STS marker related to lateral root length and drought resistance of wheat and application of STS marker

Abstract

The invention belongs to the technical field of biology, and discloses a wheat lateral root length and drought resistance related STS marker and application thereof. The invention provides an application of an InDel molecular marker, the InDel molecular marker is a DNA fragment from the 84th site to the 103rd site of which the nucleotide sequence is SEQ ID NO: 1, the application is to identify or assist in identifying the lateral root length and / or drought resistance of wheat, and the InDel molecular marker can be used for wheat breeding. The STS molecular marker provided by the invention can provide a strong selection site, improve the accuracy of selection of breeding materials with lateral root length and drought resistance related traits, and realize the target of molecular marker-assisted selection of excellent wheat varieties.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to STS markers related to wheat lateral root length and drought resistance and applications thereof. Background Art

[0002] The root system is the core organ for wheat to absorb soil moisture, and it is also the first organ to sense soil drought. The wheat root system includes seed roots and adventitious roots, but regardless of the type of roots, the lateral roots produced are collectively called lateral roots. Lateral roots can provide additional support for the plant body, expand the ability to absorb soil water resources, increase soil consolidation and soil and water conservation capacity, improve soil permeability and oxygen supply, and improve drought adaptability. They are important tissues that are expected to be improved in drought-resistant breeding. However, lateral roots are dense and deeply hidden in the soil, making it difficult to directly select them through naked eye observation. The rapid development of molecular marker technology has provided a new opportunity for the efficient selection of lateral roots. Therefore, it is an urgent need for the sustainable development of wheat production to discover and utilize molecular markers related to lateral root traits and accelerate lateral root improvement through molecular marker-assisted selection. Summary of the invention

[0003] The technical problem to be solved by the invention is how to quickly identify the lateral root length and drought resistance of wheat.

[0004] To solve the above problems, the present invention first provides an application of an InDel molecular marker, wherein the InDel molecular marker is a DNA fragment having a nucleotide sequence of positions 84 to 103 of SEQ ID No: 1, and the application is the application of the InDel molecular marker in any of the following:

[0005] A1) Identify or assist in identifying the length of wheat lateral roots;

[0006] A2) preparing a product for identifying or assisting in identifying the length of wheat lateral roots;

[0007] A3) Identify or assist in identifying drought resistance of wheat;

[0008] A4) preparing products for identifying or assisting in identifying drought resistance of wheat;

[0009] A5) Wheat breeding;

[0010] A6) Preparation of wheat breeding products.

[0011] The present invention also provides an application of a substance for detecting an InDel molecular marker, wherein the InDel molecular marker is a DNA fragment having a nucleotide sequence of positions 84 to 103 of SEQ ID No: 1, and the application is an application of the substance in any of the following:

[0012] B1) Identify or assist in identifying the length of wheat lateral roots;

[0013] B2) preparing products for identifying or assisting in identifying the length of wheat lateral roots;

[0014] B3) Identify or assist in identifying drought resistance of wheat;

[0015] B4) preparing products for identifying or assisting in identifying drought resistance of wheat;

[0016] B5) Wheat breeding;

[0017] B6) Preparation of wheat breeding products.

[0018] In the above, the wheat breeding index may include wheat lateral root length, and may also include wheat drought resistance.

[0019] In the above, the wheat lateral root length may be the total lateral root length of wheat; and the wheat drought resistance may be the wheat drought resistance index.

[0020] Furthermore, in the application, the purpose of wheat breeding may include cultivating wheat with a changed total lateral root length (the total lateral root length is greater than that of the parent or the total lateral root length is less than that of the parent); it may also include cultivating wheat with a better drought resistance index than that of the parent.

[0021] In this application, parents refer to two different varieties or lines of plants used for hybridization, such as wheat.

[0022] In the above application, the substance contains PCR primers for amplifying wheat genomic DNA fragments including the InDel molecular marker.

[0023] The PCR primers are a primer pair, which consists of a forward primer and a reverse primer. The forward primer is a single-stranded DNA that specifically binds to the upstream of the 84th position of the double-stranded DNA shown in SEQ ID No: 1 in the wheat genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the 103rd position of the double-stranded DNA shown in SEQ ID No: 1 in the wheat genomic DNA.

[0024] The forward primer may be a single-stranded DNA having a nucleotide sequence of SEQ ID No: 2, and the reverse primer may be a single-stranded DNA having a nucleotide sequence of SEQ ID No: 3.

[0025] In the above application, the substance can be a substance for detecting the InDel molecular marker by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, the SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein DNA binding reaction, and a chip based on fluorescent molecule DNA binding reaction.

[0026] In the above application, the PCR primer may be labeled or not labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Markers include, but are not limited to, dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The marker can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, weight determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The marker can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence containing the marker is detectable. In some embodiments, the nucleic acid is directly detected (e.g., directly reading the sequence) without a marker.

[0027] The present invention also provides a method for identifying the lateral root length and / or drought resistance of wheat, comprising taking the genomic DNA of the wheat to be identified as a template, performing PCR amplification with the above-mentioned specific primers to obtain a PCR product, and identifying the lateral root length and / or drought resistance of the wheat according to whether the PCR product contains the InDel molecular marker.

[0028] The present invention also provides a method for assisting in identifying the lateral root length and / or drought resistance of wheat, comprising using the genomic DNA of the wheat to be identified as a template, performing PCR amplification with the above-mentioned specific primers to obtain a PCR product, and identifying the lateral root length and / or drought resistance of the wheat according to whether the PCR product contains the InDel molecular marker.

[0029] In the above method, the lateral root length and / or drought resistance of wheat is identified based on whether the PCR product contains the InDel molecular marker. Specifically, the lateral root length and / or drought resistance of the wheat to be identified containing the InDel molecular marker is higher than the lateral root length and / or drought resistance of the wheat to be identified not containing the InDel molecular marker.

[0030] In the above method, the wheat may be an inbred line or a pure line of wheat, or the wheat may be a hybrid offspring (such as F2 generation or its subsequent generations, such as BC1F1 or its subsequent generations) obtained by hybridizing at least two of the following wheats: Fuzhuang 30, Handan 6172, Handan 6050, Heng 216, Heng 4399, Heng 5229, Luohan 2, Luohan 6, Luohan 7, Shaanxi He 6, Bainong 160, Boai 7023, Hengmai 2, Luomai 9, Luoyou 7, Yumai 29, Yumai 2, Yumai 38, Yumai 48, and Lumai 14.

[0031] The wheat may be a hybrid offspring of Lumai 14×Shaanhe 6, such as BC1F1, BC2F1, BC3F1, BC3F2, BC3F3, BC3F4 or BC3F5. In the hybrid combination of Lumai 14×Shaanhe 6, Lumai 14 is the female parent and Shaanhe 6 is the male parent.

[0032] The present invention also provides a DNA molecule, which is the above-mentioned InDel molecular marker.

[0033] The present invention also provides a specific primer for identifying or assisting in identifying the lateral root length and / or drought resistance of wheat. The specific primer consists of a forward primer and a reverse primer. The forward primer is a single-stranded DNA that specifically binds to the upstream of the 84th position of the double-stranded DNA shown in SEQ ID No: 1 in the wheat genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the 103rd position of the double-stranded DNA shown in SEQ ID No: 1 in the wheat genomic DNA.

[0034] The forward primer is a single-stranded DNA whose nucleotide sequence may be SEQ ID NO: 2, and the reverse primer is a single-stranded DNA whose nucleotide sequence may be SEQ ID NO: 3.

[0035] The present invention also provides a kit for identifying or assisting in identifying the lateral root length and / or drought resistance of wheat, wherein the kit contains the above-mentioned PCR primers.

[0036] The experiments of the present invention prove that the STS marker located on wheat chromosome 3B developed based on InDel (insertion / deletion) variation (PCR primers for amplifying wheat genomic DNA fragments including the InDel molecular marker) can accurately type allele variation related to lateral root length and / or drought resistance, and predict lateral root length and / or drought resistance of wheat. The use of molecular marker-assisted selection breeding technology can effectively avoid the influence of environmental factors and human errors on phenotypic identification. The STS molecular marker of the present invention can provide a strong selection signal, improve the accuracy of identifying wheat lateral root length and / or drought resistance, and achieve the goal of molecular marker-assisted selection of lateral root length and / or drought resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is an STS marker gel map related to lateral root length and drought resistance.

[0038] Figure 2 It is the total lateral root length and drought resistance index of Lumai 14 and its near isogenic lines. DETAILED DESCRIPTION

[0039] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0040] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0041] Example 1. Location of InDel loci related to wheat lateral root length and drought resistance and establishment of molecular markers and detection methods

[0042] Hydroponics was used to identify the root phenotype of wheat seedlings. Twenty wheat varieties were used as materials. The seeds were disinfected with 10% sodium hypochlorite solution before sowing. After treatment, they were washed 5 times with distilled water and then placed in a culture dish at 25°C for 24 hours. Then, seeds with good whitening and consistent growth were selected for sowing. The sown hydroponic boxes were placed in an artificial climate chamber for cultivation, with the day and night temperature set at 22°C / 18°C and the light intensity set at 400μmol / m -2 s -1 After the 10th day of cultivation, the hydroponic box was taken out, and the root system was scanned and the root morphology was recorded using the Epson10000XL root scanner, and the total length of the lateral roots was quantified using WinRHIZO software.

[0043] At the Shunyi Experimental Base of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, two treatments were set up: dry land and water land. The dry land was rain-fed, and the water land was irrigated before wintering, during the booting period, and during the flowering period (750m 3 hm -2 ). Four rows of each variety were sown, with a row length of 2m, a row spacing of 30cm, and 40 seeds per row. Conventional field management was carried out, and the plot yield was measured. The drought resistance index was calculated according to the national standard "Technical Specifications for Identification and Evaluation of Wheat Drought Resistance" (GB / T 21127-2007).

[0044] The developed InDel marker was used for PCR amplification and polyacrylamide gel electrophoresis, and the molecular marker 3B_InDel-20bp (corresponding to the DNA fragment of position 84-103 of SEQ ID NO: 1) which was closely linked to the lateral root length and drought resistance of wheat was obtained according to the electrophoresis analysis results. The following STS marker primers were designed, and the primer sequences are shown below:

[0045] Forward primer F: 5'-GAGTTCAGCGTCGGTCAGG-3' (SEQ ID NO: 2),

[0046] Reverse primer R: 5'-GCAGAGATGACGGAGAAAGC-3' (SEQ ID NO: 3).

[0047] The genomic DNA of the wheat variety to be tested extracted as above was used as a template and the forward primer F and reverse primer R were used to carry out PCR reaction.

[0048] The primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. After the primers were synthesized, they were diluted to 100 μM. The reaction mixture system is shown in Table 1 below:

[0049] Table 1 PCR reaction system

[0050] Element Volume (μL) DNA Template (30ng / uL) 0.4 <![CDATA[Primer F(10pmolμl -1 )]]> 0.6 <![CDATA[Primer R(10pmol μl -1 )]]> 0.6 dNTPs(2mM) 4 2×KOD buffer 10 <![CDATA[KOD FX(1Uμl -1 )]]> 0.4 <![CDATA[ddH 2 The]]> 4 Total 20

[0051] The above PCR amplification reaction conditions are as follows: the reaction program is 95°C for 5 min; 95°C for 1 min, 54°C for 1 min, 60°C for 30 s (35 cycles); 68°C for 10 min. The PCR products were detected by electrophoresis on a 4.0% agarose gel. The sequence length of the amplified product was 166 bp (SEQ ID NO: 1), indicating that the allelic variation type was an insertion type (In), and the sequence length of the amplified product was 146 bp (SEQ ID NO: 4), indicating that the allelic variation type was a deletion type (Del) ( Figure 1 ).

[0052] 5'-GAGTTCAGCGTCGGTCAGGAAGACGGCGGCCAGCCGAGGCCGGTTCTTTGCCTCTGCAAGATCTACCAGA GCCCGCGATTCCTCAAGTCCGCCTCCAAGAACTCCGCGTCCGCGCGCAAGAGGAAGACGCCGGACGACGGCCCT CGGCTTTCTCCGTCATCTCTGC-3' (SEQ ID NO: 1),

[0053] 5'-GAGTTCAGCGTCGGTCAGGAAGACGGCGGCCAGCCGAGGCCGGTTCTTTGCCTCTGCAAGATCTACCAGA GCCCGCGATTCCTCCGCGTCCGCGCGCAAGAGGAAGACGCCGGACGACGGCCCTCGGCTTTCTCCGTCATCTCT GC-3' (SEQ ID NO: 4).

[0054] Combined with the root system detection results of 20 wheat varieties (Table 2), it can be seen that the average total lateral root length and drought resistance index of the wheat germplasm with the amplification product of sequence 1 are greater than those of the wheat germplasm with the amplification product of sequence 4.

[0055] Table 2 STS marker detection results and corresponding total lateral root length and drought resistance index

[0056]

[0057]

[0058] Therefore, the forward primer F and the reverse primer R can be used to detect the lateral root length and drought resistance of the wheat to be tested. The specific method is as follows:

[0059] A PCR reaction was performed on the wheat to be tested using a forward primer F and a reverse primer R, and the sequence length of the PCR reaction product was detected; the total lateral root length and drought resistance index of the wheat to be tested whose PCR reaction product sequence length was 166 bp (SEQ ID No: 1) were greater than the total lateral root length and drought resistance index of the wheat to be tested whose PCR reaction product sequence length was 146 bp (SEQ ID No: 4).

[0060] Example 2: Method for identifying lateral root length and drought resistance of wheat using specific primer pairs for detecting InDel molecular markers (3B_InDel)

[0061] In this example, the specific primers for detecting the InDel molecular marker (3B_InDel) composed of the forward primer F and the reverse primer R in Example 1 were used to identify the lateral root length and drought resistance of wheat. The specific experimental method is as follows:

[0062] Lumai 14 was used as the female parent and Shaanhe No. 6 was used as the male parent for hybridization to obtain F1 seeds. F1 generation seeds were planted to obtain F1 generation plants, and the F1 generation plants were backcrossed with Lumai 14 to obtain BC1F1 seeds. The BC1F1 plants were self-pollinated for two rounds to obtain BC1F3 seeds. The total lateral root length of 100 BC1F3 seedlings was identified by the above-mentioned hydroponic method. At the same time, leaves of 100 seedlings of the strains (BC1F3-1 to BC1F3-100) were taken, and the genomic DNA of the leaves was used as a template. The forward primer F and the reverse primer R in Example 1 were used as primers. PCR amplification was performed according to the PCR system and PCR amplification reaction conditions of Example 1 to obtain an amplified product. The amplified products were detected by gel electrophoresis, and the PCR products were recovered for sequencing. The sequencing results showed that the amplified products of 47 BC1F1 strains were a DNA fragment with a nucleotide sequence of SEQ ID No: 1 in the sequence list, and its genotype was named insertion type (In); the amplified products of 53 BC1F1 strains were a DNA fragment with a nucleotide sequence of SEQ ID No: 4 in the sequence list, and its genotype was named deletion type (Del).

[0063] BC1F3 seeds were planted at the Shunyi Experimental Base of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. The row length was 2m, the row spacing was 0.3m, and 20 holes were sown at equal intervals in each row, with 3 seeds in each hole. Seedlings were planted during the three-leaf period to ensure a single hole and single seedling. The soil of the experimental site was sandy loam, and irrigation was carried out before wintering, during the jointing period, and during the flowering period. The amount of water each time was 750m 3 ha -1 The other management was the same as the conventional field management. The drought resistance index was calculated based on the national standard "Technical Specifications for Identification and Evaluation of Drought Resistance of Wheat" (GB / T 21127-2007) using Zhongmai 36, a control variety in the drought resistance group of the Huanghuai winter wheat region, as the control variety. The results are shown in Table 3.

[0064] Table 3 Genotype, total lateral root length and drought resistance index of 100 BC1F3 plants

[0065]

[0066]

[0067] SPSS19.0 statistical software was used to process the data, and the experimental results were expressed as mean ± standard deviation. One-way ANOVA test was used to analyze the relationship between the two genotypes of insertion and deletion and the total lateral root length and drought resistance index of wheat. The results are shown in Table 4, indicating that the total lateral root length and drought resistance index of wheat with insertion type were significantly higher than those with deletion type.

[0068] Table 4 Correlation analysis between wheat InDel molecular marker genotype and wheat total lateral root length and drought resistance index

[0069] Genetic Quantity (stock) Total lateral root length Drought resistance index Insertion type 47 <![CDATA[100.7 a ]]> <![CDATA[1.1 a ]]> Deletion type 53 <![CDATA[61.7 b ]]> <![CDATA[0.94 b ]]>

[0070] Note: Different superscript letters indicate significant differences (P<0.01).

[0071] Example 3: Application of STS markers in assisted selection of long lateral roots and drought-resistant wheat germplasm

[0072] Three near-isogenic lines (NIL) of Lumai 14 (recipient parent) were screened from the (Lumai 14×Shaanhe 6)×Lumai 14 (BC3F5) backcross introgression population according to the following method: NIL1 I n、NIL2 I n and NIL3 I n: Use Lumai 14 as the female parent and Shanhe 6 as the male parent to cross and obtain F1 seeds. Plant F1 seeds to obtain F1 plants, and backcross the F1 plants with Lumai 14 to obtain BC1F1 seeds.

[0073] Plant BC1F1 seeds to obtain BC1F1 generation plants, use the genomic DNA of the leaves of the plants as a template, use the forward primer F and the reverse primer R in Example 1 as primers, and perform PCR amplification according to the PCR system and PCR amplification reaction conditions in Example 1 to obtain an amplified product. The amplified product was detected by gel electrophoresis, and the BC1F1 generation plant with a PCR product of 166 bp was selected for backcrossing with Lumai 14 to obtain BC2F1 seeds.

[0074] Plant BC2F1 seeds to obtain BC2F1 generation plants, use the genomic DNA of the leaves of the plants as a template, use the forward primer F and the reverse primer R in Example 1 as primers, and perform PCR amplification according to the PCR system and PCR amplification reaction conditions of Example 1 to obtain an amplified product. The amplified product was detected by gel electrophoresis, and the BC2F1 generation plant with a PCR product of 166 bp was selected for backcrossing with Lumai 14 to obtain BC3F1 seeds.

[0075] Plant BC3F1 seeds to obtain BC3F1 generation plants, and select BC3F1 generation plants with a PCR product of 166 bp for self-pollination according to the above method to obtain BC3F2 seeds.

[0076] Plant BC3F2 seeds to obtain BC4F2 generation plants, and select BC3F2 generation plants with a PCR product of 166 bp for self-pollination according to the above method to obtain BC3F3 seeds.

[0077] Plant BC3F3 seeds to obtain BC3F3 generation plants, and select BC3F3 generation plants with a PCR product of 166 bp according to the above method for self-pollination to obtain BC3F4 seeds.

[0078] Plant BC3F4 seeds to obtain BC3F4 generation plants. Select BC3F4 generation plants with PCR products of 166 bp for self-pollination according to the above method to obtain BC3F5 seeds. Three near-isogenic line (NIL) materials were obtained: NIL1 In 、NIL2 In and NIL3 In .

[0079] NIL1 In 、NIL2 In and NIL3 In The BC3F5 seeds were planted in Shunyi Experimental Base of Crop Science Institute, Chinese Academy of Agricultural Sciences in 2023-2024. Each material was sown in 4 rows, with a row length of 2m and a row spacing of 0.6m. 20 holes were sown in each row at equal intervals, with 3 seeds in each hole. Seedlings were planted during the three-leaf period to ensure a single seedling per hole. Three replicates were used in a randomized block design. Irrigation was performed before wintering, during the jointing period, and during the flowering period, with an irrigation volume of 750m3 each time. 3 ha -1 , other management is the same as conventional field management, and the plot yield is measured after maturity. Using the forward primer F and reverse primer R in Example 1 as primers, PCR amplification is performed according to the PCR system and PCR amplification reaction conditions in Example 1 to obtain an amplified product. The amplified product is detected by gel electrophoresis, and the PCR product is recovered and sequenced. The sequencing results show that NIL1 In 、NIL2 In and NIL3 In The amplification products of each of the five strains are all DNA fragments with the nucleotide sequence of SEQ ID No: 1 in the sequence list, and their genotype is insertion type (In); the amplification products of the five strains of Lumai 14 are all DNA fragments with the nucleotide sequence of SEQ ID No: 4 in the sequence list, and their genotype is deletion type (Del).

[0080] The lateral root length of the recipient parent Lumai 14 and three near-isogenic line materials was identified using the same method as in Example 1. The results are as follows: Figure 2 As shown in the figure, it can be seen that there are extremely significant differences in the total lateral root length between Lumai 14 and the three near-isogenic line materials through variance analysis (P<0.01). The total lateral root length and drought resistance index of Lumai 14 with an amplification product sequence length of 146 bp are 52.7 cm and 0.92, while the total lateral root length and drought resistance index of the near-isogenic line material NIL1 with an amplification product sequence length of 166 bp are 52.7 cm and 0.92, respectively. In 、NIL2 In、NIL3 In The total lateral root length and drought resistance index were 67cm, 75cm, 73.7cm and 1.10, 1.14, 1.13 ( Figure 2 ).

[0081] It can be seen that the lateral root length and drought resistance index of wheat containing 3B_InDel-20bp in the genome are significantly higher than those without 3B_InDel-20bp. This shows that the lateral root length and drought resistance index of wheat can be predicted by detecting whether the wheat genome contains 3B_InDel-20bp. Therefore, the lateral root length and drought resistance index of wheat can be quickly and accurately identified by detecting whether the wheat genome contains the 3B_InDel-20bp sequence.

[0082] In wheat breeding for excellent root traits, it is best to select wheat with an insertion genotype containing 3B_InDel-20bp as a parent for breeding.

[0083] The sequence length of the PCR product using the genomic DNA of the parent Lumai 14 as a template was 146 bp, and the sequence length of the PCR product using the genomic DNA of the near-isogenic line material as a template was 166 bp.

[0084] The STS molecular marker of the present invention has clear sequences and primers, and can be directly used in molecular marker-assisted selection breeding through case implementation.

[0085] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

[0086] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Application of InDel molecular markers, characterized in that: The InDel molecular marker is a DNA fragment having a nucleotide sequence of positions 84 to 103 of SEQ ID NO: 1, and the application is the application of the InDel molecular marker in any of the following: A1) Identify or assist in identifying the length of wheat lateral roots; A2) preparing a product for identifying or assisting in identifying the length of wheat lateral roots; A3) Identify or assist in identifying drought resistance of wheat; A4) preparing products for identifying or assisting in identifying drought resistance of wheat; A5) Wheat breeding; A6) Preparation of wheat breeding products.

2. Application of detecting substances labeled with InDel molecules, characterized in that: The InDel molecular marker is a DNA fragment having a nucleotide sequence of positions 84 to 103 of SEQ ID NO: 1, and the application is application of the substance in any of the following: B1) Identify or assist in identifying the length of wheat lateral roots; B2) preparing products for identifying or assisting in identifying the length of wheat lateral roots; B3) Identify or assist in identifying drought resistance of wheat; B4) preparing products for identifying or assisting in identifying drought resistance of wheat; B5) Wheat breeding; B6) Preparation of wheat breeding products.

3. The use according to claim 1, characterized in that: The material contains PCR primers for amplifying a wheat genomic DNA fragment containing the InDel molecular marker.

4. The use according to claim 2, characterized in that: The PCR primers are a primer pair, which consists of a forward primer and a reverse primer. The forward primer is a single-stranded DNA that specifically binds to the upstream of the 84th position of the double-stranded DNA shown in SEQ ID NO: 1 in the wheat genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the 103rd position of the double-stranded DNA shown in SEQ ID No: 1 in the wheat genomic DNA.

5. The use according to claim 4, characterized in that: The forward primer is a single-stranded DNA with a nucleotide sequence of SEQ ID NO: 2, and the reverse primer is a single-stranded DNA with a nucleotide sequence of SEQ ID NO:

3.

6. A method for identifying or assisting in identifying the lateral root length and / or drought resistance of wheat, comprising using the genomic DNA of the wheat to be identified as a template, performing PCR amplification using the PCR primers described in claim 3, 4 or 5 to obtain a PCR product, and identifying the lateral root length and / or drought resistance of the wheat based on whether the PCR product contains the InDel molecular marker described in claim 1.

7. A DNA molecule, characterized in that The DNA molecule is the InDel molecular marker described in claim 1.

8. A specific primer for identifying or assisting in identifying wheat lateral root length and / or drought resistance, characterized in that: The specific primer consists of a forward primer and a reverse primer, wherein the forward primer is a single-stranded DNA that specifically binds to the upstream of the 84th position of the double-stranded DNA shown in SEQ ID No: 1 in the wheat genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the 103rd position of the double-stranded DNA shown in SEQ ID No: 1 in the wheat genomic DNA.

9. The specific primer according to claim 8, characterized in that The forward primer is a single-stranded DNA with a nucleotide sequence of SEQ ID NO: 2, and the reverse primer is a single-stranded DNA with a nucleotide sequence of SEQ ID NO:

3.

10. A kit for identifying or assisting in identifying lateral root length and / or drought resistance of wheat, characterized in that: The kit contains the PCR primers described in claim 3, 4 or 5.

Images