SNP (Single Nucleotide Polymorphism) molecular marker related to pig feed conversion rate as well as screening method and application thereof

Abstract

The invention discloses a pig feed conversion rate related SNP molecular marker as well as a screening method and application thereof, and belongs to the technical field of molecular biology. The SNP molecular marker related to the pig feed conversion rate is located at the 235291491th site of a chromosome 1 in an international pig reference genome 11.1 version, and is obtained by screening through the following steps: (1) constructing a pig feed conversion rate phenotype; (2) collecting a pig tissue sample and extracting DNA; (3) sequencing and performing quality control on the SNP molecular marker; and (4) carrying out whole genome selection signal detection based on a population differentiation index method, and screening out the SNP molecular marker. The invention aims to screen out the SNP molecular marker related to the feed conversion rate character, and provides a new thought for cost reduction and efficiency improvement of actual production work.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and specifically relates to a pig feed conversion rate-related SNP molecular marker and a screening method and application. Background Art

[0002] Feed conversion efficiency (FCR) is a key indicator to measure the efficiency of pigs in saving food. FCR refers to the ratio of individual daily feed intake to individual daily weight gain. FCR is easy to calculate and has a good correlation with body weight traits, so it is widely used to evaluate the feed efficiency of pigs. Animal husbandry is developing rapidly, and the proportion of feed costs in total production costs is gradually increasing, accounting for about 50% to 85% of the total cost. The key to reducing feed costs is to improve feed efficiency. Improving feed efficiency not only reduces feed consumption, but also reduces breeding costs and energy use, and also reduces manure production and total potential greenhouse gas emissions.

[0003] In recent years, with the rapid development of high-throughput genotyping and molecular technology, people have become more and more interested in the molecular processes and genetic mechanisms that affect the FCR of pigs. Selection signals refer to changes in structural characteristics left on the animal genome during natural selection or artificial selection. Capturing the existing selection signals and potential selected sites in the whole genome of animal populations through selection signal detection helps to reveal the potential selection and genetic mechanisms of important economic traits of livestock and poultry. Therefore, this study conducted genome-wide selection signal detection on Large White pigs, screened molecular markers related to the feed conversion rate of Large White pigs, and provided a reference for reducing costs and increasing efficiency in actual production. Summary of the invention

[0004] In view of the above-mentioned prior art, the present invention provides a pig feed conversion rate-related SNP molecular marker and a screening method and application, aiming to screen out SNP molecular markers related to feed conversion rate traits, and provide a new idea for reducing costs and increasing efficiency in actual production work.

[0005] In order to achieve the above-mentioned purpose, the technical solution adopted by the present invention is: to provide a SNP molecular marker related to pig feed conversion rate, which is located at position 235291491 of chromosome 1 in the international pig reference genome version 11.1, and the SNP molecular marker has a C / T polymorphism.

[0006] Based on the above technical solution, the present invention can also be improved as follows.

[0007] Furthermore, the SNP molecular marker is located at position 200 in the nucleotide sequence shown in SEQ ID No.1.

[0008] Furthermore, the method for screening SNP molecular markers related to pig feed conversion rate comprises the following steps:

[0009] (1) Construct a feed conversion efficiency phenotype for pigs, where feed conversion efficiency is the ratio of average daily feed intake to average daily weight gain;

[0010] (2) Collect pig tissue samples and extract DNA;

[0011] (3) Use gene chips for sequencing and quality control of SNP molecular markers;

[0012] (4) Based on the population differentiation index method, whole-genome selection signal detection was performed to screen out SNP molecular markers.

[0013] Furthermore, step (3) was quality controlled using PLINK software. The quality control criteria were to exclude the following sites: sites on abnormal chromosomes, SNP molecular markers with a site detection rate < 0.1, individuals with an individual detection rate < 0.1, sites with a minimum allele frequency < 0.05, and sites with a Hardy-Weinberg equilibrium < 1 × 10 -6 The location of .

[0014] Furthermore, the specific method of step (4) is as follows: sorting according to the feed conversion rate, dividing the top 30 and the bottom 30 into two groups, using the fst method of PLINK software to perform genome-wide selection signal detection on the two groups, and screening F ST SNP molecular markers with scores > 0.15.

[0015] The beneficial effect of the above-mentioned further technical scheme adopted by the present invention is that the screening method for SNP molecular markers related to pig feed conversion rate traits provided by the present invention can detect the genotype of the pig by using gene chip technology in vitro, and perform marker-assisted selection on the feed conversion rate trait of the pig, which has the advantages of being simple, fast, highly sensitive and good in specificity.

[0016] Furthermore, the application of SNP molecular markers related to pig feed conversion rate in screening pig breeds with excellent pig feed conversion rate.

[0017] Furthermore, the screening method is to detect the base type at position 235291491 of chromosome 1 in the international pig reference genome version 11.1, and select pig strains with a genotype of CC or CT at this site.

[0018] Furthermore, pig strains with a genotype of CC at position 235291491 of chromosome 1 in the international pig reference genome version 11.1 were selected.

[0019] Further, the screening method comprises the following steps:

[0020] (1) Taking pig tissue samples and extracting genomic DNA;

[0021] (2) performing PCR amplification on the genomic DNA, using the amplification primers as the nucleotide sequences shown in SEQ ID NO.2 and SEQ ID NO.3;

[0022] (3) Sequencing the PCR amplification product obtained in step (2) to determine the base type of the SNP molecular marker.

[0023] The beneficial effects of the present invention are as follows: the feed conversion rate trait-related SNP molecular marker screening method provided by the present invention, the molecular marker at position 235291491 of chromosome 1 in the 11.1 version of the international pig reference genome, can be used in the association analysis of the feed conversion rate of large white pigs. The use of the significant SNP molecular markers identified by the method for marker-assisted selection can quickly screen out genotypes with low feed conversion rates; the application of large white pigs with CC or CT genotypes with lower feed conversion rates in production can not only reduce feed costs, but also reduce the pollution of nitrogen emissions to the environment, and will not affect the production performance and product quality of the animals, which can greatly accelerate the genetic improvement of the feed conversion rate trait of large white pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Flow chart of the screening steps for SNP molecular markers related to pig feed conversion rate;

[0025] Figure 2 The PCA graph and phylogenetic tree graph of the experimental population, where a is the PCA graph and b is the phylogenetic tree graph;

[0026] Figure 3 Manhattan plot of signal analysis results for selected experimental groups;

[0027] Figure 4 To use F ST PCA diagram and phylogenetic tree diagram of the experimental population drawn for significant sites with >0.15, where a is the PCA diagram and b is the phylogenetic tree diagram;

[0028] Figure 5 This is a feed conversion rate analysis chart of different genotypes at position 235291491 on chromosome 1 in the International Pig Reference Genome version 11.1. DETAILED DESCRIPTION

[0029] The specific implementation modes of the present invention are described in detail below with reference to the embodiments.

[0030] The flow chart of the screening steps for SNP molecular markers related to pig feed conversion rate is as follows Figure 1 shown.

[0031] Example 1: Construction of a pig feed conversion efficiency phenotype

[0032] A number of large white pigs with an average initial weight of 20.28 kg and an average initial age of 74.76 days were selected and fed with the fattening feed 555 of Weinan Da Bei Nong Agricultural and Animal Husbandry Technology Co., Ltd. until about 168.06 days of age. The pigs ate freely. The average daily feed intake and average daily weight gain of the large white pigs during the entire feeding process, as well as the final age and final weight of the large white pigs, were recorded. The ratio of the average daily feed intake and average daily weight gain of the experimental individuals was used as the feed conversion rate, and the phenotype was constructed by quality control of the traits using the mean value ± 3 standard deviations. Finally, a total of 113 large white pig phenotypes were constructed.

[0033] Feed conversion ratio was calculated using the following formula:

[0034]

[0035] Example 2: Sample collection and DNA extraction

[0036] The ear tissues of experimental large white pigs were collected and DNA was extracted as sequencing samples, and genotyping was performed using the "SMIC-1" 50K SNP breeding chip of Beijing Compson Agricultural Technology Co., Ltd.

[0037] The operation of genotyping with the "SMIC-1" 50K SNP breeding chip is as follows: quantitative analysis of the gDNA of the samples used is performed using agarose gel electrophoresis and Nanodrop ND-2000; whole genome amplification is performed on all samples (incubated at 37°C for 24 hours); the gDNA is fragmented, precipitated and resuspended in hybridization buffer; the resuspended DNA fragments are added to the chip and hybridized (incubated at 48°C for 24 hours); after hybridization, the non-specifically bound DNA is washed away, and the remaining specifically bound sites are subjected to single-base extension; scanning is performed using the Illumina iScan Reader; and finally, the genotype data is read using the GenomeStudio software.

[0038] Example 3: Gene chip version conversion and SNP molecular marker quality control

[0039] The "SMIC-1" 50K SNP breeding chip tested by Compson Agricultural Technology Co., Ltd. uses the International Pig Reference Genome version 10.2. The version of the gene chip was converted according to the International Pig Reference Genome version 11.1. PLINK v1.90 software was used to perform quality control on the 11.1 version of the gene chip. The quality control standard was to exclude the following sites: sites on non-chromosomes, SNP molecular markers with a site detection rate of <0.1, individuals with an individual detection rate of <0.1, sites with a minimum allele frequency of <0.05, and Hardy-Weinberg equilibrium <1×10 -6 After quality control, 36,127 SNP molecular markers of the remaining 113 individuals were used for subsequent analysis.

[0040] Example 4: Principal component analysis of the experimental population

[0041] The SNP molecular markers with linkage disequilibrium <0.5 between adjacent loci screened by PLINK v1.90 software (--indep-pairwise 50 5 0.5) were used for principal component analysis. Then, the first 10 principal components were calculated using GCTA v1.94 software, and the principal component results were visualized using R v4.4.1 software. The results are shown in Figure 2. Figure 2 As shown in a.

[0042] Example 5: Experimental population evolution tree construction

[0043] PLINK v1.90 software was used to calculate the IBS (identity-by-descent) distance between individuals. MEGA v11.0.13 software was then used to convert the genetic distance file format and construct the evolutionary tree using the neighbor-joining method. Finally, the Rv4.4.1 software ggtree package was used to visualize the graph. The results are shown in the figure. Figure 2 As shown in b.

[0044] Example 6: Genome-wide selection signal detection

[0045] According to the phenotypic values ​​of the 113 models, the experimental population was divided into a T population and an L population. The phenotypic values ​​were sorted in ascending order, and the top 30 individuals were selected to form the T population, and the bottom 30 individuals were selected to form the L population. The fst method of PLINK v1.90 software was used to detect the selection signal of the two subpopulations (--fst). The ggplot package of R v4.4.1 software was used to plot the F ST The Manhattan diagram of the analysis results shows that Figure 3 shown.

[0046] Example 7: Screening for SNP molecular markers with significant selection signals

[0047] When the SNP marker F ST When the score is >0.15, it is considered that there is a large genetic differentiation between the SNP molecular markers among the populations. Therefore, the present invention will F ST SNP molecular markers with a score > 0.15 were selected as significant SNP molecular markers. A total of 78 significant SNP molecular markers were screened in the present invention, distributed on chromosomes 1, 3, 5, 6, 8, 11, 14 and 17, of which 62 significant SNP molecular markers were distributed on chromosome 1, including Figure 3 F ST The SNP molecular marker with the highest score is 235291491.

[0048] Example 8: Using significant SNP molecular markers to draw PCA diagrams and phylogenetic tree diagrams;

[0049] The methods of Examples 4 and 5 were used to perform PCA analysis and phylogenetic tree construction on the signal-significant SNP molecular markers screened out in Example 7. The results are as follows: Figure 4 a. Figure 4 As shown in b. Figure 2 Compared with 2a and 2b, the use of significant SNP molecular markers for PCA analysis and evolutionary tree construction can distinguish the T group from the L group, indicating that there is a large genetic differentiation between the two groups using the significant SNP molecular markers identified by the present invention.

[0050] Example 9: F ST Analysis of phenotypic values ​​corresponding to different genotypes of the SNP molecular marker with the highest score

[0051] right Figure 3 The SNP molecular marker at position 235291491 of chromosome 1 shown in the figure was analyzed to count the frequencies of different genotypes at this site. The results are as follows Figure 5 As shown in the figure, the SNP molecular marker has C / T polymorphism, there are 9 individuals with CC genotype, 18 individuals with CT genotype, and 33 individuals with TT genotype. The T test was used to calculate whether there was a difference between the phenotypic values ​​of different genotype values ​​at this site. The T test results showed that when the genotype was CC, the feed conversion rate was the lowest, and when the genotype was TT, the feed conversion rate was the highest, and the difference between the two was extremely significant.

[0052] The nucleotide sequences upstream and downstream of the SNP molecular marker at position 235291491 on chromosome 1 in the International Pig Reference Genome 11.1 are as follows:

[0053] 5'-TGGGAGCTAGAGATAAGCAGAAATTTTTTACACTTTACCCCCTTACA CACACACACACACAAAAAAACATGAAAAAAGGGAGGGAAAGGGAAAATTGATAAACTGGATTTCATCAAAATTTAAAACTTCTGCTTTGCAAAAGCTCATGTAAAGATGCTGGAAAGGCAAGCTACAGACTGGGAAAGAAATTATGCAAATTACATATCCAGTGAAGAATTAATATCT AGAATATATAAGGAACCCTCAAAATTTATCAGGGAAAATTTTTTAAAATGAGAAAATGGGCAAAAGATAAGTAGAGACAGTTCACTGACAAGGCTATAGAAATGGTAAATAAGCTCATGAAAAGATATTCATTATTAGCCATGAAGGAGATGCAAATTAAAAATACGATGAAA-3'(SEQ ID No.1);

[0054] The SNP molecular marker is located at the 200th position in the nucleotide sequence shown in SEQ ID No.1.

[0055] Example 10: A method for screening the genotype of chromosome 1 at position 235291491 in the international pig reference genome version 11.1, comprising the following steps:

[0056] (1) Obtain pig ear tissue and extract genomic DNA;

[0057] (2) PCR amplification of genomic DNA, the amplification primers are:

[0058] Forward primer: 5'-AAGGGAGGGAAAGGGAAA-3' (SEQ ID NO. 2);

[0059] Reverse primer: 5'-TATAGCCTTGTCAGTGAACT-3' (SEQ ID NO.3);

[0060] The amplification system is shown in Table 1:

[0061] Table 1 PCR amplification system

[0062]

[0063]

[0064] The amplification conditions are shown in Table 2:

[0065] Table 2 PCR amplification conditions

[0066]

[0067] (3) Sequencing the PCR amplification product obtained in step (2) to determine the base type of the SNP molecular marker.

[0068] The length of the obtained PCR amplification product was 248 bp. Based on the sequencing results, pig strains with a genotype of CC or CT at position 235291491 of chromosome 1 in the International Pig Reference Genome Version 11.1 were selected.

[0069] Although the specific implementation of the present invention is described in detail in conjunction with the embodiments, it should not be understood as limiting the scope of protection of this patent. Within the scope described in the claims, various modifications and variations that can be made by those skilled in the art without creative work still fall within the scope of protection of this patent.

Claims

1. A SNP molecular marker related to pig feed conversion rate, characterized in that: The SNP molecular marker related to pig feed conversion rate is located at position 235291491 on chromosome 1 in the international pig reference genome version 11.

1. This SNP molecular marker has a C / T polymorphism.

2. The pig feed conversion efficiency-related SNP molecular marker according to claim 1, characterized in that: The SNP molecular marker is located at the 200th position in the nucleotide sequence shown in SEQ ID No.

1.

3. The method for screening SNP molecular markers related to pig feed conversion efficiency according to claim 1 or 2, characterized in that: The following steps are involved: (1) constructing a feed conversion rate phenotype for pigs, wherein the feed conversion rate is the ratio of average daily feed intake to average daily weight gain; (2) Collect pig tissue samples and extract DNA; (3) Use gene chips for sequencing and quality control of SNP molecular markers; (4) Based on the population differentiation index method, whole-genome selection signal detection was performed to screen out SNP molecular markers.

4. The method for screening SNP molecular markers related to pig feed conversion efficiency according to claim 3, characterized in that: The step (3) was quality controlled using PLINK software. The quality control criteria were to exclude the following sites: sites on abnormal chromosomes, SNP molecular markers with a site detection rate of <0.1, individuals with an individual detection rate of <0.1, sites with a minimum allele frequency of <0.05, and sites with a Hardy-Weinberg equilibrium of <1×10 -6 The location.

5. The method for screening SNP molecular markers related to pig feed conversion efficiency according to claim 3, characterized in that: The specific method of step (4) is: sorting according to the feed conversion rate, dividing the top 30 and the bottom 30 into two groups, using the fst method of PLINK software to perform genome-wide selection signal detection on the two groups, and screening F ST SNP molecular markers with scores > 0.

15.

6. Use of the pig feed conversion rate-related SNP molecular marker according to claim 1 or 2 in screening pig strains with excellent pig feed conversion rate.

7. The use according to claim 6, characterized in that: The screening method is to detect the base type at position 235291491 of chromosome 1 in the international pig reference genome version 11.1, and select pig breeds with a genotype of CC or CT at this site.

8. The use according to claim 7, characterized in that: The pig strains with the CC genotype at position 235291491 of chromosome 1 in the international pig reference genome version 11.1 were selected.

9. The use according to claim 8, characterized in that: The screening method includes the following steps: (1) Taking pig tissue samples and extracting genomic DNA; (2) performing PCR amplification on the genomic DNA, using the amplification primers as the nucleotide sequences shown in SEQ ID NO.2 and SEQ ID NO.3; (3) Sequencing the PCR amplification product obtained in step (2) to determine the base type of the SNP molecular marker.

Images