Application of PCIF1 gene in tumor immunotherapy

Abstract

The invention discloses application of a PCIF1 gene in tumor immunotherapy, and relates to the technical field of tumor immunotherapy. The PCIF1 inhibitor is combined with CAR T cells or the PCIF1 inhibitor is combined with a PD-1 / PD-L1 therapeutic antibody to prepare a medicine for treating tumors, the medicine has an obvious inhibiting effect on the tumor cells, the activity of the CAR T cells in tumor treatment can be remarkably improved, and the tumor cell inhibiting effect after combination is further improved. Based on the discovery, the PCIF1 inhibitor can be combined with a PD-1 / PD-L1 therapeutic antibody or a CAR T cell to predict the sensitivity of a tumor patient to a medicine for treating the tumor, and a medicine combination with the best treatment effect on a certain specific tumor is screened on the basis of the prediction of the sensitivity of the tumor patient to the medicine for treating the tumor.

Description

Technical Field

[0001] The present invention relates to the technical field of tumor immunotherapy, and in particular to the application of PCIF1 gene in tumor immunotherapy. Background Art

[0002] Cancer immunotherapies, such as immune checkpoint blockade and CAR T-cell therapy, have revolutionized cancer treatment, but only a minority of patients have been observed to benefit from durable treatment. The mechanisms of drug resistance in most patients remain to be further explored. Epitranscriptomics is an emerging field that focuses on the study of RNA post-transcriptional modifications and their key regulatory effects on gene expression and various physiological and pathophysiological processes.

[0003] Among the many RNA modifications, m 6 A is the most common internal modification of mRNA. 6 Dysregulation of A is widely associated with a variety of human diseases including cancer. 6 A is similar, m 6 Am is also a dynamic and reversible epitranscriptome marker. Therapeutic approaches targeting key regulators in this pathway are expected to become potential strategies for treating cancer. Summary of the invention

[0004] The present invention provides an application of PCIF1 gene in tumor immunotherapy. Studies have found that while inhibiting the expression of PCIF1 gene in CAR T cells or inhibiting the activity of PCIF1 protein, combined use of PD-1 / PD-L1 therapeutic antibodies or CAR T cell therapy can more significantly inhibit the effect of tumor growth compared to using PD-1 / PD-L1 therapeutic antibodies alone, or using CAR T cell therapy alone, or using inhibitors of PCIF1 gene expression or PCIF1 protein activity alone. This is specifically achieved through the following technologies.

[0005] The first aspect of the present invention provides a combination preparation for treating tumors, which is composed of a PCIF1 inhibitor and CAR T cells, or a PCIF1 inhibitor and PD-1 / PD-L1 therapeutic antibodies; the PCIF1 inhibitor is a product that inhibits PCIF1 gene expression in lymphocytes or inhibits PCIF1 protein activity.

[0006] In the present invention, the information of PCIF1 gene is as follows: Gene ID of PCIF1 gene: 63935, and detailed information can be obtained in the NCBI database according to the Gene ID.

[0007] In the present invention, the CAR T cell refers to a chimeric antigen receptor (CAR) T cell, which is engineered to recognize and bind to a target antigen expressed by a cell, such as an antigen expressed by a disease cell, such as an antigen expressed by a cancer cell. T cells expressing CAR polypeptides are referred to as CAR T cells. CAR has the ability to redirect T cell specificity and reactivity to a selected target in a non-MHC restricted manner. Non-MHC restricted antigen recognition gives CAR T cells the ability to recognize antigens independent of antigen processing, thereby bypassing the main mechanism of tumor escape.

[0008] The present invention has found through research that in addition to the original cancer / tumor growth inhibition effects of PCIF1 inhibitors, PD-1 / PD-L1 therapeutic antibodies or CAR T cells themselves, when PCIF1 inhibitors are used in combination with PD-1 / PD-L1 therapeutic antibodies or CAR T cells, PCIF1 inhibitors can significantly enhance the activity of CAR T cells, thereby achieving a dual synergistic cancer / tumor inhibition effect.

[0009] The functions of PCIF1 inhibitors are specifically divided into two types: inhibiting PCIF1 gene expression and inhibiting PCIF1 protein activity. Therefore, according to their respective functions, further, the PCIF1 inhibitor can be a nucleic acid molecule, a nucleic acid construct, a lentivirus, an antibody or a small molecule compound.

[0010] Furthermore, the lymphocytes are CD19 CAR T cells. CD19 CAR T cells refer to chimeric antigen receptor T cells that target human CD19 antigen.

[0011] Further, the tumor is lung cancer, colon cancer, rectal cancer, melanoma, lymphoma or oral cancer.

[0012] The second aspect of the present invention provides an application of a reagent for detecting the expression level of PCIF1 gene or the activity of PCIF1 protein in the preparation of an immunotherapy prediction reagent, wherein the immunotherapy prediction reagent predicts the sensitivity of the tumor patient to PD-1 / PD-L1 therapeutic antibodies or CAR T cells by detecting the PCIF1 gene expression level or the PCIF1 protein activity in the tumor tissue of the tumor patient.

[0013] The third aspect of the present invention provides a method for predicting the sensitivity of a tumor to a tumor therapeutic drug that is not for the purpose of disease diagnosis and treatment, characterized in that the tumor therapeutic drug is a PD-1 / PD-L1 therapeutic antibody or a CART cell, and the sensitivity of the tumor to the tumor therapeutic drug is predicted by detecting the PCIF1 gene expression level or PCIF1 protein activity in the tumor tissue.

[0014] The claim of "not for the purpose of disease diagnosis and treatment" in the present invention means that it is not used in the clinical stage, or no human or animal living subjects are used for testing.

[0015] For example, various cancer / tumor cell lines purchased or obtained through other channels can be selected as test subjects to study the sensitivity of tumors to alternative therapeutic drugs, and then screen out more effective therapeutic drugs and treatment plans for patients with such tumors.

[0016] The fifth aspect of the present invention provides a method for in vitro screening of drugs for treating tumors, characterized in that a PCIF1 inhibitor is used as a candidate primary screening drug; the candidate primary screening drug is combined with PD-1 / PD-L1 therapeutic antibodies or CAR T cells to screen out the drug with the best anti-tumor efficacy; the PCIF1 inhibitor is a product that inhibits PCIF1 gene expression or inhibits PCIF1 protein activity.

[0017] Compared with the prior art, the present invention is beneficial in that: the present invention has found that the combination of PCIF1 inhibitor and PD-1 / PD-L1 therapeutic antibody, or CAR T cell therapy, has a significant inhibitory effect on tumor cells. PCIF1 inhibitor can also significantly enhance the activity of CAR T cells in tumor treatment, further enhancing the tumor cell inhibition effect after combined use.

[0018] The above findings make it possible to combine PCIF1 inhibitors with PD-1 / PD-L1 therapeutic antibodies or CAR T cells for tumor treatment. It can also predict the sensitivity of tumor patients to tumor treating drugs and use this as a basis to screen out the drug combination with the best treatment effect for a specific tumor. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The effect of systemic knockout (KO) of the Pcif1 gene on the growth of LLC subcutaneous lung cancer tumors in mice. Figure 1 A is the statistical result of LLC tumor growth curve after systemic knockout of Pcif1 gene (KO) in mice; Figure 1 B is the statistical result of LLC tumor weight transplanted subcutaneously in mice after systemic knockout of Pcif1 gene (KO); Figure 1 C is the survival statistics of mice with subcutaneous LLC tumors after systemic knockout of Pcif1 gene (KO); Figure 1 D shows the effect of systemic Pcif1 knockout (KO) on tumor-infiltrating CD8 + Contour plot of flow cytometric analysis of T cell killing activity; Figure 1 E shows the effect of systemic Pcif1 knockout (KO) on the tumor-infiltrating CD8 +Statistical graph of the results of flow cytometry analysis of T cell killing activity.

[0020] Figure 2 The effect of T cell-specific knockout of Pcif1 gene (cKO) on the growth of LLC subcutaneous lung cancer tumors in mice. Figure 2 A is the statistical result of LLC tumor growth curve after T cell-specific knockout of Pcif1 gene (cKO) in mice; Figure 2 B is the statistical result of LLC tumor weight transplanted subcutaneously in mice after T cell-specific knockout of Pcif1 gene (cKO); Figure 2 C is the survival statistics of mice with LLC tumors transplanted subcutaneously after T cell-specific knockout of Pcif1 gene (cKO); Figure 2 D is the T cell-specific knockout of Pcif1 gene (cKO) in mice with LLC tumor-infiltrating CD8 + Contour plot of flow cytometric analysis of T cell killing activity; Figure 2 E shows the infiltration of CD8 T cells in LLC tumors after T cell-specific knockout of Pcif1 gene (cKO) in mice. + Statistical graph of the results of flow cytometry analysis of T cell killing activity.

[0021] Figure 3 After systemic knockout of Pcif1 gene (KO), CD8 + Changes in T cell activity in the anti-CD3 / CD28 in vitro activation model. Figure 3 A shows CD8 in Pcif1 WT and KO mice + Flow cytometric contour plot of the expression of early activation marker (CD69) after T cells were activated in vitro with anti-CD3 / CD28 for 5 h; Figure 3 B is the CD8 of Pcif1 WT and KO mice + Flow cytometry results of early activation marker (CD69) expression after T cells were activated in vitro with anti-CD3 / CD28 for 5 hours; Figure 3 C shows CD8 in Pcif1 WT and KO mice + Flow cytometric contour plot of the expression of cytotoxic activity marker (Gzmb) after T cells were activated in vitro with anti-CD3 / CD28 for 72 h; Figure 3 D is the CD8 + Flow cytometry results of the expression of cytotoxic activity marker (Gzmb) after T cells were activated in vitro with anti-CD3 / CD28 for 5 hours.

[0022] Figure 4PCIF1 expression in immune infiltrating cells in tissue specimens from oral cancer patients who responded or did not respond to anti-PD-1 therapeutic antibodies. Figure 4 A is the IHC result of human oral cancer samples, detecting the expression of PCIF1 in immune-infiltrating cells of tissue specimens from oral cancer patients who responded or did not respond to anti-PD-1 therapeutic antibodies; Figure 4 B shows the proportion of patients with low or high expression of PCIF1 protein on tumor-infiltrating immune cells who responded to anti-PD-1 therapeutic antibodies.

[0023] Figure 5 The response of LLC tumor cells to PD-1 therapeutic antibodies in mice subcutaneously transplanted with Pcif1 gene after T cell-specific knockout (cKO). Figure 5 A shows the effect of LLC tumor cells transplanted subcutaneously in mice, and anti-PD-1 therapeutic antibodies alone or in combination with anti-PD-1 therapeutic antibodies after mouse T cell-specific knockout of the Pcif1 gene (cKO) on tumor growth in mice; Figure 5 B is a comparison of LLC tumor weights in mice with LLC tumor cells transplanted subcutaneously and treated with anti-PD-1 therapeutic antibodies alone or in combination with anti-PD-1 therapeutic antibodies after mouse T cell-specific knockout of the Pcif1 gene (cKO); Figure 5 C is a comparison of the survival time of mice transplanted with LLC tumor cells subcutaneously and treated with anti-PD-1 therapeutic antibodies alone or in combination with anti-PD-1 therapeutic antibodies after mouse T cell-specific knockout of the Pcif1 gene (cKO).

[0024] Figure 6 This is a test to investigate the inhibitory effect of knocking down the expression of PCIF1 gene in CAR T cells on tumor progression in a humanized mouse model. Figure 6 A is a graph of tumor fluorescence intensity obtained by in vivo imaging of immunodeficient mice 7 days after tail vein injection of RAJI-GFP tumor cells, which were then treated with engineered WT and PCIF1 gene knockdown CAR T cells. Figure 6 B is a statistical graph of tumor fluorescence intensity obtained by in vivo imaging of immunodeficient mice 7 days after tail vein injection of RAJI-GFP tumor cells, followed by further injection of engineered WT and PCIF1 gene knockdown CAR T cells for treatment; Figure 6 C shows the statistical results of mouse survival after RAJI-GFP tumor cells were injected into the tail vein of immunodeficient mice 7 days later, followed by injection of engineered WT and PCIF1 gene knockdown CAR T cells.

[0025] Figure 7Knockout of Pcif1 gene expression in CAR T cells inhibited tumor progression in mice subcutaneously transplanted with LLC cells expressing human CD19 (LLC-hCD19). Figure 7 A is the growth curve of LLC-hCD19 tumors after LLC-hCD19 cells were subcutaneously transplanted in mice and treated with engineered WT and Pcif1 KO CD19 CAR T cells injected through the tail vein; Figure 7 B is the statistics of tumor weight of mice after LLC-hCD19 cells were subcutaneously transplanted in mice and treated with engineered WT and Pcif1 KO CD19CAR T cells injected through the tail vein; Figure 7 C shows that LLC-hCD19 cells were subcutaneously transplanted into mice. After tail vein injection of engineered WT and Pcif1 KO CD19 CAR T cells, the tumor-infiltrating CD8 + Flow cytometric contour plot of CAR T cell killing activity; Figure 7 D shows that LLC-hCD19 cells were subcutaneously transplanted into mice. After tail vein injection of engineered WT and Pcif1 KO CD19 CAR T cells, the tumor-infiltrating CD8 + Statistical graph of flow cytometry results of CAR T cell killing activity.

[0026] Figure 8 Knockout of Pcif1 gene expression in CAR T cells inhibited tumor progression in mice subcutaneously transplanted with MC38 cells expressing human CD19 (MC38-hCD19). Figure 8 A is the growth curve of MC38-hCD19 tumors after subcutaneous transplantation of MC38-hCD19 cells in mice and treatment with engineered WT and Pcif1 KO CD19 CAR T cells injected through the tail vein; Figure 8 B is the statistics of mouse tumor weight after subcutaneous transplantation of MC38-hCD19 cells in mice and tail vein injection of engineered WT and Pcif1 KO CD19 CAR T cells; Figure 8 C shows that MC38-hCD19 cells were subcutaneously transplanted into mice. After tail vein injection of engineered WT and Pcif1 KO CD19 CAR T cells, the tumor-infiltrating CD8 + Flow cytometry contour plot of the killing activity of CART cells; Figure 8 D shows the tumor-infiltrating CD8 + Statistical graph of flow cytometry results of CAR T cell killing activity. DETAILED DESCRIPTION

[0027] The technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] The following specific implementation cases provided by the present invention mainly target several cancers / tumors, including RAJI human lymphoma cell line, MC38 mouse colorectal cancer cell line, LLC mouse lung cancer cell line and oral cancer, and study the effects of the combination of PCIF1 inhibitors and PD-1 / PD-L1 therapeutic antibodies, or the combination of PCIF1 inhibitors and CAR T cell therapy, on the growth of these cancers / tumors.

[0029] The present invention respectively uses mice with systemic PCIF1 gene knockout (KO) and mice with T cell-specific PCIF1 gene knockout (cKO) as experimental models to study the effect of PCIF1 gene on the growth of different cancers / tumors and its general mechanism of action, and also studies the effect of CAR T cell-specific knockout of PCIF1 gene on the growth of different cancers / tumors; the present invention also studies the effect of using anti-PD-1 therapeutic antibodies alone, or using mouse T cells to specifically knock out PCIF1 alone, or using anti-PD-1 therapeutic antibodies to treat mice with specific PCIF1 gene knockout to simulate the scenario of the combination of PCIF1 gene inhibitors and anti-PD-1 therapeutic antibodies, or using CAR T cells with PCIF1 gene knockdown to simulate the scenario of the combination of PCIF1 gene inhibitors and CAR T cells, on the growth of different cancers / tumors.

[0030] Specifically, the present invention uses mice with systemic knockout (KO) of the PCIF1 gene as test subjects as an alternative to studying the cancer treatment effect of PCIF1 inhibitors.

[0031] Specifically, the present invention selects T cells with specific PCIF1 knockout as an alternative for studying the effects of PCIF1 inhibitors on CAR T cell activity.

[0032] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or obtained by existing methods.

[0033] 1. Test Materials

[0034] In the following specific embodiments of the present invention, the materials used are as follows.

[0035] 1. Clinical samples or cell lines

[0036] RAJI human lymphoma cell line and LLC mouse lung cancer cell line were purchased from ATCC cell bank.

[0037] The MC38 mouse colon cancer cell line was kindly provided by the laboratory of Dr. Arlene H. Sharpe at Harvard Medical School.

[0038] LLC mouse lung cancer cell line and MC38 mouse colon cancer cell line were cultured using complete medium (DMEM, Hyclone) cell culture medium plus 10% fetal bovine serum (Cellmax), 100 U penicillin, and 100 mg / ml streptomycin (Hyclone).

[0039] Human oral cancer samples were provided by the Wuhan University Stomatological Hospital and approved by the Medical Ethics Committee of the Wuhan University Stomatological Hospital.

[0040] 2. Mice

[0041] Pcif1 knockout C57BL / 6 mice were purchased from Jiangsu Jicui Pharmaceutical Co., Ltd. and bred into whole body knockout (KO) homozygous mice and T cell-specific knockout (cKO) mice after verification at the DNA, RNA and protein levels by the applicant of the present invention.

[0042] All protocols and experiments using mouse models were performed in accordance with relevant ethical regulations and approved by the Institutional Animal Care and Use Committee of Wuhan University (MRI2022-LAC089). The mice used in the experiments were maintained under standard housing conditions in the pathogen-free facility of the Institute of Medical Sciences of Wuhan University.

[0043] 3. Test related reagents

[0044] PD-1 / PD-L1 therapeutic antibodies were purchased from Bioxcell.

[0045] 2. Test methods

[0046] 1. Immunohistochemistry (IHC) experiment

[0047] (1) Paraformaldehyde-fixed and paraffin-embedded tissues were cut into 4 µm sections.

[0048] (2) Dehydrogenate the sections in xylene and hydrate them in 100%, 95%, and 75% ethanol for 5 min, respectively.

[0049] (3) Heat the sections in 0.01 M citrate buffer (pH = 6.0) in a microwave oven for 15 min for heat-mediated antigen retrieval.

[0050] (4) Incubate the sections with 3% hydrogen peroxide at room temperature for 15 min to quench endogenous peroxidase activity.

[0051] (5) Incubate in 10% normal goat serum for 1 h to block nonspecific binding, and then incubate the sections with the primary antibody overnight at 4°C; wash three times with PBS, each wash for 5 min.

[0052] (6) Incubate the sections with goat secondary antibody solution for 1 h.

[0053] (7) After washing with PBS, specific detection was performed using the Servicebio detection kit peroxidase / diaminobenzamine (DAB) (G1212-200T, Servicebio).

[0054] (8) Counterstaining was performed with Mayer's hematoxylin. Immunohistochemical staining was performed using a Leica Aperio VERSA 8 Aperioimagescope (v12.3.2.8013) multi-function scanner. The DAB staining intensity was measured and quantified using Aperio Quantification software.

[0055] result: Figure 4 A is the IHC result of human oral cancer samples, detecting the expression of PCIF1 in immune infiltrating cells of tissue specimens from oral cancer patients who responded or did not respond to anti-PD-1 therapeutic antibodies.

[0056] 2. Animal experiments

[0057] (1) Pcif1 gene knockout mouse tumor bearing experiment

[0058] ① LLC cell preparation

[0059] LLC mouse lung cancer cell line was obtained, and the cells were digested with 0.05% trypsin and washed twice with PBS; then the digestion was terminated with DMEM and the supernatant was removed by centrifugation; the cells were resuspended in DMEM, the cells were fully blown, and the cells were counted, and the cell density was adjusted to 1×10 6 / mL. In the process of preparing cells, in order to prevent the cell digestion time from being too long and the cell growth density from being too high, the maximum cell density was controlled within 80% to maintain the optimal state of cell growth;

[0060] ②Cell transplantation

[0061] 100 μL LLC cell suspension (resuspended in serum-free MDEM) was injected subcutaneously into the axilla of 6-8 week-old C57BL / 6 WT and Pcif1 systemic knockout (KO) mice or T cell-specific knockout (cKO) mice. After the injection, tumor formation was closely observed.

[0062] ③Tumor measurement and mouse sacrifice

[0063] The tumor growth was observed and recorded starting from the third day after the tumor cell injection. The length and width of the mouse tumor were measured every two days using a vernier caliper using the formula: length × width 2 ×0.5 to calculate the volume of mouse tumors. According to the ethics of experimental animals, when the volume of mouse tumors reached 1500 mm 3 When the diameter of the tumor ulcer exceeds 1 cm, the mice are euthanized. The tumor growth curve of the mice after cell injection is recorded and prepared.

[0064] result: Figure 1 To investigate the effect of systemic knockout (KO) of Pcif1 on the growth of LLC subcutaneous lung cancer tumors in mice. Figure 2 The effect of T cell-specific knockout of Pcif1 gene (cKO) on the growth of subcutaneous lung cancer LLC tumors in mice.

[0065] (2) Mouse primary CD8 + In vitro T cell activation assay

[0066] Using mouse CD8 + T cell isolation kit is used to isolate spleen primary CD8 T cells from whole body Pcif1 knockout (KO) or wild type (WT) mice. + T cells.

[0067] To detect T cell activation, primary CD8 + T cells were then stained with FITC-CD69 flow cytometry antibody and verified by flow cytometry.

[0068] To detect cytokine secretion, primary CD8 + T cells for 72 hours. Brefeldin A (BFA) at a concentration of 5 μg / mL was added in the last 5 hours of stimulation to block cytokine transport and prevent its secretion. The cells were then collected and stained with BV510 - CD8 and PE-CF594-Gzmb flow antibodies, and finally verified by flow cytometry.

[0069] result: Figure 3 After systemic knockout of Pcif1 gene, mouse CD8 + Changes in T cell activity in the anti-CD3 / CD28 in vitro activation model.

[0070] (3) T cell-specific knockout of Pcif1 gene (cKO) combined with PD-1 antibody treatment experiment

[0071] ① LLC cell preparation

[0072] LLC mouse lung cancer cell line was obtained, and the cells were digested with 0.05% trypsin and washed twice with PBS; then the digestion was terminated with DMEM and the supernatant was removed by centrifugation; the cells were resuspended in DMEM, the cells were fully blown, and the cells were counted, and the cell density was adjusted to 1×10 6 / mL. In the process of preparing cells, in order to prevent the cell digestion time from being too long and the cell growth density from being too high, the maximum cell density was controlled within 80% to maintain the optimal state of cell growth.

[0073] ②Cell transplantation

[0074] 100 μL LLC cell suspension (resuspended in serum-free MDEM) was injected subcutaneously into the axilla of 6-8 week-old C57BL / 6 WT and Pcif1cKO mice. After the injection, tumor formation was closely observed.

[0075] ③ Medication strategy

[0076] The mice injected with LLC cells were divided into 4 groups: WT group, Pcif1 cKO group, WT mouse PD-1 antibody treatment group, and Pcif1 cKO mouse PD-1 antibody treatment group. In the above model groups, the dosage of PD-1 monoclonal antibody was 100 μg / mouse, and it was intraperitoneally injected once every three days.

[0077] ④Tumor measurement and mouse sacrifice

[0078] The tumor growth was observed and recorded starting from the third day after the tumor cell injection. The length and width of the mouse tumor were measured every two days using a vernier caliper using the formula: length × width 2 ×0.5 to calculate the volume of mouse tumors. According to the ethics of experimental animals, when the volume of mouse tumors reached 1500 mm 3 When the diameter of the tumor ulcer exceeds 1 cm, the mice are euthanized. The tumor growth curve of the mice after cell injection is recorded and prepared.

[0079] result: Figure 5 The response of LLC to PD-1 therapeutic antibody in mice subcutaneously transplanted after T cell-specific knockout of Pcif1 gene.

[0080] (4) Experiments on WT and PCIF1 gene knockdown CAR T cells in the treatment of humanized mouse tumors

[0081] ① Isolation of human T cells and construction of WT and PCIF1 gene knockdown CAR T

[0082] Isolation of CD3 from PBMCs using the CD3ε MicroBead Kit + T cells were then activated with Dynabeads™ T-activator CD3 / CD28 for 24 h. Then, human CD3 T cells were infected with shControl-CAR and shPCIF1-CAR lentiviruses (MOI ranged from 5 to 10). + T cells, construct WT and PCIF1 gene knockdown CAR T cells; culture the infected PCIF1 knockdown CD3 + CAR T cells.

[0083] The shPCIF1-CAR targeting sequence is mainly concentrated in the CDS region of the PCIF1 gene, for example: “cgtggtctgcatccggtataa”, and the sequence is shown in SEQ ID NO.1.

[0084] The above-mentioned shPCIF1-CAR targeting sequence can also be used as a PCIF1 inhibitor for preparing a combination preparation for treating tumors, which can reduce PCIF1 gene expression in lymphocytes.

[0085] Alternatively, the lymphocytes may be T cells.

[0086] ②Construction and treatment of humanized mouse tumor models

[0087] To establish the human cell line-derived xenograft (CDX) mouse model, 6- to 8-week-old immunodeficient mice (NCG) were intravenously injected with 5 × 10 5 RAJI-GFP cells. After transplantation, tumor progression was carefully followed by bioluminescence imaging on day 7, and the distribution of the experimental groups was even. 6 The treatment group received 1×10 6 Bioluminescence imaging was performed weekly using a Xenogen IVIS 200 instrument (PerkinElmer, USA) and subsequently analyzed using Living Image software (PerkinElmer, USA).

[0088] result: Figure 6 To test the inhibitory effect of knocking down PCIF1 expression in CAR T cells on tumor progression in a humanized mouse model.

[0089] (5) Experiment on Pcif1 gene knockout CAR T cell therapy in mouse tumors

[0090] ① Anti-CD19 CAR construction

[0091] The anti-CD19 single-chain fragment variable (scFv) nucleotide was derived from a mouse antibody (clone FMC63). The scFv of CD19 was cloned into the PLVX-puro lentiviral vector fused to the mouse CD8α hinge, CD28 transmembrane and intracellular domains, and CD3ζ-derived cytoplasmic domain.

[0092] Lentivirus was produced using a polyethylenimine-based DNA transfection system described in the published papers “USP8 inhibition reshapes an inflamed tumor microenvironment that potentiates the immunotherapy” (https: / / doi.org / 10.1038 / s41467-022-29401-6) and “ERK and USP5 govern PD-1 homeostasis via deubiquitination to modulate tumor immunotherapy” (https: / / doi.org / 10.1038 / s41467-023-38605-3).

[0093] ②Isolation of mouse T cells and transduction of CAR

[0094] Mouse T cells were isolated from spleen cells of Pcif1 WT and KO mice using the Mouse CD3ε MicroBead Kit; subsequently, they were activated for 24 h using Dynabeads™ Mouse T-activator CD3 / CD28; then, cells were infected with lentivirus (MOI ranged from 5 to 10) and activated murine T cells were cultured in CTSTM OpTmizerTM T Cell Expansion SFM containing MACS® GMP recombinant human IL-2 (1000 IU / ml) and l-glutamine (2 mM).

[0095] ③Construction and treatment of mouse tumor model

[0096] On day 0, 6- to 8-week-old C57BL / 6 WT mice were injected subcutaneously with 1 × 10 6 LLC-hCD19 cells or 1×10 5MC38-hCD19 cells. After inoculation, the tumor progression was carefully observed on the 7th day, and the distribution of each experimental group was even. At the same time, the control group received 1×10 6 The treatment group received 1×10 6 After that, the length and width of the tumors of mice were measured every two days using a vernier caliper, using the formula: length × width 2 ×0.5 to calculate the volume of mouse tumors. According to the ethics of experimental animals, when the volume of mouse tumors reached 1500 mm 3 When the diameter of the tumor ulcer exceeds 1 cm, the mice are euthanized. The tumor growth curve of the mice after cell injection is recorded and prepared.

[0097] result: Figure 7 Knockout of Pcif1 gene expression in CAR T cells inhibited tumor progression in mice subcutaneously transplanted with LLC cells expressing human CD19 (LLC-hCD19).

[0098] Figure 8 Knockout of Pcif1 gene expression in CAR T cells inhibited tumor progression in mice subcutaneously transplanted with MC38 cells expressing human CD19 (MC38-hCD19).

[0099] 3. Test results

[0100] (1) Systemic knockout (KO) and T cell-specific knockout (cKO) of Pcif1 significantly inhibited the growth of LLC subcutaneous lung cancer tumors in mice

[0101] Figure 1 The effect of systemic knockout (KO) of Pcif1 on the growth of LLC subcutaneous lung cancer tumors in mice. Figure 1 It can be seen that after injection of LLC cells, the tumor volume growth and tumor weight of mice with systemic Pcif1 knockout (KO) were significantly lower than those of wild-type mice ( Figure 1 A and Figure 1 B); The survival time of tumor-bearing Pcif1 knockout (KO) mice was significantly prolonged ( Figure 1 C); and, in Pcif1 knockout (KO) mice, tumor-infiltrating CD8 + In T cells, the secretion of cytokine Gzmb increased significantly ( Figure 1 D and Figure 1 E).

[0102] Figure 2The effect of T cell-specific knockout of Pcif1 gene (cKO) on the growth of LLC subcutaneous lung cancer tumors in mice. Figure 2 It can be seen that compared with wild-type mice, the tumor volume growth and tumor weight of mice with T cell-specific Pcif1 gene knockout (cKO) were significantly lower ( Figure 2 A and Figure 2 B); The survival time of tumor-bearing T cell-specific Pcif1 knockout (cKO) mice was significantly prolonged ( Figure 2 C); Furthermore, in T cell-specific Pcif1 knockout (cKO) mice, tumor-infiltrating CD8 + In T cells, the secretion of cytokine Gzmb increased significantly ( Figure 2 D and Figure 2 E).

[0103] This phenomenon suggests that the loss of the Pcif1 gene may have an adverse effect on CD8 + This affects the function of T cells, thereby increasing the secretion of Gzmb, providing a valuable research direction for in-depth exploration of tumor immune mechanisms and related treatment strategies.

[0104] (2) Knockout of the Pcif1 gene significantly enhances CD8 + Functions of T cells

[0105] Figure 3 After Pcif1 gene knockout, mouse CD8 + To directly explore whether the expression status of Pcif1 affects the activity of CD8 + To activate T cells in vitro, we isolated primary CD8 T cells from the spleens of Pcif1 knockout (KO) and wild-type (WT) mice. + T cells were stimulated with anti-CD3 / CD28 antibodies as a well-established in vitro activated CD8 + T cell means that can provide co-stimulatory signals for T cell receptor (TCR) signaling.

[0106] Our flow cytometry results showed that after 5 hours of anti-CD3 / CD28 antibody stimulation, the percentage of T cell activation marker CD69 was significantly increased in Pcif1 KO CD8 + Significantly upregulated in T cells ( Figure 3 A and Figure 3 B); In addition, when stimulated with anti-CD3 / CD28 antibodies for 72 hours, CD8 + The percentage of cytokine Gzmb secreted by T cells was significantly upregulated ( Figure 3 C and Figure 3 D). This series of results proves that Pcif1 gene is in CD8 + It plays an important role in T cell activation and cytokine secretion.

[0107] (3) Low expression of PCIF1 in immune-infiltrating cells can enhance tumor response to PD-1 / PD-L1 therapeutic antibodies

[0108] Considering that the loss of Pcif1 in T cells enhances CD8 + T cell activation, which may facilitate immune checkpoint blockade therapy. To test this hypothesis, we performed immunohistochemical (IHC) staining of PCIF1 in specimens from 44 human oral squamous cell carcinoma (OSCC) patients enrolled in a phase II clinical trial involving anti-PD-1 therapy (NCT04649476). The results showed that most responders (pathological response of more than 50%) had significantly lower PCIF1 expression in lymphocyte infiltration areas compared with non-responders ( Figure 4 A and Figure 4 B).

[0109] We subcutaneously transplanted mouse LLC lung cancer cells into wild-type (WT) and Pcif1 conditional knockout (cKO) mice, and then treated these mice with anti-PD-1 antibodies or control IgG. The results showed that the therapeutic effect of Pcif1 conditional knockout (cKO) mice combined with anti-PD-1 therapeutic antibodies was significantly improved compared with that of wild-type (WT) mice combined with PD-1 therapeutic antibodies. This advantage was clearly reflected by the inhibition of tumor growth and the reduction in tumor weight ( Figure 5 A and Figure 5 B). The survival of mice in the Pcif1 conditional knockout (cKO) mice combined with anti-PD-1 treatment group was significantly prolonged compared with that of wild-type (WT) mice combined with anti-PD-1 treatment ( Figure 5 C).

[0110] (4) Knocking down / knockout PCIF1 in T cells can promote the efficacy of CAR T

[0111] Figure 6 This study aimed to investigate the inhibitory effect of knocking down PCIF1 expression in CAR T cells on RAJI tumor progression in a humanized mouse model. Figure 6 It can be seen that knocking down PCIF1 expression in CAR T cells can significantly inhibit the growth of RAJI tumor cells ( Figure 6 A-6C).

[0112] Figure 7To knock out the expression of the Pcif1 gene in CAR T cells, a tumor progression inhibition experiment was conducted on mice subcutaneously transplanted with LLC lung cancer cell lines expressing human CD19 (LLC-hCD19). Figure 7 It can be seen that knocking out the expression of Pcif1 in CART cells can significantly inhibit the growth of LLC-hCD19 tumor cells ( Figure 7 In addition, in tumor-infiltrating Pcif1 knockout (KO) CAR T cells, CD8 + The secretion level of cytokine Gzmb in T cells showed a significant increase ( Figure 7 C and 7D).

[0113] Figure 8 To knock out the expression of the Pcif1 gene in CAR T cells, a tumor progression inhibition experiment was conducted on mice subcutaneously transplanted with MC38 colorectal cancer cell line expressing human CD19 (MC38-hCD19). Figure 8 It can be seen that knocking out the expression of Pcif1 in CAR T cells can significantly inhibit the growth of MC38-hCD19 tumor cells ( Figure 8 In addition, in tumor-infiltrating Pcif1 KO CAR T cells, CD8 + The secretion level of cytokine Gzmb in T cells showed a significant increase ( Figure 8 This phenomenon suggests that Pcif1 gene knockout may affect CD8 + The function of T cells, thereby regulating the secretion level of cytokines, has a positive impact on the tumor microenvironment, providing important clues for further research on the mechanism of tumor immunotherapy.

[0114] The above series of test results prove that when the PCIF1 gene inhibitor is used and combined with PD-1 / PD-L1 therapeutic antibodies or CAR T cell therapy, it can significantly inhibit the growth of LLC tumors, RAJI human lymphoma and MC38 mouse colon cancer cells by promoting lymphocyte activity. In contrast, when PD-1 / PD-L1 therapeutic antibodies or CAR-T cell therapy are used alone, the effect is not as ideal as the combined application of the above methods, and there is a significant gap in the performance of inhibiting tumor growth. This shows that the combined application scheme proposed in the present invention has unique advantages in the field of tumor treatment and provides new ideas and directions for improving the effect of tumor treatment.

[0115] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. A combined preparation for treating tumors, characterized in that: It is composed of a PCIF1 inhibitor and CAR T cells, or a PCIF1 inhibitor and PD-1 / PD-L1 therapeutic antibody; the PCIF1 inhibitor is a product that inhibits PCIF1 gene expression in lymphocytes or inhibits PCIF1 protein activity.

2. The combined preparation for treating tumors according to claim 1, characterized in that: The PCIF1 inhibitor is a nucleic acid molecule, a nucleic acid construct, a lentivirus, an antibody or a small molecule compound.

3. The combined preparation for treating tumors according to claim 1, characterized in that: The lymphocytes are CD19 CART cells.

4. The combined preparation for treating tumors according to claim 1, characterized in that: The tumor is lung cancer, colon cancer, rectal cancer, melanoma, lymphoma or oral cancer.

5. Use of a reagent for detecting PCIF1 gene expression level or PCIF1 protein activity in the preparation of an immunotherapy prediction reagent, characterized in that: The immunotherapy prediction reagent predicts the sensitivity of the tumor patient to PD-1 / PD-L1 therapeutic antibodies or CAR T cells by detecting the PCIF1 gene expression level or PCIF1 protein activity in the tumor tissue of the tumor patient.

6. A method for predicting the sensitivity of a tumor to a tumor therapeutic drug without the purpose of disease diagnosis and treatment, characterized in that: The tumor therapeutic drug is a PD-1 / PD-L1 therapeutic antibody or CAR T cell. The sensitivity of the tumor to the tumor therapeutic drug is predicted by detecting the PCIF1 gene expression level or PCIF1 protein activity in the tumor tissue.

7. A method for in vitro screening of drugs for treating tumors, characterized in that: A PCIF1 inhibitor is used as a candidate primary screening drug; the candidate primary screening drug is used in combination with PD-1 / PD-L1 therapeutic antibodies or CAR T cells to screen out a drug with the best anti-tumor efficacy; the PCIF1 inhibitor is a product that inhibits PCIF1 gene expression or inhibits PCIF1 protein activity.

Images