Non-alcoholic steatohepatitis model as well as construction method and application thereof

Abstract

The invention relates to the technical field of animal model construction, and discloses a non-alcoholic steatohepatitis model and a construction method and application thereof. The construction method comprises the following steps: performing stable overexpression on an AKT gene in the liver of a mouse by adopting a high-pressure caudal vein transfection technology, and feeding the mouse by adopting a high-fat feed. The non-alcoholic steatohepatitis model constructed by the construction method provided by the invention has the characteristics of liver inflammatory cell infiltration, liver fat deposition, insulin resistance, dyslipidemia and the like, has high clinical pathology similarity with NASH, has a remarkable steatohepatitis phenotype, can be used for researching the occurrence and development mechanism of NASH and evaluating the treatment effect of drugs, and has a wide application prospect. The method is of great significance to prevention and treatment of generation and development of NASH; meanwhile, the construction method is simple to operate, does not need transgenic animals, is short in feeding period, low in cost and high in efficiency, can effectively shorten the establishment period of the non-alcoholic steatohepatitis animal model, and has a good application prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of animal model construction, and in particular to a non-alcoholic fatty liver disease model, a construction method thereof and an application thereof. Background Art

[0002] Nonalcoholic fatty liver disease (NAFLD) is a common chronic liver disease worldwide, with an increasing incidence and prevalence. It includes a series of liver abnormalities, ranging from simple steatosis (fatty liver), nonalcoholic steatohepatitis (NASH), advanced liver necrosis, cirrhosis, and finally hepatocellular carcinoma (HCC) or liver failure associated with nonalcoholic fatty liver. Histologically, NASH is different from simple fatty liver. It is an inflammatory subtype in patients with nonalcoholic fatty liver. 25% of patients will experience progressive hepatic steatosis, inflammation and damage, and in some cases, advanced liver fibrosis. At present, there is still no standard treatment and targeted drugs for NASH, and its pathogenic mechanism still needs to be further studied.

[0003] Animal models are an important platform to support NASH treatment and drug development, and can be roughly divided into diet-induced, genetic, or a combination of multiple interventions. Although many models can lead to lipid accumulation in the liver, not all models accumulate through pathways known to be associated with human NASH. Clinical studies have shown that the main manifestations of NASH are abnormal liver function tests, abnormal blood lipid levels, insulin resistance, hepatocyte steatosis, vacuolar degeneration, and liver fibrosis. The main nutritional components of the diet-induced obesity model are similar to those of obese humans and are a popular NASH mouse model. However, C57BL / 6J mice do not continue to develop fatty hepatitis or advanced fibrosis on a high-fat diet, and the modeling cycle is long (more than 30 weeks). In addition, although simply stably overexpressing the AKT gene in the mouse liver can cause abnormal liver function tests, abnormal blood lipid levels, hepatocyte steatosis, vacuolar degeneration, and liver fibrosis in a short period of time, compared with the clinical symptoms of human NASH, it still lacks the main feature of insulin resistance and cannot fully simulate human NASH. Therefore, it is urgent to develop a NASH animal model that is more similar to the clinical symptoms of human NASH. Summary of the invention

[0004] The purpose of the present invention is to overcome the problems of the prior art non-alcoholic fatty liver disease model, such as long cycle, high cost, and inability to fully simulate human NASH, and to provide a non-alcoholic fatty liver disease model and its construction method and application. The non-alcoholic fatty liver disease model has a rapid, stable and typical NASH phenotype and can be used for preclinical studies of drug efficacy.

[0005] In order to achieve the above objectives, the present invention provides a method for constructing a non-alcoholic fatty liver disease model, which comprises: using high-pressure tail vein transfection technology to stably overexpress the AKT gene in the liver of mice, and feeding them with a high-fat diet.

[0006] Preferably, the construction method specifically comprises the following steps:

[0007] After adaptive feeding, mice were injected with AKT gene plasmid via tail vein transfection at high pressure;

[0008] The mice injected with AKT gene plasmid were fed with high-fat diet.

[0009] Preferably, the mouse is a wild-type FVB / N mouse or a C57BL / 6J mouse.

[0010] Preferably, the feeding period of the adaptive feeding is 5 to 9 days;

[0011] Preferably, the adaptive breeding environment includes: a temperature of 22-25° C. and a humidity of 45-55%.

[0012] Preferably, the AKT gene plasmid comprises a SB plasmid encoding Sleeping Beauty transposase and an AKT plasmid carrying a target gene transposon;

[0013] Preferably, the vector of the SB plasmid is a pCMV vector;

[0014] Preferably, the vector of the AKT plasmid is a pT3-EF1α vector.

[0015] Preferably, the AKT gene plasmid is prepared according to the following process: the SB plasmid encoding Sleeping Beauty transposase and the AKT plasmid carrying the target gene transposon are mixed with physiological saline.

[0016] Preferably, the mass ratio of the SB plasmid encoding Sleeping Beauty transposase to the AKT plasmid carrying the target gene transposon is 1:10-30.

[0017] Preferably, the high-fat feed feeding environment includes: temperature 22-25°C, humidity 45-55%;

[0018] Preferably, the conditions for raising the high-fat feed include: a feeding cycle of once a day and a feeding cycle of 3 to 4 weeks;

[0019] Preferably, the high-fat feed is high-fat feed D12492.

[0020] The second aspect of the present invention provides a non-alcoholic fatty liver disease model, which is constructed by the construction method described above.

[0021] The third aspect of the present invention provides a use of the above-mentioned non-alcoholic fatty liver disease model in studying the occurrence and development mechanism of non-alcoholic hepatitis and evaluating the effect of therapeutic drugs.

[0022] The advantages and beneficial effects of the present invention are:

[0023] (1) The method for constructing an animal model of non-alcoholic fatty liver disease provided by the present invention adopts high-pressure tail vein transfection technology to inject AKT gene plasmid to establish the model, which makes full use of the relationship between AKT gene and sugar metabolism and fat metabolism in the liver, so that the mice injected with AKT have disordered sugar and lipid metabolism, and after high-fat feeding, fat can be deposited in the liver, forming non-alcoholic fatty liver disease; the method has obvious effect.

[0024] (2) The construction method provided by the present invention is simple to operate, does not require transgenic animals, has a short breeding cycle, low cost, and high efficiency, and can effectively shorten the establishment cycle of the non-alcoholic fatty liver disease animal model, and has good application prospects.

[0025] (3) The non-alcoholic fatty liver disease model constructed by the construction method provided by the present invention has the characteristics of liver inflammatory cell infiltration, liver fat deposition, insulin resistance, dyslipidemia, etc., has a high similarity with the clinical pathology of NASH, and has a significant fatty liver disease phenotype. It can be used to study the occurrence and development mechanism of NASH and evaluate the effect of drug treatment. It is of great significance for preventing and treating the occurrence and development of NASH. In addition, it provides a good animal model for studying the pathogenesis of NASH, especially aspects related to abnormal glucose and lipid metabolism. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 These are the morphology and color results of the livers of each group of FVB / N mice;

[0027] Figure 2 is the liver weight and liver weight ratio of each group of FVB / N mice; compared with the WT group, # P<0.05, ## P<0.01, ### P < 0.001, #### P<0.0001; compared with the model group, * P<0.05, ** P<0.01, *** P < 0.001, **** P < 0.0001;

[0028] Figure 3 is the glucose tolerance curve of each group of FVB / N mice; compared with the WT group, # P<0.05, ## P<0.01; compared with the model group, *P<0.05, **P <0.01.

[0029] Figure 4 is the insulin tolerance curve of each group of FVB / N mice; compared with the WT group, # P<0.05, ## P<0.01, ### P<0.00; compared with the model group, * P<0.05, ** P<0.01, *** P < 0.001;

[0030] Figure 5 H&E staining of livers from each group of FVB / N mice; magnification 200x;

[0031] Figure 6 Oil red staining of liver tissues of each group of FVB / N mice; magnification 200x;

[0032] Figure 7 The serum total cholesterol (TC), total triglyceride (TG), ALT and AST levels of each group of FVB / N mice were detected; compared with the WT group, # P<0.05, ## P<0.01, #### P<0.0001; compared with the model group, * P<0.05, ** P < 0.01;

[0033] Figure 8 The livers of each group of FVB / N mice were stained with picrosirius red; the magnification was 200x;

[0034] Fig. 9 The expression of TNF-α, a inflammatory factor in the liver, in each group of FVB / N mice is shown in Figure 2. Compared with the WT group, # P<0.05, ## P<0.01; compared with the model group, * P<0.05.

[0035] Fig.10 These are the morphology and color results of the livers of each group of C57BL / 6J mice;

[0036] Fig.11 is the liver weight and liver weight ratio of each group of C57BL / 6J mice; compared with the WT group, # P<0.05, ## P<0.01, ### P < 0.001, #### P<0.0001; compared with the model group,* P<0.05, ** P<0.01, *** P < 0.001, **** P < 0.0001;

[0037] Fig.12 H&E staining of livers from each group of C57BL / 6J mice; magnification 200x;

[0038] Fig.13 Oil red staining of liver tissues in each group of C57BL / 6J mice; the magnification is 200x. DETAILED DESCRIPTION

[0039] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0040] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0041] The invention provides a method for constructing a non-alcoholic fatty liver disease model. The method comprises: using high-pressure tail vein transfection technology to stably over-express AKT gene in mouse liver, and feeding the mice with high-fat feed.

[0042] In a preferred embodiment, the construction method comprises the following steps:

[0043] After adaptive feeding, mice were injected with AKT gene plasmid via tail vein transfection at high pressure;

[0044] The mice injected with AKT gene plasmid were fed with high-fat diet.

[0045] In some embodiments, the mouse is a wild-type FVB / N mouse or a C57BL / 6J mouse. Preferably, the mouse is 6 to 8 weeks old and weighs 18 to 22 g. Mice within this age and weight range have the advantages of a short feeding cycle and a fast fat deposition rate, which can significantly reduce the establishment cycle of the animal model.

[0046] In a preferred embodiment, the FVB / N mice and C57BL / 6J mice are of SPF grade.

[0047] In the construction method described in the present invention, before adaptive feeding, FVB / N mice (or C57BL / 6J mice) are divided into 6 to 10 mice per cage; the feeding density of 6 to 10 mice per cage can ensure that each mouse has enough space for activities and avoid stress reactions in mice caused by overcrowding, which affects the metabolism in the body, and can also enable the mice to adapt to the environment as quickly as possible and shorten the time of adaptive feeding; at the same time, this feeding density can also effectively save feeding space.

[0048] In the method of the present invention, by first performing adaptive feeding on mice, the metabolism in the mice can be stabilized, which helps to quickly accumulate fat during the experiment. In some embodiments, during adaptive feeding, the feed fed is ordinary feed, and drinking water is free.

[0049] The present invention does not limit the specific source or composition of the common feed fed during adaptive feeding, and can be the feed conventionally used for feeding mice in the art. Specifically, the composition of the common feed can include soybean meal, fish meal, vegetable oil, bran, corn, vitamins, minerals, etc.

[0050] In a preferred embodiment, the adaptive breeding environment includes: a temperature of 22-25° C., a humidity of 45-55%, and a 12-hour day and night alternation.

[0051] In a preferred embodiment, the cycle of adaptive feeding is 5 to 9 days, specifically, for example, 5 days, 6 days, 7 days (ie, 1 week), 8 days or 9 days.

[0052] In the present invention, the AKT gene plasmid is used to stably express the AKT gene in mouse liver. The present invention does not limit the specific source, structure or nucleotide sequence of the AKT gene plasmid, and can be a conventional plasmid for expressing the AKT gene in the art. In some embodiments, the AKT gene plasmid comprises an SB plasmid encoding a Sleeping Beauty transposase and an AKT plasmid carrying a target gene transposon.

[0053] In a specific embodiment, the vector of the SB plasmid is a pCMV vector.

[0054] In a specific embodiment, the vector of the AKT plasmid is a pT3-EF1α vector.

[0055] In a preferred embodiment, the AKT gene plasmid comprises an SB plasmid encoding Sleeping Beauty transposase (pCMV-sleeping beauty transposase) and an AKT plasmid carrying a target gene transposon (pT3-EF1α-myr-AKT).

[0056] In the method of the present invention, the AKT gene plasmid is in the form of a solution. In some embodiments, the AKT gene plasmid is prepared according to the following steps: dilute the SB plasmid encoding the Sleeping Beauty transposase and the AKT plasmid carrying the target gene transposon into physiological saline and mix them thoroughly.

[0057] In a preferred embodiment, the mass ratio of the SB plasmid encoding Sleeping Beauty transposase to the AKT plasmid carrying the target gene transposon is 1:10-30, more preferably 1:10-25.

[0058] In some embodiments, the dosage ratio of the SB plasmid encoding Sleeping Beauty transposase to physiological saline is 1 μg: 1-10 mL, preferably 1 μg: 1-5 mL.

[0059] In the method of the present invention, the environment of adaptive feeding and high-fat diet feeding is preferably the same, so that the mice can adapt quickly and improve the overall modeling cycle, and the body state of the mice can always be kept stable. Specifically, the environment of high-fat diet feeding includes: temperature 22-25°C, humidity 45-55%, and 12-hour day and night alternation.

[0060] In a specific embodiment, when the high-fat diet is fed, the FVB / N mice and C57BL / 6J mice are fed a fixed amount of 30 g per cage once a day, and are allowed to drink water freely.

[0061] More preferably, the period of high-fat diet feeding is 3 to 4 weeks.

[0062] In the method described in the present invention, there is no particular limitation on the high-fat feed, which can be a high-fat feed commonly used in the art. In a preferred embodiment, the high-fat feed is high-fat feed D12492. In some embodiments, the high-fat feed D12492 contains the following components in parts by mass: 190-210 parts of casein, 2-4 parts of cystine, 120-130 parts of maltodextrin, 70-75 parts of sucrose, 40-60 parts of cellulose, 240-250 parts of lard, 20-30 parts of soybean oil, 40-60 parts of minerals, and 2-4 parts of vitamins.

[0063] In a preferred embodiment, the components of the high-fat feed D12492 are: 200 parts of casein, 3 parts of cystine, 125 parts of maltodextrin, 72.8 parts of sucrose, 50 parts of cellulose, 245 parts of lard, 25 parts of soybean oil, 50 parts of minerals, and 3 parts of vitamins, and the total weight of the feed formula is 773.8 parts.

[0064] In a specific embodiment, the construction method comprises the following steps:

[0065] (1) Divide mice into cages of 6 to 10 mice;

[0066] (2) Adaptive feeding of mice in each cage;

[0067] (3) Each cage of adaptively reared mice was injected with AKT gene plasmid via tail vein transfection at high pressure and fed a high-fat diet.

[0068] After the feeding cycle (modeling) is over, glucose tolerance tests and insulin tolerance tests are performed on FVB / N mice or C57BL / 6J mice; at the same time, after the feeding cycle is over, the mice are anesthetized, and fasting serum and mouse liver tissue are collected for blood index detection and liver pathology analysis to determine the effect of model construction. By detecting the liver weight and blood lipid changes of the constructed non-alcoholic fatty liver disease mouse model, observing the liver metabolic indicators and liver pathological changes of the mice, evaluating and analyzing the liver lipid metabolism, inflammation, and fibrosis development, the NASH model is identified. The results showed that the model has a high similarity with clinical pathology and a high success rate, and can be used to explore the pathogenesis of NASH and screen therapeutic drugs.

[0069] The method for constructing an animal model of non-alcoholic fatty liver disease described in the present invention has low cost and high efficiency, can quickly form fatty liver disease, and the fatty liver disease phenotype appears 3 to 4 weeks after modeling. It can effectively shorten the establishment period of the animal model of non-alcoholic fatty liver disease formed by a conventional high-fat diet, and greatly save the time cost of medical research on NASH.

[0070] The present invention also provides a non-alcoholic fatty liver disease model, which is constructed by the above method. The non-alcoholic fatty liver disease animal model has the characteristics of liver inflammatory cell infiltration, liver fat deposition, dyslipidemia and insulin resistance, has a high similarity with clinical pathology, and has a significant fatty liver disease phenotype.

[0071] The present invention also provides the use of the above-mentioned non-alcoholic fatty liver disease model in studying the occurrence and development mechanism of non-alcoholic hepatitis and evaluating therapeutic drugs.

[0072] The present invention will be described in detail below by way of examples, but the protection scope of the present invention is not limited thereto. The experimental methods in the following examples, unless otherwise specified, are conventional methods in the art. The experimental materials used in the following examples, unless otherwise specified, are commercially available products.

[0073] In the following examples, the raw materials involved include:

[0074] Ordinary feed and high-fat feed (D12492) were purchased from Xiaoshu Youtai (Beijing) Biotechnology Co., Ltd.; FVB / N mice and C57BL / 6J mice were purchased from Sibeifu Biotechnology Co., Ltd.

[0075] The SB plasmid encoding Sleeping Beauty transposase (pCMV-sleeping beauty transposase) is a plasmid obtained by cloning the SB gene into the pCMV vector, wherein the SB gene information includes: 1863..2881 in the CDS region of GenBank: MT559074.1.

[0076] The AKT plasmid carrying the target gene transposon (pT3-EF1α-myr-AKT) is a plasmid obtained by cloning the myr-AKT gene into the pT3-EF1α vector. The nucleotide sequence of the myr-AKT gene is as follows: the myr sequence (atggggagcagcaagagcaagcccaagtctaga) is added to the 5' end of the CDS region (NM_009652) of AKT1. The NM_009652 sequence can be found at https: / / www.ncbi.nlm.nih.gov / gene / .

[0077] Example 1

[0078] (1) Animal grouping:

[0079] SPF FVB / N mice were selected and randomly divided into WT group, AKT group, HFD group and AKT-HFD group, with 8 mice in each group. The SPF FVB / N mice were 6 to 8 weeks old and weighed 18 to 22 g. The animal breeding conditions were all in accordance with the SFP international standards.

[0080] Among them, the WT group was the wild group, the AKT group was the group injected with AKT gene plasmid by high-pressure tail vein transfection technology, the HFD group was the high-fat feeding group, and the AKT-HFD group was the group injected with AKT gene plasmid by high-pressure tail vein transfection technology and high-fat feeding group.

[0081] (2) After grouping, each group of mice was given adaptive feeding. The adaptive feeding conditions were: temperature 22-25°C, humidity 50%, 12-hour day and night alternation; the feeding cycle was 1 week.

[0082] (3) After one week of adaptive feeding with ordinary diet, the mice in the AKT group and AKT-HFD group were injected with AKT gene plasmid (2 mL / mouse) using high-pressure tail vein transfection technology. The mice in the HFD group and AKT-HFD group were fed a high-fat diet, while the WT group (control group) continued to be fed with ordinary diet.

[0083] The specific method of high-fat feeding is: quantitative feeding once a day, 30g per cage each time. During the high-fat feeding period, mice were free to drink water, and the water source was SPF-grade sterilized water; the high-fat feeding cycle was 3 weeks and 4 weeks.

[0084] Preparation of AKT gene plasmid: Add 1 μg of SB plasmid encoding Sleeping Beauty transposase and 25 μg of AKT plasmid carrying target gene transposon to every 2 mL of 0.9% saline and mix thoroughly.

[0085] After the high-fat feeding period (i.e. modeling) is completed, the following tests are performed:

[0086] 1. Take photos of the livers of mice in each group, and weigh the body weight and liver weight of mice in each group. The test results are as follows: Figure 1 and Figure 2 shown.

[0087] Depend on Figure 1 From the appearance and color of the liver, it can be seen that compared with the WT group, the liver of the AKT group was larger and the surface was light yellow; the liver of the HFD group was light yellow with a small number of white spots; the liver of the AKT-HFD group was significantly larger, yellowish in color, and rough on the surface, with a distinct "graininess".

[0088] pass Figure 2 It can be seen that after feeding for 3 to 4 weeks, the liver weight and liver weight ratio of each group of mice were significantly increased compared with the WT group, among which the liver weight and liver weight ratio of the AKT-HFD group were significantly increased compared with the other three groups.

[0089] 2. Perform the following tests on each group of mice. Fast the mice in each group before the test.

[0090] (1) Glucose tolerance test: After fasting for 16 hours, the rats were given a 20% glucose solution prepared with saline at a concentration of 2 g / kg by gavage. The tail vein blood glucose was tested at 15 min, 30 min, 60 min, 90 min, and 120 min using Contour TS test strips (Bayer HealthCare LLC, Mishawaka, IN). After the experiment, each cage was supplemented with feed. The results are shown in the table below. Figure 3 .

[0091] Depend on Figure 3 It can be seen that the blood glucose level of mice in the WT group rose slowly and with the smallest amplitude, fell rapidly, and had a higher glucose tolerance; the blood glucose level of mice in the AKT group rose slowly and with a smaller amplitude, fell rapidly, and had a high glucose tolerance; the blood glucose level of mice in the HFD group rose rapidly and with a larger amplitude, and fell slowly; the blood glucose level of mice in the AKT-HFD group rose rapidly and with the largest amplitude, fell slowly, and had impaired glucose tolerance.

[0092] (2) Insulin tolerance test: After 6 hours of fasting, insulin solution was injected intraperitoneally, and tail vein blood glucose was measured using a blood glucose meter at 15 minutes, 30 minutes, 45 minutes, 60 minutes, and 90 minutes. After the experiment, feed was added to each cage. The results are shown in the table. Figure 4.

[0093] Depend on Figure 4 It can be seen that the blood sugar of WT group mice dropped rapidly after insulin injection, and the mice had no insulin resistance; the blood sugar of AKT group mice dropped at a similar rate to that of WT group after insulin injection, and the mice had no insulin resistance; the blood sugar of HFD group mice dropped slowly after insulin injection; the mice had mild insulin resistance; the blood sugar of AKT-HFD group mice dropped the slowest, and the mice had insulin resistance.

[0094] (3) Liver tissue pathology detection: Liver tissue fixed in 4% paraformaldehyde solution was prepared into liver tissue sections. The tissue sections were sequentially immersed in xylene, different concentrations of ethanol and distilled water for 5 minutes. Stained with hematoxylin solution for 2 minutes, then differentiated with 1% hydrochloric acid alcohol solution for 2 seconds, and then counterstained with eosin solution for 2 minutes and washed with running water. The tissue sections were sequentially immersed in different concentrations of ethanol for dehydration for 5 minutes, and immersed in xylene solution for 5 minutes. Evaporate in a fume hood, seal the sections with neutral gum, and take photos under a microscope for analysis. The staining results are as follows. Figure 5 shown.

[0095] Depend on Figure 5 The HE staining results showed that at 3 weeks, the liver tissue structure of the WT group was compact and clear without lesions; the liver tissue of the AKT group had a small amount of fat vacuoles and balloon-like degeneration, and a small amount of inflammatory cell infiltration was visible; the liver tissue of the HFD group had no obvious lesions; the liver tissue of the AKT-HFD group had a large number of fat vacuoles and balloon-like lesions and obvious inflammatory cell infiltration. At 4 weeks, a large number of fat vacuoles and balloon-like degeneration appeared in the AKT group, and the inflammatory cell infiltration increased significantly compared with 3 weeks. The AKT-HFD group was still characterized by a large number of fat vacuoles and balloon-like lesions in the liver tissue and obvious inflammatory cell infiltration.

[0096] (4) Prepare frozen sections of liver tissue, place at room temperature for 1 hour, fully recover to room temperature, dry, place in fixative for 15 minutes, and wash with running water. Use Oil Red O staining solution to stain in the dark for 10 minutes, and wash away excess staining solution. Counterstain the cell nucleus with hematoxylin staining solution for 30 seconds, differentiate with 1% hydrochloric acid alcohol for 2 seconds, and wash with pure water. Use neutral gum to seal the sections, and use a microscope to take pictures and analyze the results. Figure 6 shown.

[0097] Depend on Figure 6 The results of Oil Red O staining showed that at 3 weeks, the liver structure of the WT group was clear and there was no lipid droplet deposition, while the liver tissue of the AKT group had local lipid droplet deposition; the liver structure of the HFD group was clear, with only a small amount of lipid droplet deposition, and the liver fatty lesions of the AKT-HFD group, with a large amount of lipid droplet deposition, and the cell nucleus was squeezed to the edge. At 4 weeks, the local lipid droplet deposition in the liver tissue of the AKT group increased significantly compared with that at 3 weeks.

[0098] (5) After four weeks of high-fat feeding, the mice in each group were subjected to serum testing. The method was as follows: after fasting, the mice were anesthetized with isoflurane and blood was collected from the submandibular venous plexus. The whole blood was allowed to stand at room temperature for 30 minutes and centrifuged at 3000 rpm for 10 minutes to obtain the upper serum. The kit was used to detect TC, TG, ALT and AST indicators. The results are shown in Figure 7 .

[0099] Depend on Figure 7 It can be seen that after 4 weeks of feeding, the serum TC, TG, ALT, and AST levels of mice in the AKT-HFD group increased most significantly, indicating abnormal blood lipid levels and liver function damage.

[0100] (6) After four weeks of high-fat feeding, the mice in each group were stained with picrosirius red. The method was as follows: paraffin sections were dewaxed to water: the sections were placed in xylene I for 20 minutes, xylene II for 20 minutes, anhydrous ethanol I for 10 minutes, anhydrous ethanol II for 10 minutes, 95% alcohol for 5 minutes, 90% alcohol for 5 minutes, 80% alcohol for 5 minutes, 70% alcohol for 5 minutes, and distilled water for washing. Then, the sections were stained in saturated picrosirius red staining solution for 8 minutes. The sections were then rinsed in anhydrous alcohol for several minutes and observed under a microscope until satisfactory. The sections were placed in clean xylene for 5 minutes to make them transparent and sealed with neutral gum. Microscope examination and image acquisition and analysis were performed. The results are shown in the following table. Figure 8 shown.

[0101] Depend on Figure 8 It can be seen that after 4 weeks of feeding, obvious fibrotic lesions appeared in the AKT-HFD group, and the collagen fibers increased significantly, which were concentrated around the portal area and around the degenerated hepatocytes, indicating the occurrence of liver fibrosis.

[0102] (7) After four weeks of high-fat feeding, the mice in each group were subjected to qRT-PCR to detect liver inflammatory factors. The method was as follows: liver mRNA was extracted, reverse transcribed into cDNA, TNF-α primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the primers were used for amplification to detect the expression of TNF-α in the liver of each group of mice. The results are as follows Fig. 9 shown.

[0103] Depend on Fig. 9 It can be seen that after 4 weeks of feeding, TNF-α was significantly upregulated in the AKT-HFD group, indicating that inflammation was more obvious in this group.

[0104] Example 2

[0105] The method of Example 1 was followed, except that FVB / N mice were replaced with C57BL / 6J mice.

[0106] After the high-fat feeding period (i.e. modeling) is completed, the following tests are performed:

[0107] 1. Take photos of the livers of mice in each group, and weigh the body weight and liver weight of mice in each group. The test results are as follows: Figure 10-11 shown.

[0108] Depend on Fig.10 From the appearance and color of the liver, we can see that at 3 weeks, compared with the WT group, the liver of the AKT group was larger and yellow-white in surface; the liver of the HFD group was light yellow in surface; the liver of the AKT-HFD group was significantly larger, white in color, and rough in surface, with obvious "graininess". At 4 weeks, the livers of the AKT group, HFD group, and AKT-HFD group were all larger than those at 3 weeks.

[0109] pass Fig.11 It can be seen that after 3 and 4 weeks of feeding, the liver weight and liver weight ratio of mice in the AKT group and AKT-HFD group were significantly increased compared with those in the WT group.

[0110] 2. Perform the following tests on each group of mice.

[0111] (1) The livers of mice in each group were subjected to the above-mentioned H&E staining. The staining results are as follows: Fig.12 shown.

[0112] Depend on Fig.12 The HE staining results showed that at 3 weeks, the liver tissue structure of the WT group was compact and clear without lesions; the liver tissue of the AKT group had a small amount of fat vacuoles and balloon-like degeneration, and a small amount of inflammatory cell infiltration was visible; the liver tissue of the HFD group had a small amount of fat vacuoles; the liver tissue of the AKT-HFD group had a large amount of fat vacuoles and balloon-like lesions and obvious inflammatory cell infiltration. At 4 weeks, a large amount of fat vacuoles and balloon-like degeneration appeared in the AKT group, and the inflammatory cell infiltration increased significantly compared with 3 weeks. The liver tissue of the HFD group still had only a small amount of fat vacuoles, and the AKT-HFD group was still characterized by a large amount of fat vacuoles and balloon-like lesions in the liver tissue and obvious inflammatory cell infiltration.

[0113] (2) The livers of mice in each group were stained with the above-mentioned oil red staining. The staining results were as follows: Fig.13 shown.

[0114] Depend on Fig.13 The results of Oil Red O staining showed that at 3 weeks, the liver structure of the WT group was clear and there was no lipid droplet deposition, while the liver tissue of the AKT group had local lipid droplet deposition; the liver structure of the HFD group was clear and there was a small amount of lipid droplet deposition, and the liver fatty lesions of the AKT-HFD group were large, with the cell nucleus squeezed to the edge. At 4 weeks, the local lipid droplet deposition in the liver tissue of the AKT group, HFD group, and AKT-HFD group increased significantly compared with that at 3 weeks.

[0115] The results showed that after C57BL / 6J mice were modeled using the same method as in Example 1, C57BL / 6J mice showed the same symptoms as FVB / N mice, and the AKT-HFD group showed obvious liver inflammatory cell infiltration and liver fat deposition.

[0116] In summary, the construction method provided by the present invention uses high-pressure tail vein transfection technology to inject AKT gene plasmids into FVB / N mice or C57BL / 6J mice that are fed a high-fat diet, and successfully establishes an animal model of non-alcoholic fatty liver disease with characteristics such as liver inflammatory cell infiltration, liver fat deposition, insulin resistance, and dyslipidemia, while significantly shortening the modeling time. This non-alcoholic fatty liver disease animal model provides a good and efficient animal model for studying the pathogenesis of NAFLD, especially aspects related to abnormal glucose and lipid metabolism.

[0117] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. A method for constructing a non-alcoholic fatty liver disease model, characterized in that: The construction method comprises: using high-pressure tail vein transfection technology to stably overexpress the AKT gene in the liver of mice, and feeding the mice with a high-fat diet.

2. The construction method according to claim 1, characterized in that: The construction method specifically includes the following steps: After adaptive feeding, mice were injected with AKT gene plasmid via tail vein transfection at high pressure; The mice injected with AKT gene plasmid were fed with high-fat diet.

3. The method according to claim 1 or 2, characterized in that: The mice are wild-type FVB / N mice or C57BL / 6J mice.

4. The construction method according to claim 2, characterized in that: The feeding period of the adaptive feeding is 5 to 9 days; Preferably, the adaptive breeding environment includes: a temperature of 22-25° C. and a humidity of 45-55%.

5. The construction method according to claim 2, characterized in that: The AKT gene plasmid comprises a SB plasmid encoding Sleeping Beauty transposase and an AKT plasmid carrying a target gene transposon; Preferably, the vector of the SB plasmid is a pCMV vector; Preferably, the vector of the AKT plasmid is a pT3-EF1α vector.

6. The construction method according to claim 2 or 5, characterized in that: The AKT gene plasmid is prepared according to the following steps: the SB plasmid encoding Sleeping Beauty transposase and the AKT plasmid carrying the target gene transposon are mixed with physiological saline.

7. The construction method according to claim 5 or 6, characterized in that: The mass ratio of the SB plasmid encoding the Sleeping Beauty transposase to the AKT plasmid carrying the target gene transposon is 1:10-30.

8. The construction method according to claim 1 or 2, characterized in that: The high-fat feed feeding environment includes: temperature 22-25°C, humidity 45-55%; Preferably, the conditions for raising the high-fat feed include: a feeding cycle of once a day and a feeding cycle of 3 to 4 weeks; Preferably, the high-fat feed is high-fat feed D12492.

9. A non-alcoholic fatty liver disease model, characterized in that: It is constructed by the construction method described in any one of claims 1 to 8.

10. Use of the non-alcoholic fatty liver disease model according to claim 9 in studying the occurrence and development mechanism of non-alcoholic hepatitis and evaluating the effects of therapeutic drugs.

Images