sequence is composed of reverse complementary paired base pairs.

2. The closed dumbbell-shaped Met agonist according to claim 1, characterized in that The loops at both ends of the cDA include 34 to 40 bases and are functional sequences; and the neck in the middle is a rigid linker including multiple base pairs.

3. The closed dumbbell-shaped Met agonist according to claim 2, characterized in that The neck of the cDA includes 13 bp, and the cDA is constructed from a linear Met agonist named ssDA, and the base sequence of the ssDA is as follows: ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGATCGTGT CACGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAGTGACACG.

4. The closed dumbbell-shaped Met agonist according to claim 3, characterized in that The 5' end of the ssDA is first phosphorylated, and then the 5' end and the 3' end of the ssDA are connected using DNA ligase to form the cDA. Preferably, T4 ligase and ssDA solution are first incubated at 16-22° C. for 1-2 hours, and then incubated at 65-75° C. for 5-10 minutes to obtain the cDA.

5. A use of a closed dumbbell-shaped Met agonist as claimed in any one of claims 1 to 4, characterized in that: The closed dumbbell-shaped Met agonist is used in cell or in vivo therapy.

6. The use according to claim 5, characterized in that: The closed dumbbell-shaped Met agonist is used for regulating angiogenesis, preferably for treating diabetic ulcers in humans or animals.

Images