Nucleic acid aptamer combined with GPRIN1 protein as well as application and screening method of nucleic acid aptamer

Abstract

The invention discloses a nucleic acid aptamer combined with GPRI N1 protein, application and a screening method of the nucleic acid aptamer, the nucleic acid aptamer which is small in molecular weight, stable in chemical property, easy to store and mark, capable of being combined with the GPRI N1 protein with high affinity is obtained through screening by improving screening conditions, and the nucleic acid aptamer has very good specificity. The nucleic acid aptamer can be used in the aspects of detection, diagnosis, imaging, treatment and the like, and has a wide application prospect.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a nucleic acid aptamer binding to a GPRIN1 protein, and an application and a screening method thereof. Background Art

[0002] GRIN1 (Glutamate Ionotropic Receptor NMDA Type Subunit 1) is a novel protein with no substantial homology to known protein domains. It is primarily expressed in the brain and specifically binds to activated G(z)alpha, G(o)alpha, and G(i)alpha through its carboxyl-terminal region. The carboxyl terminus of protein KIAA0514 (GRIN2) is homologous to GRIN1 and also binds to activated G(o)alpha. Both GRIN1 and G(o)alpha are membrane-bound proteins that are enriched in neurite growth cones. Co-expression of GRIN1 or GRIN2 with activated G(o)alpha leads to the formation of an elaborate network of processes in Neuro2a cells, suggesting that these pathways may function downstream of G(o)alpha to control neurite outgrowth.

[0003] Diseases associated with GRIN1 include neurodevelopmental disorders with or without hyperactive movements and seizures, autosomal dominant and neurodevelopmental disorders with or without hyperactive movements and seizures, and autosomal recessive inheritance. Its related pathways include unblocking NMDA receptors, glutamate binding and activation, and MAPK family signaling cascades.

[0004] Aptamers are DNA or RNA molecules separated by systematic evolution of ligands by exponential enrichment (SELEX). They can bind with high affinity and specificity to other targets such as proteins, metal ions, small molecules, peptides, and even whole cells. Therefore, they have broad prospects in biochemical analysis, environmental monitoring, basic medicine, and new drug synthesis. Compared with antibodies, aptamers have small molecular weight, better stability, easy modification, no immunogenicity, short production cycle, and can be synthesized artificially, eliminating a series of processes such as animal immunization, feeding, protein extraction, and purification. Therefore, if we can find aptamers with higher affinity and high specificity for GPRI N1 protein, it will help to achieve high sensitivity and high specificity detection of GPRI N1 protein, and help to develop drugs targeting GPRI N1 protein.

[0005] Therefore, there is an urgent need to find a nucleic acid aptamer that has high binding affinity and good specificity for the GPRI N1 protein, maintains high binding affinity after precise truncation, is easy to modify and synthesize, has good stability, and is easy to use. Summary of the invention

[0006] In order to overcome at least one of the defects of the prior art, the present invention provides a nucleic acid aptamer binding to GPRI N1 protein, its application and screening method.

[0007] The technical solution adopted by the present invention to solve the problem is:

[0008] A nucleic acid aptamer binding to GPRI N1 protein, the nucleic acid aptamer having a nucleotide sequence as shown in SEQ ID NO.1; or a nucleotide sequence having at least 30% homology with SEQ ID NO.1 and binding to GPRI N1 protein; or an RNA sequence transcribed from the nucleotide sequence as shown in SEQ ID NO.1.

[0009] Based on the SELEX technology, the inventors designed and synthesized a random single-stranded DNA library and corresponding primers to screen for nucleic acid aptamers that have small molecular weight, stable chemical properties, easy storage and labeling and can bind to the GPRI N1 protein with high affinity. Thus, a nucleic acid aptamer that binds to the GPRI N1 protein with high affinity was screened, which is GRI N1-19 (SEQ ID NO.1). The nucleic acid aptamer has high affinity and high specificity with the GPRI N1 protein.

[0010] It can be understood that the nucleotide sequence having at least 30%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% homology with the nucleic acid aptamer provided by the present invention and binding to the GPRI N1 protein, for example, the nucleotide sequence shown in any of the above nucleic acid aptamers can be partially deleted or partially added, and still has high affinity with the GPRI N1 protein and is still within the scope of protection of the present invention.

[0011] In some embodiments, as an improvement to the above technical solution, a certain position on the nucleotide sequence of the above-mentioned nucleic acid aptamer can be modified, for example, phosphorylation, methylation, amination, sulfhydrylation, replacement of oxygen with sulfur, replacement of oxygen with selenium or isotopization, etc., provided that the nucleic acid aptamer sequence obtained after such modification has desirable properties, for example, it can have an affinity for binding to GPRIN1 protein that is equal to or higher than that of the parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.

[0012] Therefore, in some embodiments, the nucleotide sequence of the nucleic acid aptamer is modified and the modified nucleic acid aptamer specifically binds to the GPRIN1 protein, and the modification is selected from at least one of phosphorylation, methylation, amination, thiolation, replacement of oxygen with sulfur, replacement of oxygen with selenium and isotopization, which is still within the scope of protection of the present invention.

[0013] Furthermore, the nucleic acid aptamer has a sequence that is at least 30% homologous to any one of SEQ ID NO. 1 and is obtained by modifying the nucleotide sequence that binds to the GPRIN1 protein.

[0014] Furthermore, the transformation includes at least one of the following transformation methods:

[0015] (1) Connecting a fluorescent marker to the aptamer;

[0016] (2) Connecting radioactive substances to the aptamer;

[0017] (3) Connecting therapeutic substances to the aptamer;

[0018] (4) connecting biotin to the aptamer;

[0019] (5) connecting digoxigenin to the aptamer;

[0020] (6) connecting a nanoluminescent material to the nucleic acid aptamer;

[0021] (7) Connecting a small peptide to the aptamer;

[0022] (8) Connecting siRNA to the nucleic acid aptamer.

[0023] The conjugate of the nucleic acid aptamer described in the present invention refers to connecting other groups to the nucleic acid aptamer, such as fluorescent markers with marking functions, such as FAM, radioactive substances, therapeutic substances, biotin, digoxin, nanoluminescent materials, small peptides, siRNA or enzyme labels, so that the nucleic acid aptamer sequence obtained after modification has desirable properties, for example, it can have an affinity for binding to GPRIN1 protein that is equal to or higher than that of the parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.

[0024] In other words, the above aptamers, whether partially substituted or modified, have substantially the same or similar molecular structures, physicochemical properties and functions as the original aptamers, and can be used to bind to the GPRIN1 protein.

[0025] The present invention also provides a derivative of a nucleic acid aptamer, which uses the above-mentioned nucleic acid aptamer binding to GPRIN1 protein. The derivative of the nucleic acid aptamer includes a phosphorothioate skeleton or peptide nucleic acid binding to GPRIN1 protein modified from the nucleotide sequence skeleton of the nucleic acid aptamer or the conjugate of the nucleic acid aptamer.

[0026] The term "phosphorothioate backbone" as used in the present invention has the meaning generally understood by those of ordinary skill in the art, and refers to that the non-bridging oxygen atoms of the phosphodiester backbone of RNA and DNA aptamers can be replaced by one or two sulfur atoms, resulting in a phosphorothioate backbone with phosphorothioate or phosphorodithioate bonds, respectively. Such phosphorothioate backbones are known to have increased binding affinity to their targets, as well as enhanced resistance to nuclease degradation.

[0027] The term "peptide nucleic acid" used in the present invention has the meaning generally understood by those of ordinary skill in the art, and refers to an artificially synthesized DNA molecule analog, first reported by Nielsen et al. in 1991. Oligonucleotide mimics linked by peptide bonds were synthesized using N-2-(aminoethyl)-glycine units instead of sugar-phosphate backbones as repeating structural units, and are called peptide nucleic acids. Since peptide nucleic acids (PNA) do not have phosphate groups like those on DNA or RNA, there is a lack of electrical repulsion between PNA and DNA, making the binding strength between the two greater than the binding strength between DNA.

[0028] The present invention also provides a use of a nucleic acid aptamer and a nucleic acid aptamer derivative, comprising at least one of the following:

[0029] (1) Quantitative or qualitative detection of GPRIN1 protein;

[0030] (2) Purification of GPRIN1 protein;

[0031] (3) Imaging of GPRIN1 protein;

[0032] (4) preparing drugs targeting GPRIN1 protein;

[0033] (5) preparing reagents or drugs for diagnosing and treating abnormal GPRIN1 expression;

[0034] The present invention also provides a method for screening a nucleic acid aptamer that binds to a GPRIN1 protein, comprising the following steps:

[0035] S1, synthesize random single-stranded DNA library and primers;

[0036] S2. Magnetic bead screening: Perform at least 7 rounds of counter-screening and screening, and add serum starting from the 4th round.

[0037] Furthermore, in step S2, serum is added after the 4th round, and the specific process is: 5% serum is added in the 4th round, and 20% serum is added in the 5th round; the serum is normal human serum.

[0038] The conventional conditions for nucleic acid aptamer screening are carried out in ionic buffer, while a certain concentration of serum is gradually added under the screening conditions. On the one hand, because the serum contains abundant proteins, it can compete with the proteins on the surface of the magnetic beads to bind to the library, thereby removing those sequences that have weak binding ability to the target GPRI N1 protein or are only adsorbed. On the other hand, the aptamer binds to the target in the serum environment, which can better meet the actual detection environment of the application based on the development of nucleic acid aptamers in the later stage.

[0039] Studies have shown that using higher concentrations of serum in the final rounds of screening can screen for nucleic acid aptamers with higher affinity and better specificity.

[0040] In summary, the nucleic acid aptamer binding to GPRI N1 protein, application and screening method provided by the present invention have the following technical effects:

[0041] 1. By improving the screening conditions, a nucleic acid aptamer with small molecular weight, stable chemical properties, easy storage and labeling, which can bind to GPRI N1 protein with high affinity and high specificity, was screened and obtained;

[0042] 2. The structure is relatively stable, simple, easy to modify, can be synthesized artificially in a short period of time, has stable chemical properties, and is easy to store and label;

[0043] 3. It can be used for detection, diagnosis, imaging and treatment, such as purification or high-sensitivity and high-specificity detection of GPRI N1 protein; preparation of drugs targeting GPRI N1 protein; reagents or drugs for diagnosis and treatment of abnormal GPRI N1 expression, etc., and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 This is a schematic diagram of the binding ability of several rounds of enriched libraries obtained from the 1st to 7th rounds of screening with the target protein detected by QPCR (fluorescence quantitative PCR) in Example 1;

[0045] Figure 2 This is a schematic diagram of the melting curves of the enriched libraries and target proteins obtained by QPCR (fluorescence quantitative PCR) in the first to seventh rounds of screening in Example 1;

[0046] Figure 3 Schematic diagram of the retention rate of the positive screen library obtained in the 1st to 7th rounds of screening in Example 1;

[0047] Figure 4 This is a data diagram of affinity detection between nucleic acid aptamer GRIN1-19 and GRIN1 protein in Example 2;

[0048] Figure 5 This is a schematic diagram of the affinity detection data between the nucleic acid aptamer GRIN1-19 and B-Amyloid in Example 3;

[0049] Figure 6 This is a schematic diagram of the affinity detection data between the nucleic acid aptamer GRIN1-19 and TF in Example 3;

[0050] Figure 7 This is a schematic diagram of the affinity detection data of the nucleic acid aptamer GRIN1-19 and SNCA in Example 3;

[0051] Figure 8 This is a schematic diagram of the affinity detection data of nucleic acid aptamer GRIN1-19 and ADP7 in Example 3;

[0052] Fig. 9 This is a schematic diagram of the results of the dot blot hybridization experiment using nucleic acid aptamers in Example 4 to detect the specificity of GPRIN1 protein.

[0053] Fig.10 This is a schematic diagram of the results of the dot hybridization experiment using nucleic acid aptamers in Example 4 to detect the concentration gradient of GPRIN1 protein. DETAILED DESCRIPTION

[0054] For better understanding and implementation, the technical solutions in the embodiments of the present invention will be clearly and completely described and discussed below in conjunction with the accompanying drawings of the present invention. Obviously, what is described here is only a part of the examples of the present invention, not all the examples. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0055] In order to facilitate the understanding of the embodiments of the present invention, the following will be further explained by taking specific embodiments as examples in conjunction with the drawings, and each embodiment does not constitute a limitation on the embodiments of the present invention.

[0056] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0057] Example 1: Screening of ssDNA nucleic acid aptamers binding to GPRIN1 protein

[0058] The method for screening ssDNA nucleic acid aptamers binding to GPRIN1 protein in this embodiment comprises the following steps:

[0059] 1. Synthesize the random single-stranded DNA library and primers shown in the following sequence:

[0060] Random single-stranded DNA library:

[0061] 5'-TTCAGCACTCCACGCATAGC(36N)CCTATGCGTGCTACCGTG AA-3'(SEQ ID NO.2);

[0062] Among them, "36N" represents a sequence formed by connecting 36 arbitrary nucleotide bases. The library was synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0063] Primer information is shown in Table 1 and was synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0064] Table 1. Primers and their sequences

[0065] Primer name Sequence (5'-3') Lib13S1 TTCAGCACTCCACGCATAGC(SEQ ID NO.3) Lib13-FAM-S1 FAM-TTCAGCACTCCACGCATAGC(SEQ ID NO.4) Lib13-Biotin-A2 Biotin-TTCACGGTAGCACGCATAGG(SEQ ID NO.5) Lib13A2 TTCACGGTAGCACGCATAGG(SEQ ID NO.6)

[0066] Among them, S in the primer name represents the forward primer, and A in the primer name represents the reverse primer.

[0067] The primers were prepared into 100 μM storage solution with DPBS buffer (calcium chloride 0.1 g / L, potassium chloride 0.2 g / L, potassium dihydrogen phosphate 0.2 g / L, magnesium chloride hexahydrate 0.1 g / L, sodium chloride 8 g / L, sodium hydrogen phosphate dodecahydrate 2.8915 g / L; pH 7.4, 25°C) and stored at -20°C for later use.

[0068] 2. Magnetic bead screening

[0069] The magnetic bead method was used for screening, with a total of 7 rounds of screening. The screening process of each round is shown in Table 2.

[0070] Table 2. GPRIN1 protein aptamer screening process

[0071]

[0072]

[0073] The specific screening process is as follows:

[0074] 1) Carboxyl magnetic beads to immobilize GPRIN1 protein

[0075] Take 50 μl of carboxyl magnetic beads (Jiangsu Zecheng Biotechnology Co., Ltd., catalog number: FM2221), wash them 4 times with 200 μl of ultrapure water, fish the magnetic beads with a magnet, and remove the supernatant. Take 100 μl of each of the prepared NHS (N-hydroxysuccinimide; 0.1M aqueous solution) and EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution), mix them in equal volumes, add them to the magnetic beads, incubate at 25°C for 20 minutes to activate the carboxyl groups on the surface of the magnetic beads, and wash the magnetic beads twice with DPBS buffer for later use.

[0076] Take 32 μl of GPRIN1 protein (purchased from Aibosheng Science and Technology Co., Ltd., P03428PA, the concentration after dissolution is 1 mg / ml), add 468 μl of 10 mM sodium acetate at pH 5.5, mix well, and add to the above activated magnetic beads. Incubate at 25°C on a vertical mixer for 60 minutes, and the GPRIN1 protein is coupled to the surface of the magnetic beads through the amino groups on the protein surface.

[0077] After the coupling is completed, place the coupling tube on a magnetic stand, discard the supernatant, take 500μl 1M ethanolamine pH8.5 and add it to the magnetic beads, incubate on a vertical mixer at 25℃ for 10 minutes to block the unreacted activation sites on the surface of the magnetic beads. Place it on a magnetic stand and discard the blocking solution. Wash the magnetic beads 4 times with 250μl DPBS and mark them as MB-GPRIN1.

[0078] 2) Counter-screening and screening

[0079] Preparation of reverse screening magnetic beads: The His peptide was coupled to the magnetic beads. The His peptide was chemically synthesized by Nanjing GenScript Biotechnology Co., Ltd. The steps of coupling the His peptide were the same as those of coupling the GPRIN1 protein. The concentration of the His peptide was 10 mg / ml and it was diluted with a 10 mM NaAC solution at pH 4.5. Specifically, 10 μl of the His peptide was taken and 90 μl of a 10 mM NaAc solution at pH 4.5 was added and mixed. The rest of the steps were the same. The coupled magnetic beads were labeled MB-His.

[0080] Library dissolution and denaturation treatment: Take 1OD random single-stranded nucleotide library, centrifuge at 14000rpm for 5 minutes, centrifuge the library to the bottom of the tube, dissolve it to 10μM with DPBS buffer, mix it and dispense it into PCR tubes for denaturation treatment. The treatment process is as follows: The PCR instrument is set to 95℃ for 10 minutes. The purpose of this step is to unwind the folded chain, then keep it at 4℃ for 5 minutes, and then equilibrate to room temperature. Add the treated library to 50μl MB-His magnetic beads, mix it and incubate it at room temperature for a period of time on a vertical mixer. Place it on a magnetic stand, collect the supernatant, mark it as pool-, and use the supernatant as a single-stranded nucleic acid library for positive screening with MB-GPRIN1 magnetic beads. In each round of magnetic bead screening, MB-His is used for reverse screening before the positive screening targeting GPRIN1 protein, and the reverse screening supernatant is used as a single-stranded nucleotide library for positive screening with MB-GPRIN1 magnetic beads. Specifically, add the pool- of the library after counter-screening to 50 μl MB-GPRIN1 magnetic beads and incubate them at 25°C for 40 minutes on a vertical mixer. Place them on a magnetic stand, discard the supernatant, retain the magnetic beads, and wash the magnetic beads 4 times with 200 μl DPBS. Finally, add 200 μl DPBS to the washed magnetic beads, boil them in a boiling water bath for 10 minutes, collect the supernatant, and mark it as elution-GPRIN1.

[0081] The nucleic acid molecules in elution-GPRIN1 were used as templates and amplified by ordinary PCR. The method is as follows: add all template elution-GPRIN1 to 2ml PCR mix and mix well, divide the template and PCR mix mixture into 100μl / tube and add it to the PCR tube. The amplification conditions are as follows: 95℃ pre-denaturation for 2 minutes, 95℃ denaturation for 60 seconds, 60℃ annealing for 60 seconds, 72℃ extension for 60 seconds, a total of 25 cycles, and store at 4℃. PCR mix is ​​prepared with dNTPs (P031-02) purchased from Novozymes and rtaq enzyme (R500Z) purchased from Takara Biotech.

[0082] The amplified product was purified using commercially purchased Tiandirenhe SA magnetic beads (SM017100) to prepare a secondary library for the next round of screening. Add 1 / 5 volume of 4M sodium chloride to 2mL of PCR product, and then add 160uL of SA magnetic beads that have been washed with DPBS and the supernatant removed. After incubation on a shaker at room temperature for 30 minutes, remove the supernatant of the PCR product. Wash the magnetic beads three times with DPBS containing 0.02% Tween20, add 100uL of 40mM sodium hydroxide solution after removing the supernatant, and remove the magnetic beads by magnetic attraction after incubation for three minutes. Then add 4uL of 1M hydrochloric acid to the supernatant to neutralize the single chain, and then add 104uL of 2*DPBS to dilute and neutralize the salt concentration, and finally obtain 208uL of the secondary library dissolved in 1*DPBS, which can be used as the library for the next round of screening.

[0083] The magnetic bead method was used to screen 7 times repeatedly. Each operation used the secondary library obtained in the previous operation as the starting nucleic acid library. After the library was denatured and renatured, it was incubated with MB-GPRIN1 magnetic beads. During the screening process, SPR was used to detect the changes in the recognition ability of the DNA single-stranded library for the GPRIN1 protein. When the recognition ability of the DNA single-stranded library for the GPRIN1 protein met the requirements, that is, the binding ability of the screened DNA single-stranded library with the target protein was higher than that of the library input at the beginning of the screening ( Figure 1 ), Figure 1 Among them, p1, p2, p3, p4, and p6 represent the libraries obtained from the 1st, 2nd, 3rd, 4th, and 6th rounds of screening, respectively. It can be seen that the library targets obtained from the 5th and 6th rounds have high affinities, and p6 is much higher than p1 and p2, meeting the sequencing requirements. The obtained libraries were analyzed by high-throughput sequencing.

[0084] 3. Analysis and identification of nucleic acid aptamers obtained after screening: After high-throughput sequencing analysis of the obtained enriched library products, several sequences were selected and synthesized by Genewise Biotechnology (Jiangsu) Technology Co., Ltd., and the affinity was tested.

[0085] In subsequent tests, one sequence with the strongest binding ability was identified from the 100 sequences obtained in the final 7th round. The nucleic acid aptamer having the nucleotide sequence shown in SEQ ID NO.1 was named GRIN1-19. The specific sequence of SEQ ID NO.1 is TTCAGCACTCC ACGCATAGCACGGTCTGTGCCTGCGGTTGTTCAAGGGCTGTATTGCC TATGCGTGCTACCGTGAA.

[0086] Example 2: Surface Plasmon Resonance (SPR) Detection of Affinity between GPRIN1 Protein Aptamer and GPRIN1 Protein

[0087] Suzhou Genewise Biotechnology Co., Ltd. was commissioned to synthesize the nucleic acid aptamer GRIN1-19 (SEQ ID NO. 1), which was diluted to 500 nM with DPBS buffer.

[0088] 1. GPRIN1 protein was coupled to the second channel of the CM5 chip surface. The specific method was as follows: first, the chip was cleaned with 50mM NaOH, 20μl was injected, and the flow rate was 10μl / min. Then, equal volumes of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1M aqueous solution) were mixed and 50μl was injected to activate the chip at a flow rate of 5μl / min. GPRIN1 protein was diluted with 10mM sodium acetate at pH 5.5 to a final concentration of 20μg / mL and then injected. The injection volume was 50μL, the flow rate was 5μL / min, and the GPRIN1 protein coupling amount was 3359Ru. After the injection was completed, ethanolamine was injected to block the chip at a flow rate of 10μL / min and 100μL was injected. Channel 1 was treated as above, and the steps of coupling His protein, activation and blocking were exactly the same, and it was used as the control channel.

[0089] 2. Detection: Use a surface plasmon resonance instrument (GE Healthcare, model: Biacore 8K) to set the detection parameters. The diluted aptamer sample flows through channels 1 and 2 in turn. The procedure for each aptamer is as follows: injection 30 μL / min, time 2 minutes, dissociation 30 μL / min, time 2 minutes, regeneration 1M NaCl 30 μL / min, time 30 seconds, and the diluted aptamer is injected in turn.

[0090] The affinity test data of nucleic acid aptamer GRIN1-19 and GPRIN1 protein are shown in Figure 4 The KD values ​​are shown in Table 3 below, which illustrate the binding ability of the corresponding nucleic acid aptamers to the target protein GPRIN1 protein. These data show that these nucleic acid aptamers were detected to have strong binding to the GPRIN1 protein using the SPR instrument.

[0091] Table 3. Affinity of nucleic acid aptamers to GPRIN1 protein (the smaller the KD value, the greater the affinity)

[0092] Aptamers Affinity KD for GPRIN1 protein (nM) GRIN1-19 (SEQ ID NO. 1) 8.90

[0093] As can be seen from Table 3, one nucleic acid aptamer (SEQ ID NO. 1) screened from 100 sequences has a particularly high affinity for the GPRIN1 protein.

[0094] Example 3: Study on the specificity of nucleic acid aptamers

[0095] In this example, B-Amyloid, TF, SNCA, and ADP7 were used to replace GPRIN1 protein, respectively. The method of fixing GPRIN1 protein to the SPR chip for testing was the same as in Example 4. B-Amyloid, TF, SNCA, and ADP7 proteins were coupled to the second channel of four channels on the surface of the CM5 chip, and the coupling amounts were 322RU, 2268RU, 1413RU, and 3824RU, respectively. The diluted GRIN1-19, a total of 1 nucleic acid aptamer, was injected sequentially.

[0096] The affinity test data of nucleic acid aptamer GRIN1-19 and B-Amyloid can be found in Figure 5 , the affinity test data with TF can be found in Figure 6 , the affinity test data with SNCA can be found in Figure 7 , the affinity test data with ADP7 can be found in Figure 8 ;

[0097] It can be seen that the nucleic acid aptamer GRIN1-19 has very good specificity.

[0098] Example 4: Detection of GPRIN1 protein by dot blot hybridization assay based on nucleic acid aptamers

[0099] The steps of the dot hybridization experiment performed on a nucleic acid aptamer GRIN1-19 with high affinity and high specificity in this example are as follows:

[0100] 1. Take two 8cm×2cm nitrocellulose membranes (purchased from Millipore), dilute GPRIN1 protein to 1mg / ml with DPBS, and dilute control proteins B-Amyloid, TF, SNCA, and ADP7 to 1mg / ml respectively. Spot 2ul onto the nitrocellulose membrane and air dry for 40 minutes.

[0101] 2. After drying, block with 10% BSA at room temperature for 1 hour. After blocking, wash with DPBST (DPBS containing 0.5 ppm tween20) for 3 times and aspirate clean.

[0102] 3. After the cellulose membrane is washed, the nucleic acid aptamer synthesized by Jinweizhi in Example 3 is modified with biotin and diluted to 0.5uM, and then the diluted nucleic acid aptamer is incubated with the protein on the nitrocellulose membrane on a shaker at room temperature for 30min. After the incubation, it is washed three times with DPBST, and placed on a shaker for 5 minutes each time.

[0103] 4. Transfer the test strip to a new centrifuge tube, dilute HRP-Streptavidin (purchased from Beyotime Biotech 1 mg / ml): DPBS buffer at a ratio of 1:2000, take 3 mL and add it to soak it, incubate it at room temperature in the dark for 30 minutes. After the incubation, wash it with DPBS-T for 2 minutes, repeat the washing 3 times, and aspirate it clean.

[0104] 5. Transfer the test strip to a clean PE glove, take the ECL color development kit (purchased from Beyotime Biotech), mix 100uL of solution A and 100uL of solution B, soak the surface of the test strip, and incubate in the dark for 5 minutes.

[0105] 6. Observation and photography using the imaging system: The instrument used was the ImageQuantTM LAS 4000 digital imaging system from GE Healthcare Life Sciences.

[0106] The results are as follows Fig. 9 Shown is the result of specific detection using GRIN1-19.

[0107] Depend on Fig. 9 It can be seen that the biotin-modified aptamer GRIN1-19 can be used for the detection of membrane hybridized GPRIN1 protein. Compared with the spots of the control proteins B-Amyloid, TF, SNCA, and ADP7, the GPRIN1 protein is obvious, which shows that the aptamer can be used to accurately detect the GPRIN1 protein. Therefore, the aptamer GRIN1-19 was used for the detection of the GPRIN1 protein.

[0108] In this example, a concentration gradient of GRIN1-19 was used for the detection of GPRIN1 protein. GRIN1-19 was diluted with DPBS to 1 mg / mL, 0.50 mg / mL, 0.250 mg / mL, 0.125 mg / mL, 0.063 mg / mL, and 0.032 mg / mL. Dot hybridization was performed according to the above method. The results are as follows: Fig.10 As shown, the nucleic acid aptamer GRIN1-19 can be used to accurately detect 0.032 mg / mL of GPRIN1 protein.

[0109] Therefore, GRIN1-19 is the most preferred, as it has the highest sensitivity and accuracy in detection results.

[0110] The technical means disclosed in the scheme of the present invention are not limited to the technical means disclosed in the above-mentioned implementation mode, but also include technical schemes composed of any combination of the above-mentioned technical features. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications are also regarded as the protection scope of the present invention.

Claims

1. A nucleic acid aptamer that binds to GPRIN1 protein, characterized in that: The nucleic acid aptamer has a nucleotide sequence as shown in SEQ ID NO.1; or a nucleotide sequence having at least 30% homology with SEQ ID NO.1 and binding to GPRIN1 protein; or an RNA sequence transcribed from the nucleotide sequence as shown in SEQ ID NO.

1.

2. The nucleic acid aptamer binding to GPRIN1 protein according to claim 1, characterized in that: The nucleotide sequence of the nucleic acid aptamer is modified, and the modification method includes one or more of phosphorylation, methylation, amination, sulfhydrylation, replacement of oxygen with sulfur, replacement of oxygen with selenium, and isotopization.

3. The nucleic acid aptamer binding to GPRIN1 protein according to claim 2, characterized in that: The nucleic acid aptamer has a sequence that is at least 30% homologous to any one of SEQ ID NO. 1 and is obtained by modifying the nucleotide sequence that binds to the GPRIN1 protein.

4. The nucleic acid aptamer binding to GPRIN1 protein according to claim 3, characterized in that: The transformation includes at least one of the following transformation methods: (1) Connecting a fluorescent marker to the aptamer; (2) Connecting radioactive substances to the aptamer; (3) Connecting therapeutic substances to the aptamer; (4) connecting biotin to the aptamer; (5) connecting digoxigenin to the aptamer; (6) connecting a nanoluminescent material to the nucleic acid aptamer; (7) Connecting a small peptide to the aptamer; (8) Connecting siRNA to the nucleic acid aptamer.

5. A derivative of a nucleic acid aptamer, comprising the nucleic acid aptamer for binding to GPRIN1 protein according to any one of claims 1 to 4, characterized in that: The derivatives of the nucleic acid aptamer include a phosphorothioate backbone or a peptide nucleic acid that binds to the GPRIN1 protein and is formed by modifying the nucleotide sequence backbone of the nucleic acid aptamer or the conjugate of the nucleic acid aptamer.

6. The use of the nucleic acid aptamer according to any one of claims 1 to 4 and the nucleic acid aptamer derivative according to claim 5, characterized in that: Include at least one of the following: (1) Quantitative or qualitative detection of GPRIN1 protein; (2) Purification of GPRIN1 protein; (3) Imaging of GPRIN1 protein; (4) preparing drugs targeting GPRIN1 protein; (5) Prepare reagents or drugs for diagnosing and treating abnormal GPRIN1 expression.

7. A method for screening nucleic acid aptamers that bind to GPRIN1 protein, characterized in that: The following steps are involved: S1, synthesize random single-stranded DNA library and primers; S2. Magnetic bead screening: Perform at least 7 rounds of counter-screening and screening, and add serum starting from the 4th round.

8. The method for screening a nucleic acid aptamer binding to GPRIN1 protein according to claim 7, characterized in that: In step S2, serum is added after the 4th round, and the specific process is: 5% serum is added in the 4th round, and 20% serum is added in the 5th round; the serum is normal human serum.

Images