Multi-PCR amplification library building method based on single-ended sequencing and application of multi-PCR amplification library building method

Abstract

The invention provides a multiple PCR amplification library building method based on single-ended sequencing and application of the multiple PCR amplification library building method, and belongs to the technical field of biological medicine and molecular diagnosis. The invention provides a multi-PCR amplification library building method based on single-ended sequencing. The method comprises the following steps: extracting and treating DNA or RNA, carrying out a first round of PCR reaction and purification, carrying out a digestion reaction and purification, carrying out a second round of PCR reaction and purification, building a library and carrying out detection. According to the method, by optimizing the primer design, improving the amplification system and simplifying the library construction process, the sensitivity and specificity of the detection process are remarkably improved, the operation steps are simplified, the method can be used for detecting gene mutations (including SNV / Indel, Fusion, CNV and MSI) related to tumor targeted therapy, cancer diagnosis, relapse monitoring and medication guidance are carried out according to the detection result, and the application prospect is wide. Powerful tool support is provided for scientific research and clinical application.

Description

Technical Field

[0001] The present invention relates to the fields of biomedicine technology and molecular diagnosis technology, and in particular to a multiplex PCR amplification library construction method based on single-end sequencing and an application thereof. Background Art

[0002] Tumor is one of the major diseases that endanger human health. Its complexity and diversity have brought great challenges to modern medicine. With the progress of modern medicine and molecular biology, personalized treatment of tumors has become an important direction of tumor treatment. Tumors are often accompanied by multiple gene mutations. These mutations not only determine the occurrence and development of tumors, but also affect the sensitivity of patients to certain drugs. Therefore, accurate detection and identification of these gene mutations is crucial to the formulation of reasonable treatment plans.

[0003] At present, tumor targeted therapy and high-throughput sequencing (NGS) technology have become an important part of the field of tumor precision medicine. Among them, tumor targeted therapy is achieved by specifically inhibiting the key signaling pathways of tumor cells. Its representative molecular markers include EGFR, HER2, KRAS, BRAF, ALK, ROS1, MET, etc. The mutation or amplification of these genes has important clinical significance in many types of cancer. For example, EGFR mutation is an important basis for non-small cell lung cancer (NSCLC) patients to choose EGFR inhibitor drugs; HER2 gene amplification is an indication for breast cancer patients to receive trastuzumab treatment; NSCLC patients with ALK gene rearrangement (fusion) can benefit from crizotinib treatment; NSCLC patients with ROS1 rearrangement can benefit from crizotinib treatment; NSCLC patients with MET gene exon 14 skipping mutation can benefit from glutamate and tepotinib treatment; patients carrying BRAF gene V600E mutation can benefit from the combination treatment of BRAF inhibitors and MEK inhibitors, etc.

[0004] High-throughput sequencing (NGS) technology can analyze hundreds to thousands of gene loci simultaneously and is widely used in research and clinical practice to fully understand the complexity of tumor genomes. This technology has become the mainstream means of detecting gene mutations due to its high throughput, high sensitivity and high specificity. However, in actual application, existing NGS kits still face some problems in the process of multiplex PCR amplification and library construction: (1) Poor amplification specificity: Multiplex PCR reactions are prone to produce non-specific amplification products, which increases the risk of false positive results. (2) Strong amplification preference: There may be differences in amplification efficiency between different target fragments, resulting in some low-frequency mutations that cannot be effectively detected. (3) Complex library construction: The steps of NGS library construction are cumbersome, involving multiple purification and enzyme digestion treatments, which takes a long time to operate and is prone to introducing errors. (4) The long NGS sequencing time makes it impossible for doctors to obtain genetic test results in a timely manner, making it difficult to adjust individualized treatment plans based on the patient's genetic characteristics, affecting clinical decision-making and treatment plan adjustments.

[0005] Therefore, it is particularly urgent and necessary to develop a new, efficient and rapid NGS detection kit and a corresponding multiplex PCR amplification library construction method to improve amplification specificity and uniformity and simplify the library construction process. This can not only improve the accuracy and reliability of detection, but also better serve the needs of personalized tumor treatment and promote the development of precision medicine. Summary of the invention

[0006] The purpose of the present invention is to provide a multiplex PCR amplification library construction method based on single-end sequencing and its application. The amplification library construction method has high detection sensitivity and specificity, can detect gene mutations related to tumor targeted therapy, and has a fast detection process. Nucleic acid extraction, library construction and sequencing can be completed within 16 hours at the fastest, and can be used for cancer diagnosis, recurrence monitoring and medication guidance.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions: The present invention provides a multiplex PCR amplification library construction method based on single-end sequencing, comprising the following steps: (1) Extracting DNA samples and / or RNA samples from samples; (2) using the primer pool to perform multiplex PCR amplification and magnetic bead purification on the cDNA sample obtained by reverse transcription of the DNA sample or RNA sample in step (1); (3) digesting and purifying the non-specific amplification products in the product of step (2); (4) Using Index primers, perform secondary PCR labeling and purification on the product of step (3) to obtain an NGS library for tumor targeted drugs; (5) Perform single-end high-throughput sequencing on the NGS library constructed in step (4) and perform biological analysis on the sequencing data.

[0008] Preferably, in step (2), the primer pool includes specific primer pairs for detecting any one or more of SNV / Indel, CNV, Fusion, and MSI mutations of oncogenes and tumor suppressor genes.

[0009] Preferably, in step (2), the primer pool includes primers for detecting AKT1, ALK, ARAF, BRAF, CD274, CTNNB1, DDR2, DPYD, EGFR, ERBB2, ESR1, FBXW7, FGFR1, FGFR2, FGFR3, FGFR4, GNAS, HRAS, IDH1, IDH2, KIT, KRAS, MAP2K1, MET, NRAS, NTRK1, NTRK3, PDGFRA, PIK3CA , a DNA primer pool consisting of primers for detecting any one or more genes among POLD1, POLE, PTEN, RET, ROS1, SMAD4, TERT, TP53, UGT1A1 or MSI, or an RNA primer pool consisting of primers for detecting any one or more genes among ALK, BRAF, CLDN18, EGFR, FGFR1, FGFR2, FGFR3, FGFR4, MET, NRG1, NTRK1, NTRK2, NTRK3, RET, and ROS1; The DNA primer pool is used to detect any one or more gene mutation types among SNV / Indel, CNV, and MSI mutations, and the RNA primer pool is used to detect Fusion gene mutation types; The structure of the primers in the primer pool includes a bridging sequence and a specific amplification sequence for establishing an NGS library.

[0010] Preferably, the specific amplification sequences in the DNA primer pool include one or more of the sequences shown in SEQ ID NO.1 to SEQ ID NO.354; the specific amplification sequences in the RNA primer pool include one or more of the sequences shown in SEQ ID NO.355 to SEQ ID NO.410: the bridging sequences used to establish the NGS library are shown in SEQ ID NO.414 and SEQID NO.415.

[0011] Preferably, any one of the specific amplification sequences shown in SEQ ID NO.1 to SEQ ID NO.410 can be connected to the bridging sequences shown in SEQ ID NO.414 and SEQ ID NO.415, respectively, to detect any one or more of SNV / Indel, CNV, Fusion, and MSI mutations of oncogenes and tumor suppressor genes.

[0012] Preferably, in step (4), the Index primer sequence is as follows: SEQ ID NO.411: CAAGCAGAAGACGGCATACGAGANNNNNNNNCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC, where NNNNNNNN is 8 different base sequences used to identify the tag sequences of different samples; SEQ ID NO.412: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC.

[0013] Preferably, in step (5), the biological analysis step includes: performing quality control on the sequencing data and aligning it to the reference genome, and then using variation detection software to identify gene mutations and their frequencies associated with tumor targeted drugs.

[0014] The present invention also provides an application of a multiplex PCR amplification library construction method based on single-end sequencing in screening tumor targeted drugs, cancer diagnosis or recurrence monitoring.

[0015] The present invention also provides an NGS detection device or kit that can be used to implement the multiplex PCR amplification library construction method based on single-end sequencing.

[0016] The present invention also provides an NGS detection device or kit that can be used to implement a multiplex PCR amplification library construction method based on single-end sequencing and its application in screening tumor targeted drugs, cancer diagnosis or recurrence monitoring.

[0017] The beneficial effects of the present invention compared with the prior art are: The present invention provides a multiplex PCR amplification library construction method based on single-end sequencing, including: DNA or RNA extraction and processing, first round PCR reaction and purification, digestion reaction and purification, second round PCR reaction and purification to construct a library and perform detection. The above method significantly improves the sensitivity and specificity of the detection process and simplifies the operation steps by optimizing primer design, improving the amplification system and streamlining the library construction process. It can be used to detect gene mutations related to tumor targeted therapy, including single nucleotide variants (SNVs), insertions and deletions (Indels), gene fusions, copy number variants (Copy number Variants) and microsatellite instability (MSI). According to the test results, cancer diagnosis, recurrence monitoring and medication guidance are carried out, providing powerful tool support for scientific research and clinical applications.

[0018] (2) The accuracy and specificity of the multiplex PCR amplification library construction method based on single-end sequencing in the present invention reached 100%, and the minimum detection limit of SNV / Indel was 1%, the minimum detection limit of CNV was 4 copies, the minimum detection limit of Fusion was 100 copies, and the minimum detection limit of MSI was 10%. It can accurately detect tumor-related mutations and is suitable for large-scale clinical testing and scientific research applications. It is expected to play an important role in personalized tumor treatment.

[0019] (3) The multiplex PCR amplification and library construction method based on single-end sequencing of the present invention can simultaneously sequence from the upstream and downstream of the primer in the single-end sequencing mode to achieve the effect of double-end sequencing, and the sequencing time is shortened to 1 / 2 of the double-end. The nucleic acid extraction, library construction and sequencing can be completed within 16 hours at the fastest, which is used for cancer diagnosis, recurrence monitoring and medication guidance. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0021] Figure 1 The invention discloses a multiplex PCR amplification library construction method based on single-end sequencing. DETAILED DESCRIPTION

[0022] The embodiments of the present invention are described in detail below, and the embodiments are intended to explain the present invention and should not be construed as limiting the present invention. If specific techniques or conditions are not specified in the embodiments, they are carried out according to the techniques or conditions described in the literature in this area or according to the product specifications. If the manufacturers of reagents or instruments are not specified, they are all conventional products that can be obtained commercially.

[0023] The present invention provides two construction methods for different samples (see Figure 1 ): 1. When the extracted sample is RNA, the library construction steps include: (1) Extracting RNA samples from samples, pre-treating the RNA samples, performing reverse transcription, and purifying the RNA samples to obtain cDNA samples; (2) using the RNA primer pool to perform the first round of multiplex PCR amplification and magnetic bead purification on the cDNA sample in step (1); (3) digesting and purifying the non-specific amplification products in the product of step (2); (4) Using Index primers, perform secondary PCR labeling and purification on the product of step (3) to obtain a targeted library for tumor targeted drugs; perform quality control on the targeted library and quantify the library using Qubit4.0 (Qubit dsDNA HS Assay Kit, Q32854). When the library concentration is ≥0.4 ng / μL, the preparation is considered qualified and the NGS library is obtained; (5) Perform high-throughput sequencing on the qualified NGS library constructed in step (4) and perform bioinformatics analysis on the sequencing data.

[0024] 2. When the extracted sample is DNA, the library construction steps include: (1) Extracting DNA samples from samples; (2) using the DNA primer pool to perform a first round of multiplex PCR amplification and magnetic bead purification on the DNA sample in step (1); (3) digesting and purifying the non-specific amplification products in the product of step (2); (4) Using Index primers, perform secondary PCR labeling and purification on the product of step (3) to obtain a targeted library for tumor targeted drugs; perform quality control on the targeted library and quantify the library using Qubit4.0 (Qubit dsDNA HS Assay Kit, Q32854). When the library concentration is ≥0.4 ng / μL, the preparation is considered qualified and the NGS library is obtained; (5) Perform high-throughput sequencing on the qualified NGS library constructed in step (4) and perform bioinformatics analysis on the sequencing data.

[0025] The target genes amplified by the present invention are shown in Table 1.

[0026]

[0027] The DNA primer pool used in the following examples includes: An amplification primer set obtained by connecting the sequences shown in SEQ ID NO.1 to SEQ ID NO.354 with the bridge sequences shown in SEQ ID NO.414 and SEQ ID NO.415, respectively, wherein the concentration of each primer is 75 nM; The RNA primer pool used in the following examples includes: an amplification primer set obtained by connecting the sequences shown in SEQ ID NO.355 to SEQ ID NO.410 with the bridging sequences shown in SEQ ID NO.414 and SEQ ID NO.415, respectively, wherein the concentration of each primer is 25 nM.

[0028] Example 1 Example 1 of the present invention detects EGFR mutations in lung cancer samples, and the specific steps are as follows: (1) DNA extraction: A nucleic acid extraction kit (Zhenyue Bio, YCP-1201) was used to extract DNA from lung cancer sections at a concentration of 10 ng / μL.

[0029] (2) Multiplex PCR amplification and purification: Prepare a DNA primer pool for EGFR detection: Use the DNA primer pool to perform multiplex PCR amplification on the DNA isolated in step (1). The PCR amplification system is as follows: use 2 μL of PCR amplification mixture (PARGON GENOMICS, 5X mPCR Mix), 2 μL of DNA primer pool, 2 μL of DNA, and add nuclease-free water to 10 μL for amplification; Amplification conditions were as follows: pre-denaturation at 95°C for 10 minutes; denaturation at 98°C for 15 seconds, annealing / extension at 60°C for 5 minutes, for a total of 10-12 cycles; and maintenance at 10°C. After amplification, 2 μL of stop buffer (PARGON GENOMICS, Stop Buffer) was added.

[0030] (3) Purify the amplified product using purification magnetic beads: Mix the PCR product from step (2) with purified magnetic beads in a volume ratio of 1.3:1 and let stand at room temperature for 10 minutes; collect the magnetic beads using a magnetic stand and discard the supernatant; wash the magnetic beads twice with 70% ethanol, using 180 μL of ethanol each time, let stand for 30 seconds, and remove the ethanol by aspiration; open the tube and dry the magnetic beads at room temperature for 5 minutes; add 20 μL of elution buffer, mix thoroughly, and proceed directly to the next step of the reaction.

[0031] (4) Digestion and purification: Use 2μL of digestion enzyme (PARGON GENOMICS, CP Digestion Reagent), 2μL of digestion buffer (PARGON GENOMICS, CP Reagent Bufffer) and 6μL of nuclease-free water to mix with the eluate in step (3). Then incubate at 37°C for 10 minutes. After the incubation, add 2μL of stop buffer (PARGON GENOMICS, Stop Buffer).

[0032] The product was purified again using the magnetic bead purification step of step (3).

[0033] (5) Index labeling and purification: The digestion product of step (4) was labeled by secondary PCR using the primer mixture of Index shown in SEQ ID NO.412 to SEQ ID NO.413 (all at a concentration of 5 μM). The secondary PCR labeling system was as follows: using amplification mixture 2 (PARGONGENOMICS, 5X 2 nd Add 8 μL of PCR Mix, 4 μL of Index Primer Mix, and 18 μL of nuclease-free water to the eluted product of step (4).

[0034] Amplification conditions were: Pre-denaturation at 95°C for 10 minutes; denaturation at 98°C for 15 seconds, annealing / extension at 60°C for 75 seconds, for a total of 12 to 15 cycles; hold at 10°C.

[0035] Mix the PCR product with purified magnetic beads in a volume ratio of 1:1 and let stand at room temperature for 10 minutes; collect the magnetic beads using a magnetic stand and discard the supernatant; wash the magnetic beads twice with 70% ethanol, using 180 μL ethanol each time, let stand for 30 seconds, and remove the ethanol; open the tube and dry the magnetic beads at room temperature for 5 minutes; add 20 μL elution buffer, mix thoroughly and let stand on the magnetic stand, collect the eluate, and obtain the targeted library.

[0036] (6) DNA library quality control: The library was quantified using Qubit4.0 (Qubit dsDNA HS Assay Kit, Q32854). The library concentration was 1.6 ng / μL, and the NGS library was obtained.

[0037] (7) NGS sequencing: After constructing the NGS library, sequencing was performed on the Illumina MiniSeq platform.

[0038] Data analysis: After sequencing, the sequencing data was transferred to the tumor gene detection data management software (Zhenyue Bio, version number not less than 2.0) for automatic data analysis to obtain the gene mutation results. The results showed a deletion mutation of EGFR exon 19 in the sample, with a mutation frequency of 15%. The sample was derived from a 55-year-old patient diagnosed with ⅢA (T3N1M0) lung adenocarcinoma, who was treated with EGFR inhibitor targeted drugs icotinib and osimertinib, with a total survival of 52 months.

[0039] Example 2 Example 2 of the present invention performs ALK fusion mutation detection in lung cancer samples, and the specific steps are as follows: (1) RNA extraction: RNA was extracted from lung cancer sections using a nucleic acid extraction kit (Zhenyue Bio, YCP-1301) at a concentration of 50 ng / μL.

[0040] (2) Preparation of cDNA: 4 μL of extracted RNA, 5 μL of reverse transcription buffer 1 (Abclonal, 2X Frag / Elute Buffer) and nuclease-free water were added to 10 μL and mixed, and then RNA was pretreated at 65°C for 5 minutes; after pretreatment, 2 μL of reverse transcriptase (Abclonal, First strand Synthesis Enzyme Mix) and 8 μL of reverse transcription buffer 2 (Abclonal, RTReagent) were added and mixed, and cDNA synthesis reaction was carried out according to the following conditions: Temperature and time settings: 25℃ for 10 minutes; 42℃ for 15 minutes, 70℃ for 15 minutes, then keep at 4℃.

[0041] Using the purification magnetic beads, perform purification as follows: The product was mixed with purified magnetic beads in a volume ratio of 2.2:1 and allowed to stand at room temperature for 10 minutes. The magnetic beads were collected using a magnetic stand and the supernatant was discarded. The magnetic beads were washed twice with 70% ethanol, each time with 180 μL ethanol, allowed to stand for 30 seconds, and the ethanol was removed by aspiration. The tube was opened and the magnetic beads were dried at room temperature for 5 minutes. 10 μL elution buffer was added and the mixture was thoroughly mixed before proceeding directly to the next step.

[0042] (3) Multiplex PCR amplification and purification: Prepare an RNA primer pool for ALK fusion detection: Use the RNA primer pool to perform multiplex PCR amplification on the cDNA obtained by reverse transcription in step (2). The PCR amplification system is as follows: 4 μL of PCR amplification mixture (PARGON GENOMICS, 5X mPCR Mix), 2 μL of RNA primer pool, 1 μL of exogenous quality control (non-human plasmid DNA, 100 copies), and 3 μL of nuclease-free water. Add them to the reverse transcription product of step (2) and mix them for amplification. Amplification conditions were: 95°C pre-denaturation for 10 minutes; 98°C denaturation for 15 seconds, 60°C annealing / extension for 5 minutes, for a total of 10-12 cycles; 10°C hold. After amplification, 2 μL of stop buffer (PARGON GENOMICS, Stop Buffer) was added.

[0043] (4) Purify the amplified product using purification magnetic beads: The amplified product was purified using purification magnetic beads according to the method of step (3) in reference example 1.

[0044] (5) Digestion and purification: Digestion and purification were performed according to the method of step (4) in reference example 1.

[0045] (6) Index labeling and purification: The digestion product of step (5) was labeled by secondary PCR using the Index primer mixture shown in SEQ ID NO.412~SEQ ID NO.413 (all at a concentration of 5 μM). The secondary PCR labeling system is: 8 μL of amplification mixture 2 (PARGONGENOMICS, 5X 2nd PCR Mix), 1.6 μL of Index primer mixture, and 20.4 μL of nuclease-free water were added to the eluted product of step (5) and mixed.

[0046] The amplification conditions and purification steps were similar to those in step (5) of Example 1 to obtain a targeted library.

[0047] (7) RNA library quality control: The library was quantified using Qubit4.0 (Qubit dsDNA HS Assay Kit, Q32854) to obtain the NGS library. The library concentration was 0.3 ng / μL.

[0048] (8) NGS sequencing: After NGS library construction, sequencing was performed on the Illumina MiniSeq platform.

[0049] Data analysis: After sequencing is completed, the sequencing data is transferred to the tumor gene detection data management software (Zhenyue Bio, version number not less than 2.0) for automatic data analysis to obtain gene mutation results. The sample was derived from a 34-year-old patient diagnosed with stage IIIC left lung adenocarcinoma. He benefited from the treatment of ALK-TKI third-generation targeted drug lorlatinib. After 3 months of treatment, the efficacy evaluation achieved partial remission (PR), and the subsequent efficacy evaluation maintained PR. As of the last follow-up in June 2024, the patient's progression-free survival (PFS) has exceeded 70 months.

[0050] Example 3 Example 3 of the present invention performs microsatellite instability (MSI) detection in colorectal cancer samples, and the specific steps are as follows: (1) DNA extraction: DNA was extracted from colorectal cancer sections using a nucleic acid extraction kit (Zhenyue Biotechnology, YCP-1201) at a concentration of 10 ng / μL.

[0051] (2) Referring to steps (1) to (5) of Example (1), a targeted library is obtained. The difference from Example (1) is that the DNA used in the multiplex PCR amplification and purification in step (2) is the DNA in step (1) of Example 3.

[0052] (3) DNA library quality control: The library was quantified using Qubit4.0 (Qubit dsDNA HS Assay Kit, Q32854). The library concentration was 2.2 ng / μL, and the library preparation was qualified; (4) NGS sequencing: After library construction, sequencing was performed on the Illumina MiniSeq platform.

[0053] Data analysis: After sequencing is completed, the sequencing data is transferred to the tumor gene detection data management software (Zhenyue Bio, version number not less than 2.0), and then the data analysis is automatically performed to obtain the gene mutation results. The test results showed that patients with colorectal cancer had a high level of microsatellite instability (MSI-H). The patient was a 36-year-old metastatic colorectal cancer patient who failed second-line treatment. He was confirmed as a dMMR (mismatch repair deficiency) patient screened for Lynch syndrome through simultaneous testing and benefited from the immune drug PD-1 antibody treatment. After 4 courses of treatment, the multiple enlargements of the retroperitoneal lymph nodes basically disappeared, and a state of clinical complete remission was achieved. The drug was discontinued two years after treatment, and the patient was still in a disease-free survival (NED) state at the most recent review (June 2022).

[0054] Example 4 Example 4 of the present invention detects the effect of the multiplex PCR amplification library construction method based on single-end sequencing of the present application, and the specific steps are as follows: (1) Evaluation of the initial amount of library construction Evaluate the effect of different nucleic acid input amounts on the test results.

[0055] 18 lung cancer sections were selected, and DNA was extracted using a nucleic acid extraction kit (Zhenyue Bio, YCP-1201), and then quantified by Qubit4.0 (ThermoFisher, Q32854). 1ng, 2.5ng, 5ng, 10ng, 20ng and 30ng were used to evaluate the starting amount of DNA; 4 lung cancer sections were selected, and RNA was extracted using a nucleic acid extraction kit (Zhenyue Bio, YCP-1301), and then quantified by Qubit4.0 (ThermoFisher, Q32852). 10ng, 25ng, 50ng, 100ng and 300ng were used to evaluate the starting amount of RNA; each sample was repeated three times. The effects of different starting amounts on the test results were compared to evaluate whether the sample quality control passed and whether the target variation was detected under different starting amounts.

[0056] Quality control standards: DNA library: [1] The library qualification rate reaches 100%, and the qualification standard is that the library concentration is not less than 0.4ng / uL; [2] The data quality control qualification rate reaches 100%, and the qualification standard is that the average sequencing depth (Average depth) is not less than 800x, and the uniformity (uniformity) is not less than 70%; 3] All sample mutation results are 100% detected.

[0057] RNA library: [1] The data quality control pass rate reached 100%, and the data qualification standard was that the total reads were not less than 20,000, and the number of reads of any housekeeping gene was not less than 20; [2] All sample mutation results were 100% detected.

[0058] Table 2 Mean values ​​of quality control parameters at different DNA input amounts

[0059]

[0060]

[0061]

[0062] The results showed that the sample quality control passed and all target variants were detected when the minimum starting amount of DNA was 10 ng and the minimum starting amount of RNA was 50 ng. Therefore, the minimum input amount of DNA was 10 ng and the minimum input amount of RNA was 50 ng.

[0063] (2) Accuracy assessment 16 cell line standards (Nanjing Kebo) were tested, and the mutation types included SNV, Indel, Fusion, CNV and MSI. The sample information is detailed in the table below. All mutations were verified using Sanger and ddPCR methods. Each sample was tested three times, and the corresponding mutations to be tested should all be positive.

[0064] Test 4 negative cell line standards, two of which are wild-type cell line references and two of which are positive mutations outside the detection range of this kit. Each sample is tested three times, and the test results should all be negative.

[0065]

[0066] The results in Table 7 show that all target variants were detected and no target variants were detected in all negative samples, that is, the accuracy was 100%.

[0067]

[0068] (3) Minimum detection limit assessment: 15 nucleic acid samples from clinical lung cancer sections and 3 cell line standards (Nanjing Kebo) were selected. The types of mutations included SNV, Indel, Fusion, CNV and MSI. The sample preparation information is shown in the table below. The frequency gradients of SNV and Indel were set to 0.6%, 1%, and 2.5%; the copy number gradients set for CNV were 3 copies, 4 copies, and 6 copies; the copy number gradients set for Fusion were 50 copies / 50ng, 100 copies / 50ng, and 200 copies / 50ng; the tumor cell line proportion gradients set for MSI were: 5%, 10%, and 15% tumor cell line proportion. Each mutation frequency was repeated 20 times in parallel, and the lowest mutation frequency with a positive site detection rate of 95% was taken as the optimal detection limit of the kit.

[0069] (1) Preparation of DNA samples with gradient SNV / Indel mutation frequency: 11 clinical lung cancer positive DNA samples DS0530, DS0187, DS0255, DS0244, DS0154, DS0071, DS0223, DS0382, DS0629, DS0574, and DS0551 containing 9 mutation sites to be tested were collected. Each sample contained a single gene mutation site. According to the initial ddPCR fixed frequency results, the negative cell line GM12878D DNA was used as the sample diluent to dilute the mutation frequency of the 9 clinical positive samples to three gradients of 0.6%, 1%, and 2.5%, and ddPCR detection was performed. The preparation results are shown in Table 10.

[0070] (2) Preparation of gradient DNA samples for ERBB2 and MET gene copy number amplification: DNA standards of ERBB2 and MET copy number amplification cell lines purchased from Kebai were used. Based on the initial ddPCR copy number quantification results, DNA of the negative cell line GM12878D was used as sample diluent to dilute the ERBB2 and MET gene copies to three gradients of 6, 4, and 3, respectively, and ddPCR was performed for detection. The preparation results are shown in Table 10 (3) Preparation of DNA samples with different tumor cell content gradients for MSI: The MSH cell line DNA standard purchased from Kebai was used, with a tumor cell content of 100%. The negative cell line GM12878D DNA was used as the sample diluent to dilute the MSH cell line DNA standard to three gradients of 15%, 10%, and 5% tumor cell content. ddPCR detected the background purity and mutation frequency unique to the MSH cell line to calibrate the incorporated tumor cell content. The preparation results are shown in Table 10.

[0071] (4) Preparation of FUSION positive copy gradient RNA samples: Four clinical lung cancer fusion-positive RNA samples RS0001, RS0076, RS0047, and RS0054 containing the four fusion sites to be tested were taken. According to the initial ddPCR copy number quantification results, the negative cell line GM12878R FFPE RNA was used as the sample diluent to dilute the positive fusion copy number to three gradients of 50 copies / 50ng, 100 copies / 50ng, and 200 copies / 50ng, and ddPCR detection was performed. The preparation results are shown in Table 11.

[0072] Note: Bio-Rad QX200 was used to perform ddPCR detection of mutation frequency of SNV / Indel sites. The test standards are as follows:

[0073] Bio-Rad QX200 was used for ddPCR detection of CNV copy number quantification, and the test standards were as follows:

[0074]

[0075]

[0076] The results in Table 12 show: 1) The mutation frequency of SNV and Indel variant sites is 1%, and the detection rate is 95%, so the minimum detection limit of SNV / Indel is 1%; 2) The copy number of CNV variant is 4 copies, and the detection rate is 95%, so the minimum detection limit of CNV is 4 copies; 3) The copy number of Fusion variant is 100 copies, and the detection rate is 95%, so the minimum detection limit of Fusion is 100; 4) The proportion of MSI tumor cells is 10%, and the detection rate is 95%, so the minimum detection limit of MSI is 10%.

[0077]

[0078] (5) Repeatability evaluation: Select 10 cell line standards (Nanjing Kebo) and perform 10 intra-batch and 10 inter-batch repeat tests. That is, the same sample is tested 10 times using the same batch of reagents, and the corresponding mutations should be detected; the same sample is tested 10*3 times using three batches, a total of 30 times, and the corresponding mutations should be detected. The reference product information is as follows:

[0079] The results in Table 14 show that the repeatability test results within and between batches of the same sample are consistent.

[0080]

[0081] (6) Interference analysis: Two cell line standards (Nanjing Kebo) were selected, and the sample information is shown in Table 1. Five potential interfering substances in clinical samples were selected for study: ethanol, formalin, melanin, hemoglobin, and proteinase K. Different types and concentrations of interfering substances were added to the nucleic acid samples for testing, and blank controls were set at the same time. Each type was tested three times. The interfering substances added and the corresponding concentration settings are shown in Table 16.

[0082]

[0083]

[0084] The results in Table 17 show that when the interferences do not exceed 8% v / v ethanol, 0.02% v / v formalin, 0.5 mg / L melanin, 0.5 g / L hemoglobin and 20 mg / L proteinase K, respectively, there is no effect on the test results.

[0085]

[0086] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A multiplex PCR amplification library construction method based on single-end sequencing, characterized in that: The steps include: (1) Extracting DNA samples and / or RNA samples from samples; (2) using the primer pool to perform multiplex PCR amplification and magnetic bead purification on the cDNA sample obtained by reverse transcription of the DNA sample or RNA sample in step (1); (3) digesting and purifying the non-specific amplification products in the product of step (2); (4) Using Index primers, perform secondary PCR labeling and purification on the product of step (3) to obtain an NGS library for tumor targeted drugs; (5) Perform single-end high-throughput sequencing on the NGS library constructed in step (4) and perform biological analysis on the sequencing data.

2. The multiplex PCR amplification library construction method based on single-end sequencing according to claim 1, characterized in that: In step (2), the primer pool includes specific primer pairs for detecting any one or more of SNV / Indel, CNV, Fusion, and MSI mutations of oncogenes and tumor suppressor genes.

3. The multiplex PCR amplification library construction method based on single-end sequencing according to claim 2, characterized in that: In step (2), the primer pool includes primers for detecting AKT1, ALK, ARAF, BRAF, CD274, CTNNB1, DDR2, DPYD, EGFR, ERBB2, ESR1, FBXW7, FGFR1, FGFR2, FGFR3, FGFR4, GNAS, HRAS, IDH1, IDH2, KIT, KRAS, MAP2K1, MET, NRAS, NTRK1, NTRK3, PDGFRA, PIK3CA, P A DNA primer pool consisting of primers for detecting any one or more genes among OLD1, POLE, PTEN, RET, ROS1, SMAD4, TERT, TP53, UGT1A1 or MSI, or an RNA primer pool consisting of primers for detecting any one or more genes among ALK, BRAF, CLDN18, EGFR, FGFR1, FGFR2, FGFR3, FGFR4, MET, NRG1, NTRK1, NTRK2, NTRK3, RET, ROS1; The DNA primer pool is used to detect any one or more gene mutation types among SNV / Indel, CNV, and MSI mutations, and the RNA primer pool is used to detect Fusion gene mutation types; The structure of the primers in the primer pool includes a bridging sequence and a specific amplification sequence for establishing an NGS library.

4. The multiplex PCR amplification library construction method based on single-end sequencing according to claim 3, characterized in that: The specific amplification sequence in the DNA primer pool includes one or more of the following sequences: The sequences shown in SEQ ID NO.1 to SEQ ID NO.2 are used to amplify AKT1; The sequences shown in SEQ ID NO.3 to SEQ ID NO.10 are used to amplify ALK; The sequences shown in SEQ ID NO.11 to SEQ ID NO.12 are used to amplify ARAF; The sequences shown in SEQ ID NO.13 to SEQ ID NO.16 are used to amplify BRAF; The sequences shown in SEQ ID NO.17 to SEQ ID NO.36 are used to amplify CD274; The sequences shown in SEQ ID NO.37 to SEQ ID NO.43 are used to amplify CTNNB1; The sequences shown in SEQ ID NO.44 to SEQ ID NO.45 are used to amplify DDR2; The sequences shown in SEQ ID NO.46 to SEQ ID NO.55 are used to amplify DPYD; The sequences shown in SEQ ID NO.56 to SEQ ID NO.67 are used to amplify EGFR; The sequences shown in SEQ ID NO.68 to SEQ ID NO.95 are used to amplify ERBB2; The sequences shown in SEQ ID NO.96 to SEQ ID NO.103 are used to amplify ESR1; The sequences shown in SEQ ID NO.104 to SEQ ID NO.105 were used to amplify FBXW7; The sequences shown in SEQ ID NO.106 to SEQ ID NO.113 are used to amplify FGFR1; The sequences shown in SEQ ID NO.114 to SEQ ID NO.121 are used to amplify FGFR2; The sequences shown in SEQ ID NO.122 to SEQ ID NO.125 are used to amplify FGFR3; The sequences shown in SEQ ID NO.126 to SEQ ID NO.132 are used to amplify FGFR4; The sequences shown in SEQ ID NO.133 to SEQ ID NO.136 are used to amplify GNAS; The sequences shown in SEQ ID NO.137 to SEQ ID NO.144 are used to amplify HRAS; The sequences shown in SEQ ID NO.145 to SEQ ID NO.148 are used to amplify IDH1; The sequences shown in SEQ ID NO.149 to SEQ ID NO.152 are used to amplify IDH2; The sequences shown in SEQ ID NO.153 to SEQ ID NO.160 are used to amplify KIT; The sequences shown in SEQ ID NO.161 to SEQ ID NO.166 are used to amplify KRAS; The sequences shown in SEQ ID NO.167 to SEQ ID NO.178 are used to amplify MAP2K1; The sequences shown in SEQ ID NO.179 to SEQ ID NO.190 are used to amplify MET; The sequences shown in SEQ ID NO.191 to SEQ ID NO.224 are used to amplify MSI; The sequences shown in SEQ ID NO.225 to SEQ ID NO.230 are used to amplify NRAS; The sequences shown in SEQ ID NO.231 to SEQ ID NO.234 are used to amplify NTRK1; The sequences shown in SEQ ID NO.235 to SEQ ID NO.238 are used to amplify NTRK3; The sequences shown in SEQ ID NO.239 to SEQ ID NO.244 are used to amplify PDGFRA; The sequences shown in SEQ ID NO.245 to SEQ ID NO.254 are used to amplify PIK3CA; The sequences shown in SEQ ID NO.255 ​​to SEQ ID NO.270 are used to amplify POLD1; The sequences shown in SEQ ID NO.271 to SEQ ID NO.280 are used to amplify POLE; The sequences shown in SEQ ID NO.281 to SEQ ID NO.302 are used to amplify PTEN; The sequences shown in SEQ ID NO.303 to SEQ ID NO.318 are used to amplify RET; The sequences shown in SEQ ID NO.319 to SEQ ID NO.322 are used to amplify ROS1; The sequences shown in SEQ ID NO.323 to SEQ ID NO.332 are used to amplify SMAD4; The sequences shown in SEQ ID NO.333 to SEQ ID NO.334 are used to amplify TERT; The sequences shown in SEQ ID NO.335 to SEQ ID NO.350 are used to amplify TP53; The sequences shown in SEQ ID NO.351 to SEQ ID NO.354 are used to amplify UGT1A1; The specific amplification sequence in the RNA primer pool includes one or more of the following sequences: The sequences shown in SEQ ID NO.355 to SEQ ID NO.360 are used to amplify ALK; The sequences shown in SEQ ID NO.361 to SEQ ID NO.364 are used to amplify BRAF; The sequences shown in SEQ ID NO.365 to SEQ ID NO.366 are used to amplify CLDN18; The sequences shown in SEQ ID NO.367 to SEQ ID NO.368 are used to amplify EGFR; The sequences shown in SEQ ID NO.369 to SEQ ID NO.370 are used to amplify FGFR1; The sequences shown in SEQ ID NO.371 to SEQ ID NO.373 are used to amplify FGFR2; The sequences shown in SEQ ID NO.374 to SEQ ID NO.375 are used to amplify FGFR3; The sequences shown in SEQ ID NO.376 to SEQ ID NO.377 are used to amplify FGFR4; The sequences shown in SEQ ID NO.378 to SEQ ID NO.381 are used to amplify MET; The sequences shown in SEQ ID NO.382 to SEQ ID NO.385 are used to amplify NRG1; The sequences shown in SEQ ID NO.386 to SEQ ID NO.388 are used to amplify NTRK1; The sequences shown in SEQ ID NO.389 to SEQ ID NO.390 are used to amplify NTRK2; The sequences shown in SEQ ID NO.391 to SEQ ID NO.394 are used to amplify NTRK3; The sequences shown in SEQ ID NO.395 to SEQ ID NO.399 are used to amplify RET; The sequences shown in SEQ ID NO.400 to SEQ ID NO.410 are used to amplify ROS1; The bridging sequences used to establish the NGS library are shown in SEQ ID NO.414 and SEQ ID NO.

415.

5. The multiplex PCR amplification library construction method based on single-end sequencing according to claim 1, characterized in that: Any one of the specific amplification sequences shown in SEQ ID NO.1 to SEQ ID NO.410 can be connected to the bridging sequences shown in SEQ ID NO.414 and SEQ ID NO.415, respectively, to detect any one or more of SNV / Indel, CNV, Fusion, and MSI mutations of oncogenes and tumor suppressor genes.

6. The multiplex PCR amplification library construction method based on single-end sequencing according to claim 1, characterized in that: In step (4), the Index primer sequence is as follows: SEQ ID NO.411: CAAGCAGAAGACGGCATACGAGANNNNNNNNCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC, where NNNNNNNN is 8 different base sequences used to identify the tag sequences of different samples; SEQ ID NO.412: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC.

7. The multiplex PCR amplification library construction method based on single-end sequencing according to claim 1, characterized in that: In step (5), the biological analysis step includes: The sequencing data is quality controlled and aligned to the reference genome, and then variant detection software is used to identify gene mutations and their frequencies associated with tumor targeted drugs.

8. An application of the multiplex PCR amplification library construction method based on single-end sequencing according to claim 1 in screening tumor targeted drugs, cancer diagnosis or recurrence monitoring.

9. An NGS detection device or kit that can be used to implement the multiplex PCR amplification library construction method based on single-end sequencing as described in claim 1.

10. Use of an NGS detection device or kit for implementing a multiplex PCR amplification library construction method based on single-end sequencing as described in claim 9 in screening tumor targeted drugs, cancer diagnosis or recurrence monitoring.

Images