Genetically engineered algae for inhibiting protozoa as well as construction method and application of genetically engineered algae

Abstract

The invention discloses a genetically engineered algae for inhibiting protozoa and a construction method and application thereof, and is characterized in that the genetically engineered algae is phaeodactylum tricornutum into which an expression plasmid pPha-T1-eGFP-Linker-EP2 is introduced, and the nucleotide sequence of the expression plasmid is as shown in SEQ ID NO: 7. The construction method comprises the following steps: artificially synthesizing an EP2 coding sequence optimized by a codon; a step of inserting the expression vector into the downstream of the eGFP of the expression vector, and expressing a plasmid pPha-T1-eGFP-Linker-EP2; the method comprises the following steps of: electrically transforming expression plasmids into phaeodactylum tricornutum, and coating transformed phaeodactylum tricornutum cells on an f / 2 plate culture medium for culturing and screening positive algae strains to obtain the genetically engineered algae for inhibiting protozoa, and has the advantages that the large-scale culture efficiency and success rate of microalgae are improved, and the genetically engineered algae have a strong inhibition effect on Tophelenium sectorius and Tophelenium lakeri.

Description

Technical Field

[0001] The invention belongs to the technical field of plant breeding, and in particular relates to a genetically engineered algae capable of inhibiting protozoa, a construction method and an application thereof. Background Art

[0002] Compared with terrestrial higher plants, microalgae have a faster growth rate, higher photosynthesis efficiency, and can accumulate a large amount of high value-added substances, such as carotenoids, polyunsaturated fatty acids, active polysaccharides and active polyphenols, and have high economic development value. In addition, microalgae cultivation can also be coupled with wastewater treatment and flue gas emission reduction in thermal power plants, thereby exerting important ecological value. Therefore, the development of microalgae resources has both huge economic benefits and ecological significance.

[0003] Currently, except for a very small number of microalgae that can be cultivated on a large scale through heterotrophic fermentation, most microalgae can only be produced on a large scale by open raceway pools or closed reactors, relying on autotrophy or mixotrophy. For heterotrophic fermentation systems, protozoa pose less threat to microalgae; while for microalgae cultivation systems relying on raceway pools or photobioreactors, in order to achieve stable and efficient production of microalgae, the problem of protozoa invasion must be overcome.

[0004] There is an extensive predation-prey relationship between protozoa such as ciliates, amoebas and sunworms and microalgae. Taking ciliates as an example, they can prey on tens of thousands of microalgae cells every day and reproduce very quickly (one generation takes only 2-3 hours); therefore, the number of ciliates can easily surge in a short period of time. After the outbreak, ciliates will prey on microalgae in large quantities, causing a sharp drop in microalgae biomass. In addition, ciliates can also induce a large number of microalgae cells to adhere and aggregate, thereby greatly reducing the light transmittance of the photobioreactor and causing the formation of difficult-to-remove biofilms in the runway pool; not only will it weaken the photosynthesis efficiency of microalgae, but it can also cause long-term and persistent damage to microalgae culture. Therefore, solving the problem of protozoan invasion is of great significance to promoting the development of the microalgae industry.

[0005] The existing large-scale production system of microalgae lacks effective protozoa control methods. Physical methods such as small-pore (10–20 mm) membrane filtration and high-speed centrifugation can only be used at the laboratory level due to their huge energy consumption; they lack feasibility when faced with tens of thousands of cubic meters of microalgae culture water. Although chemical methods such as adding copper sulfate, alkaloids and traditional Chinese medicine preparations can inhibit the growth of protozoa to a certain extent, they also have many defects such as poor protozoa killing effect, strong inhibitory effect on microalgae, high preparation cost, and residues in microalgae biomass that affect the quality of microalgae. They cannot be promoted and applied in large-scale production of microalgae. Therefore, the development of a safe, efficient and feasible method for the prevention and control of protozoa invasion of microalgae has become a major issue facing the current microalgae industry.

[0006] Antimicrobial peptides are a class of naturally occurring small molecule active peptides that are widely found in animals, plants and microorganisms. They are widely considered to be a promising alternative to antibiotics because they can effectively inhibit the growth and reproduction of bacteria. Enhanced Piscidin 2 (EP2 for short) can destroy the cell membrane of microorganisms and exhibit multiple activities such as antiviral, antifungal and antiparasitic. However, the cost of artificially synthesizing EP2 in batches and adding it to the microalgae production system to inhibit the growth of protozoa is extremely high. By using a genetic transformation system to give microalgae the ability to synthesize EP2, algae species that inhibit the growth of protozoa can be constructed, thereby solving the problem of protozoa invasion in large-scale microalgae production at low cost and effectively. At present, there are no related research reports on improving microalgae germplasm through genetic engineering to solve the problem of protozoa invasion in large-scale microalgae cultivation based on the inhibitory effect of antimicrobial peptides on protozoa. Summary of the invention

[0007] The technical problem to be solved by the present invention is to provide a genetically engineered algae for inhibiting protozoa and improving the efficiency and success rate of large-scale cultivation of microalgae, as well as a construction method and application thereof.

[0008] The technical solution adopted by the present invention to solve the above technical problems is: a genetically engineered algae for inhibiting protozoa, wherein the genetically engineered algae is a triangular shaped algae into which an expression plasmid pPha-T1-eGFP-Linker-EP2 is introduced, and the nucleotide sequence of the expression plasmid pPha-T1-eGFP-Linker-EP2 is shown in SEQ ID NO:7.

[0009] The present invention also provides a method for constructing the above-mentioned genetically engineered algae for inhibiting protozoa, comprising the following steps: Step 1, artificially synthesize the codon-optimized EP2 coding sequence and insert it into the downstream of eGFP in the expression vector to construct the expression plasmid pPha-T1-eGFP-Linker-EP2; Step 2: electro-transform the expression plasmid pPha-T1-eGFP-Linker-EP2 into P. tricornutum, and spread the transformed P. tricornutum cells on f / 2 plate culture medium for culture, screen positive algae strains, and obtain genetically engineered algae that inhibit protozoa.

[0010] Furthermore, step 1 is as follows: (1) Synthesizing a double-stranded nucleotide template: designing double-stranded forward and reverse synthesis primers of EP2 according to the nucleotide coding sequence of EP2 and the flexible linker, wherein the nucleotide sequence of the double-stranded forward synthesis primer of EP2 is as shown in SEQ ID NO:3: 5'-GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCTTCTTCCACCACATCTTCCGCGGTATCGTGCACGTGGGCAAGACGATCCACAAGCTGGTGACCGGCAACCAC-3', and the nucleotide sequence of the double-stranded reverse synthesis primer of EP2 is as shown in SEQ ID NO:4: 5'-GTGGTTGCCGGTCACCAGCTTGTGGATCGTCTTGCCCACGTGCACGATACCGCGGAAGATGTGGTGGAAGAAGGAACCGCCGCCACCGCTACCACCGCCGCC-3'; annealing the double-stranded forward and reverse synthesis primers of EP2 to synthesize a double-stranded nucleotide template; (2) EP2 amplification: EP2 forward and reverse amplification primers were designed based on the linker coding sequence and HindIII restriction endonuclease cleavage site sequence, wherein the nucleotide sequence of the EP2 forward amplification primer is shown in SEQ ID NO:5: 5'-ggtggcggcggttccaagcttGGCGGCGGTGGTAGCGGTGGC-3', and the nucleotide sequence of the EP2 reverse amplification primer is shown in SEQ ID NO:6: 5'-gatagcacgcttctgaagcttTTACCGCTACCACCGCCGCC-3'; PCR amplification was performed using the double-stranded nucleotide encoding (G4S)2-EP2 as a template to obtain the fusion-expressed EP2 amplified fragment; (3) Ligation reaction: pPha-T1-eGFP was digested with HindIII restriction endonuclease, and the digestion product was ligated with the EP2 amplified fragment obtained in step (2) to construct the expression plasmid pPha-T1-eGFP-Linker-EP2, the nucleotide sequence of which is shown in SEQ ID NO:7.

[0011] Furthermore, step 2 is as follows: (1) Transformation of Phaeodactylum triangularis: The expression plasmid pPha-T1-eGFP-Linker-EP2 was transformed into competent cells. After incubation, the cells were spread onto LB solid culture medium. When visible colonies were formed, the colonies were picked up and transferred to LB liquid culture medium for shaking culture. The transformed competent cells were collected to extract the expression plasmid, and then transformed into Phaeodactylum triangularis by electroporation. (2) Screening of positive transformants: The transformed Phaeodactylum tricornutum cells were spread on a solid f / 2 plate medium containing bleomycin and placed under a light intensity of 50-70 µmol photons m −2 s −1 , culture under the conditions of temperature of 20-24°C, screen the positive transformants, and obtain the genetically engineered algae that inhibit protozoa.

[0012] The present invention also provides the use of the above-mentioned genetically engineered algae for inhibiting protozoa in preparing protozoa inhibitors, wherein the protozoa include Euplotes fanningii and Euplotes rabbii.

[0013] Compared with the prior art, the advantages of the present invention are 1. The present invention utilizes the strong inhibitory effect of specific antimicrobial peptides on protozoa, and introduces the antimicrobial peptide coding sequence into microalgae through genetic engineering to make it express the antimicrobial peptide, thereby establishing a microalgae species construction system that is antiprotozoan.

[0014] 2. The improved microalgae germplasm can effectively resist the invasion of protozoa during large-scale cultivation, thereby effectively improving the efficiency and success rate of large-scale cultivation of microalgae. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The results of screening positive transformants of Phaeodactylum tricornutum by using the plate method with the help of antibiotics; Figure 2 It is the sequencing result after the DNA of the transformed algae strain was amplified by the specific primers based on the eGFP coding sequence; Figure 3 Laser confocal images of pPha-T1-eGFP-Linker-EP2 and wild-type strains; Figure 4 The photos are of co-culture of different strains of P. tricornutum with Euplotes fan-shaped and Euplotes rabbii in six-well plates; Figure 5 Photo of Euplotes fanning feeding on Phaeodactylum triangularis; Figure 6 The growth of Euplotes fan-shaped after being fed with different strains of P. triangularis. Figure 7 Photo of Euplotes rafaeli feeding on Phaeodactylum triangularis; Figure 8 This shows the growth of Euplotes laevis after being fed with different strains of Phaeochromis triangularis. DETAILED DESCRIPTION

[0016] The present invention is further described in detail below with reference to the accompanying drawings.

[0017] Microalgae: Phaeodactylum triangularis; basic plasmid: pPha-T1-eGFP; amplification kit: 2×Phanta FlashMaster Mix (Dye Plus) (Vazyme, P520-01); competent cells: DH5α; ligation kit: ClonExpress® II One Step Cloning Kit (Vazyme, C112-02), DNA extraction: 2×CTAB (Coolaber, SL2071), plasmid extraction kit: FastPure Plasmid Mini Kit (Vazyme, DC201-01); Linker type (G4S) 2; microalgae culture medium was according to the literature (Guillard RRL, Ryther JH. Studies of marineplanktonic diatoms: I. Cyclotella nana Hustedt, and Detonula confervacea (Cleve) Gran[J]. Canadian Journal of Microbiology, 1962, 8(2): 229–239) prepared f / 2 medium, in which the amount of agar added to the f / 2 solid plate was 1%; the microalgae culture equipment was: Ningbo Jiangnan Illumination Incubator GXM-508BP; the culture conditions were: light intensity 60 µmol photons m −2 s −1 , temperature 22℃.

[0018] Different genetic transformation methods, different antimicrobial peptides, and different expression systems (intracellular, extracellular, secreted into the environment) of microalgae can all be used to construct the antiprotozoan algae species described in this patent. The following specific examples only list the triangular brown finger algae ( Phaeodactylum tricornutum ) was used as research material, the electroporation method was used, the cytoplasm was used as the expression site of the antimicrobial peptide, pPha-T1-eGFP was used as the basic plasmid, and the antimicrobial peptide EP2 was used as the expression object to construct the antiprotozoan genetically engineered Phaeochromis tricornutum.

[0019] Specific embodiment 1: constructing the expression plasmid pPha-T1-eGFP-Linker-EP2, comprising the following steps: Step 1, synthesis of double-stranded nucleotides encoding (G4S)2-EP2: The amino acid sequence of the EP2 short peptide is as shown in SEQ ID NO: 1: FFHHIFRGIVHVGKTIHKLVTGNH, the coding sequence of the EP2 short peptide is codon optimized to obtain a nucleotide sequence encoding EP2 as shown in SEQ ID NO: 2: 5'-TTCTTCCACCACATCTTCCGCGGTATCGTGCACGTGGGCAAGACGATCCACAAGCTGGTGACCGGCAACCAC-3', and EP2 double-stranded forward and reverse synthesis primers are designed according to the nucleotide coding sequence of EP2 and the nucleotide coding sequence of the flexible linker ((G4S)2), wherein the nucleotide sequence of the EP2 double-stranded forward synthesis primer is as shown in SEQ ID NO: 2. NO:3 is shown: 5'-GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCTTCTTCCACCACATCTTCCGCGGTATCGTGCACGTGGGCAAGACGATCCACAAGCTGGTGACCGGCAACCAC-3', the nucleotide sequence of the EP2 double-stranded reverse synthesis primer is shown in SEQ ID NO:4: 5'-GTGGTTGCCGGTCACCAGCTTGTGGATCGTCTTGCCCACGTGCACGATACCGCGGAAGATGTGGTGGAAGAAGGAACCGCCGCCACCGCTACCACCGCCGCC-3'; the EP2 double-stranded forward and reverse synthesis primers are placed in the same reaction system and annealed to generate a double-stranded nucleotide encoding (G4S)2-EP2.

[0020] Step 2, EP2 amplification: EP2 forward and reverse amplification primers were designed according to the Linker coding sequence and the HindIII restriction endonuclease cleavage site sequence, wherein the nucleotide sequence of the EP2 forward amplification primer is as shown in SEQ ID NO:5: 5'-ggtggcggcggttccaagcttGGCGGCGGTGGTAGCGGTGGC-3', and the nucleotide sequence of the EP2 reverse amplification primer is as shown in SEQ ID NO:6: 5'-gatagcacgcttctgaagcttTTACCGCTACCACCGCCGCC-3'; PCR amplification was performed using the double-stranded nucleotide encoding (G4S)2-EP2 as a template to obtain the fusion-expressed EP2 amplified fragment; The PCR amplification system was as follows: 0.5 μL double-stranded nucleotide, 10 μL 2× PrimeSTAR Max Premix, 0.5 μL each of the forward and reverse amplification primers of the FSP gene, and 8.5 μL ddH2O; The PCR program was as follows: 94°C for 5 min; 94°C for 30 sec, 68°C for 30 sec, 72°C for 1 min, for 35 cycles, and stored at 4°C.

[0021] Verification of PCR amplification products: After amplification, PCR products were separated by agarose gel electrophoresis, followed by gel excision, recovery and sequencing. The sequencing results were consistent with the theoretical coding sequence of EP2.

[0022] Step 3, ligation reaction: pPha-T1-eGFP was digested with HindIII restriction endonuclease, and the digestion product was ligated with the EP2 amplified fragment obtained in step 1, and the reaction was carried out at 37°C for 30 min to construct the expression plasmid pPha-T1-eGFP-Linker-EP2, whose nucleotide sequence is shown in SEQ ID NO:7.

[0023] Specific embodiment 2: constructing an antiprotozoan genetically engineered triangular algae, comprising the following steps: Step 1, transformation of Phaeodactylum triangularis: the expression plasmid pPha-T1-eGFP-Linker-EP2 constructed in the specific example 1 is transformed into competent cells, and after incubation, it is spread on LB solid culture medium, and when visible colonies are formed, the colonies are picked into LB liquid culture medium, and placed in a constant temperature shaking incubator at 37°C to culture the transformed competent cells, collect the transformed competent cells, extract the pPha-T1-eGFP-Linker-EP2 plasmid, and transform it into Phaeodactylum triangularis by electrotransformation method, and the electrotransformation parameters are: 500 V, 25 μF, 400 Ω; Step 2, screening of positive transformants: The transformed P. tricornutum cells were spread on f / 2 plate medium containing 1.0% agar and a bleomycin concentration of 75 μg / mL, and placed under a light intensity of 60 μmol photons m −2 s −1 , cultured at 22°C. After about 3 weeks, the successfully transformed strains formed algal colonies on the f / 2 plate. Figure 1 Visible algae were picked and cultured in liquid f / 2 medium with a bleomycin concentration of 75 μg / mL for 1 week to obtain the algal liquid of P. triangularis, and the DNA of the algal liquid was extracted as an identification template; Step 3, identification of positive transformants: design identification primers based on the eGFP coding sequence, wherein the nucleotide sequence of the eGFP coding sequence forward identification primer is shown in SEQ ID NO: 8: 5'-GACGACGGCAACTACAAGAC-3', and the nucleotide sequence of the eGFP coding sequence reverse identification primer is shown in SEQ ID NO: 9: 5'-CGAACTCCAGCAGGACCAT-3'; The PCR amplification system was as follows: 0.5 μL of Phaeodactylum triangularis DNA, 10 μL of 2×Phanta Flash Master Mix, 0.5 μL each of the forward and reverse identification primers of the eGFP coding sequence, and 8.5 μL of ddH2O; The PCR amplification program was as follows: 94°C for 5 min; 94°C for 30 sec, 58°C for 30 sec, and 72°C for 1 min, for 35 cycles, and stored at 4°C. The PCR products were separated by agarose gel electrophoresis and then sequenced.

[0024] The results are as follows Figure 2 As shown, the Sanger sequencing results showed that the amplified fragment originated from the eGFP coding region of the plasmid.

[0025] Specific example three: Verification of positive transformants of Phaeodactylum triangularis.

[0026] Each strain of P. triangularis was cultured to the logarithmic growth phase (cell density was about 5×10 6 cells / mL), and the transformation results were verified at the DNA level and protein level respectively.

[0027] 1. DNA level verification: The identification primers were designed based on the expression plasmid pPha-T1-eGFP-Linker-EP2 sequence, wherein the nucleotide sequence of the expression plasmid forward identification primer is shown in SEQ ID NO: 10: 5'-GACCACTACCAGCAGAACA-3', and the nucleotide sequence of the expression plasmid reverse identification primer is shown in SEQ ID NO: 11: 5'-TTATCCAGGTCCAAACAGA-3'; PCR amplification was performed using the genomic DNA of Phaeodactylum tricornutum as a template; The PCR amplification system was as follows: 0.5 μL of P. tricornutum genomic DNA, 10 μL of 2×Phanta Flash MasterMix, 0.5 μL of each of the forward and reverse identification primers of the expression plasmid, and 8.5 μL of ddH2O; The PCR amplification program was: 94℃ 5 min; 94℃ 30 sec, 58℃ 30 sec, 72℃ 1 min, 35 cycles, stored at 4℃, and the PCR products were separated by agarose gel electrophoresis and sequenced. The Sanger sequencing results were consistent with the theoretical sequence of the pPha-T1-eGFP-Linker-EP2 plasmid, indicating that the pPha-T1-eGFP-Linker-EP2 plasmid had been successfully integrated into P. tricornutum.

[0028] 2. Protein level verification: Using a laser confocal microscope, the position and intensity of the eGFP signal of each strain of Phaeodactylum triangularis cells were detected and compared under the conditions of excitation and emission wavelengths of 488 nm and 507 nm respectively. Figure 3 As shown, the green fluorescent eGFP signal of the Phaeochromis tricornutum strain transformed with the expression plasmid pPha-T1-eGFP-Linker-EP2 was localized in the cytoplasm; no eGFP signal was observed in the wild-type strain cells.

[0029] Specific example 4: Verification of the protozoa inhibition effect based on the positive transformant strain of Phaeodactylum tricornutum.

[0030] After the positive transformants of P. triangularis, wild strains (negative control 1), and pPha-T1-eGFP transformants (negative control 2) were cultured to the exponential phase, 300 mL of algae solution was added to each well of a 6-well plate. The cell density of each well was OD 750 =0.2); then a certain amount of Euplotes vannus and Euplotes raikovi were added to the algae solution to verify the inhibitory effect of the positive transformed strains of P. triangularis on protozoa.

[0031] 1. Inhibitory effect of Euplotes fan-shaped: 20 Euplotes fan-shaped and 1.7 mL of f / 2 medium were added to each well of a 6-well plate; then, Euplotes fan-shaped and algae liquid of different strains were cultured in a constant temperature incubator under light, such as Figure 4 The culture conditions were as shown, and the light intensity was 60 µmol photons m −2 s −1 , temperature 22℃; Figure 5 It can be seen that there is a clear predator-prey relationship between Euplotes fan-shaped and P. triangularis.

[0032] During the co-culture of Euplotes fan-shaped and various strains of P. triangularis, the proliferation of Euplotes fan-shaped in different strains of microalgae was monitored daily using a stereo microscope for 5 consecutive days. Figure 6 As shown, after 5 days of feeding with the pPha-T1-eGFP-Linker-EP2 transformant, the number of cells of the fan-shaped Euplotes was less than 30 cells / well; while after 5 days of feeding with the wild strain (negative control 1) and the pPha-T1-eGFP transformant (negative control 2), the number of fan-shaped Euplotes reached about 120 cells / well, which was much higher than that of the pPha-T1-eGFP-Linker-EP2 transformant. It can be seen that the genetically engineered triangular shaped algae constructed in the specific embodiment 2 showed a significant inhibitory effect on the fan-shaped Euplotes.

[0033] 2. Inhibitory effect of Euplotes rabbii: 20 Euplotes rabbii and 1.7 mL of f / 2 medium were added to each well of a 6-well plate. Subsequently, Euplotes rabbii and algae solutions of different strains were placed in a constant temperature incubator with a light intensity of 60 µmol photons m −2 s −1 , temperature 22℃. Figure 7 It can be seen that there is a clear predator-prey relationship between Euplotes lagerstroemia and P. tricornutum.

[0034] During the 5 days of co-culture of Euplotes lagenaria and various strains of P. tricornutum, the proliferation of Euplotes lagenaria was monitored daily using a stereo microscope. Figure 8 As shown, after 5 days of feeding with the pPha-T1-eGFP-Linker-EP2 transformant, the number of cells of Lacropsis rapa was only 21 cells / well; after 5 days of feeding with the wild strain (negative control 1) and the pPha-T1-eGFP transformant (negative control 2), the number of Lacropsis rapa reached 182 cells / well and 176 cells / well, respectively, which were several times that of the treatment group fed with the pPha-T1-eGFP-Linker-EP2 transformant. It can be seen that the genetically engineered triangular algae constructed in the specific embodiment 2 showed a significant inhibitory effect on Lacropsis rapa.

[0035] The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by a person skilled in the art within the spirit and scope of the present invention shall also fall within the protection scope of the present invention.

Claims

1. A genetically engineered algae for inhibiting protozoa, characterized in that: The genetically engineered algae is a triangular shaped algae into which the expression plasmid pPha-T1-eGFP-Linker-EP2 is introduced. The nucleotide sequence of the expression plasmid pPha-T1-eGFP-Linker-EP2 is shown in SEQ ID NO:

7.

2. A method for constructing a genetically engineered algae for inhibiting protozoa according to claim 1, characterized in that The following steps are involved: Step 1, artificially synthesize the codon-optimized EP2 coding sequence and insert it into the downstream of eGFP in the expression vector to form the expression plasmid pPha-T1-eGFP-Linker-EP2; Step 2: electro-transform the expression plasmid pPha-T1-eGFP-Linker-EP2 into P. tricornutum, and spread the transformed P. tricornutum cells on f / 2 plate culture medium for culture, screen positive algae strains, and obtain genetically engineered algae that inhibit protozoa.

3. The method for constructing a genetically engineered algae for inhibiting protozoa according to claim 2, characterized in that Step 1 is as follows: (1) Synthesizing a double-stranded nucleotide template: designing double-stranded forward and reverse synthesis primers of EP2 according to the nucleotide coding sequence of EP2 and the flexible linker, wherein the nucleotide sequence of the double-stranded forward synthesis primer of EP2 is as shown in SEQ ID NO:3: 5'-GGCGGCGGTGGTAGCGGTGGCGGCGGTTCCTTCTTCCACCACATCTTCCGCGGTATCGTGCACGTGGGCAAGACGATCCACAAGCTGGTGACCGGCAACCAC-3', and the nucleotide sequence of the double-stranded reverse synthesis primer of EP2 is as shown in SEQ ID NO:4: 5'-GTGGTTGCCGGTCACCAGCTTGTGGATCGTCTTGCCCACGTGCACGATACCGCGGAAGATGTGGTGGAAGAAGGAACCGCCGCCACCGCTACCACCGCCGCC-3'; annealing the double-stranded forward and reverse synthesis primers of EP2 to synthesize a double-stranded nucleotide template; (2) EP2 amplification: EP2 forward and reverse amplification primers were designed based on the linker coding sequence and HindIII restriction endonuclease cleavage site sequence, wherein the nucleotide sequence of the EP2 forward amplification primer is shown in SEQ ID NO:5: 5'-ggtggcggcggttccaagcttGGCGGCGGTGGTAGCGGTGGC-3', and the nucleotide sequence of the EP2 reverse amplification primer is shown in SEQ ID NO:6: 5'-gatagcacgcttctgaagcttTTACCGCTACCACCGCCGCC-3'; PCR amplification was performed using the double-stranded nucleotide encoding (G4S)2-EP2 as a template to obtain the fusion-expressed EP2 amplified fragment; (3) Ligation reaction: pPha-T1-eGFP was digested with HindIII restriction endonuclease, and the digestion product was ligated with the EP2 amplified fragment obtained in step (2) to construct the expression plasmid pPha-T1-eGFP-Linker-EP2, the nucleotide sequence of which is shown in SEQ ID NO:

7.

4. The method for constructing a genetically engineered algae for inhibiting protozoa according to claim 2, characterized in that Step 2 is as follows: (1) Transformation of Phaeodactylum triangularis: The expression plasmid pPha-T1-eGFP-Linker-EP2 was transformed into competent cells. After incubation, the cells were spread onto LB solid culture medium. When visible colonies were formed, the colonies were picked up and transferred to LB liquid culture medium for shaking culture. The transformed competent cells were collected to extract the expression plasmid, and then transformed into Phaeodactylum triangularis by electroporation. (2) Screening of positive transformants: The transformed P. tricornutum cells were spread on a solid f / 2 plate medium containing bleomycin and placed under a light intensity of 50-70 µmol photons m −2 s −1 , culture under the conditions of temperature of 20-24°C, screen the positive transformants, and obtain the genetically engineered algae that inhibit protozoa.

5. Use of the genetically engineered algae for inhibiting protozoa according to claim 1 in preparing a protozoa inhibitor, characterized in that: The protozoa include Euplotes fan-shaped and Euplotes rabbii.

Images