Primer probe composition and kit for rapidly detecting Victoria and Yamagata series influenza B viruses

Abstract

The invention belongs to the technical field of nucleic acid detection, and particularly discloses a primer probe composition and a kit for rapidly detecting Victoria series and Yamagata series influenza B. The primer probe composition comprises a first primer probe group for detecting a Yamagata series influenza B virus HA gene, a second primer probe group for detecting a Yamagata series influenza B virus HA gene and a third primer probe group for detecting a Yamagata series influenza B virus HA gene, and the second primer probe group is used for detecting the HA gene of the Victoria series influenza B virus. The kit comprises the primer probe composition and an enzyme mixed solution, and specifically comprises an RNA enzyme inhibitor, DNA polymerase and reverse transcriptase. By adopting the primer probe composition and the kit disclosed by the invention, Victoria series and Yamagata series influenza B viruses can be rapidly detected, and meanwhile, compared with other compositions, the primer probe composition and the kit have the advantages that the detection rate is higher, and the detection is more accurate.

Description

Technical Field

[0001] The invention relates to the technical field of nucleic acid detection, and in particular to a primer-probe combination and a kit for rapidly detecting Victoria and Yamagata influenza B viruses. Background Art

[0002] Influenza is an acute respiratory infectious disease caused by influenza virus, and its main mode of transmission is airborne droplets. According to the difference in nucleoprotein antigenicity, influenza virus is divided into type A, type B, type C and type D. Influenza B virus is a single-stranded RNA virus belonging to the family of Orthomyxoviridae. It is divided into Victoria and Yamagata strains according to the differences in antigenicity and gene specificity. It is the pathogen of influenza B, which is characterized by rapid onset, chills and fever. The body temperature rises to a peak of 39-40℃ or even higher within a few hours to 24 hours; accompanied by headache, body aches, fatigue, and loss of appetite; respiratory symptoms are mild, dry throat and sore throat, dry cough, and diarrhea may occur; facial flushing, conjunctival hyperemia, pharyngeal hyperemia, and follicles on the soft palate.

[0003] Influenza B virus is an enveloped single-stranded negative-sense RNA virus. The virus particles are spherical, filamentous or pleomorphic, and are structurally divided into three layers. The outermost layer is composed of a double layer of lipids and three glycoproteins derived from the virus host cell: hemagglutinin (HA), neuraminidase (NA) and matrix protein 2 (M2); the middle layer is a spherical protein shell formed by matrix protein 1 (M1); the core is a nucleocapsid composed of nucleoprotein (NP), three polymerase proteins Basic polymerase 1 (PB1), Basic polymerase 2 (PB2) and Acidic protein (PA) and viral RNA. The viral genome consists of 8 segments and encodes a total of 11 proteins.

[0004] There are many methods for detecting influenza B virus, mainly including virus culture, serological detection and molecular biological detection. Among them, virus culture and serological detection are time-consuming, low in sensitivity, high in culture requirements and prone to false negatives. Commonly used molecular biological methods include ordinary PCR, nested PCR, fluorescent quantitative PCR and constant temperature amplification, but most PCR currently uses a universal design method to detect influenza virus and cannot distinguish between strains of influenza B.

[0005] In view of this, the present invention proposes a method and a kit for rapidly detecting Victoria and Yamagata influenza B viruses based on real-time fluorescence PCR technology, which can realize simultaneous detection and differentiation of Victoria and Yamagata influenza B viruses in a single tube, and can meet high sensitivity, and has clear clinical significance and potential application value. Summary of the invention

[0006] The object of the present invention is to provide a probe and primer combination for rapid detection of Victoria and Yamagata influenza B viruses based on fluorescent PCR, and a rapid amplification enzyme reaction system, which can simultaneously detect Victoria-FluB and Yamagata-FluB in the same reaction system within half an hour.

[0007] The objective of the present invention is achieved through the following technical solutions: In a first aspect, the present invention provides a primer-probe combination for rapid detection of Victoria and Yamagata influenza B viruses, comprising at least the following primer-probe groups: A first primer probe set for detecting the HA gene of Yamagata influenza B virus, comprising a first primer pair having sequences as shown in SEQ ID NO.1 and SEQ ID NO.2, and a first probe having a sequence as shown in SEQ ID NO.3; The second primer probe set for detecting Victoria type B influenza virus HA gene comprises a second primer pair with sequences as shown in SEQ ID NO.4 and SEQ ID NO.5, and a second probe with sequence as shown in SEQ ID NO.6.

[0008] As some specific embodiments of the present invention, the primer probe set also includes a third primer probe set for detecting the RNaseP gene, including a third primer pair with sequences as shown in SEQ ID NO.7 and SEQ ID NO.8, and a third probe with a sequence as shown in SEQ ID NO.9.

[0009] The sequences of SEQ ID NO.1-SEQ ID NO.9 are as follows: SEQ ID NO.1: CAACTGYACAGATCTGGAYGT; SEQ ID NO.2: CRGATGTAACAGGTCTGACYTC; SEQ ID NO.3: CAGRCCAATGTGTGTGGGGAYCA; SEQ ID NO.4: GCAAATCTCAAAGGAACAGAAACC; SEQ ID NO.5: ACAGGTCTGRCTTCATGGAGTATTG; SEQ ID NO.6: CAGRCCAAAATGCACRGGGAA; SEQ ID NO.7: AGATTTGGACCTGCGAGCG; SEQ ID NO.8: GAGCGGCTGTCTCCACAAGT; SEQ ID NO.9: TTCTGACCTGAAGGCTCTGCGCG.

[0010] As some specific embodiments of the present invention, the first, second and third probes are respectively provided with a fluorescent group and a quenching group at both ends, wherein the fluorescent group is selected from any one or more of FAM, VIC and CY5; and the quenching group is selected from any one or more of BHQ1 and BHQ2.

[0011] In a second aspect, the present invention provides a kit for rapid detection of Yamagata and Victoria influenza B viruses, comprising the primer-probe combination described in any one of the above items, and also comprising an enzyme mixture and a Victoria / Yamagata-FluB detection solution.

[0012] As some specific embodiments of the present invention, in the primer-probe composition, the concentration of the first primer pair and the first probe of the first primer-probe group, and the second primer pair in the second primer-probe group is 0.1-1 μM; the concentration of the second probe in the second primer-probe group is 0.05-0.5 μM; And / or, the concentration of the third primer pair and the third probe of the third primer probe set is 0.05-0.5 μM.

[0013] As some specific embodiments of the present invention, in step S2, in the primer-probe composition, the 5' end of the first probe is labeled with a fluorescent group FAM; the 5' end of the second probe is labeled with a fluorescent group VIC; and the 5' end of the third probe is labeled with a fluorescent group CY5.

[0014] As some specific embodiments of the present invention, the enzyme mixture includes an RNase inhibitor, a DNA polymerase, and a reverse transcriptase, wherein the DNA polymerase is a fast hot start enzyme, which can shorten the reaction time and improve the amplification efficiency.

[0015] As some specific embodiments of the present invention, the dosage ratio of the RNase inhibitor, DNA polymerase and reverse transcriptase is 0.5-1:1-2:0.5-1; the dosage of the RNase inhibitor is 0.5-1U, the dosage of the DNA polymerase is 1-2U, and the dosage of the reverse transcriptase is 0.5-1U.

[0016] As some specific embodiments of the present invention, the kit further comprises Victoria / Yamagata-FluB detection solution, and the Victoria / Yamagata-FluB detection solution comprises PCR buffer and dNTPs; The concentration of the dNTPs is 0.1-0.4 mM, wherein dATP:dTTP:dCTP:dGTP:dUTP=1:1:1:1:1; The PCR buffer is a Tris-HCl buffer including KCl, MgCl2, and DMSO.

[0017] Specifically, in the PCR buffer, the concentration of KCl is 20-50 mM, the concentration of MgCl2 is 1-6 mM; the volume fraction of DMSO is 5-15%; and the concentration of Tris-HCl is 50-100 mM.

[0018] As some specific embodiments of the present invention, the kit also includes a positive control, a weak positive control and a negative control, the positive control and the weak positive control include Yamagata and Victoria influenza B virus HA target gene fragments, and the negative control includes an RNaseP gene fragment.

[0019] The concentration of the HA target gene of Yamagata and Victoria influenza B viruses in the positive control was 1.0×10 5 -1.0×10 7 copies / mL, and the concentration of the HA target gene of Yamagata and Victoria influenza B viruses in the weak positive control was 1.0×10 3 -1.0×10 5 copies / mL; the Yamagata and Victoria influenza B virus HA target gene fragments correspond to the first and second primer probe sets, respectively.

[0020] As some specific embodiments of the present invention, the HA target gene fragment sequence of the Yamagata influenza B virus is shown in SEQ ID NO.10; And / or, the HA target gene fragment sequence of the Victoria influenza B virus is shown in SEQ ID NO.11; And / or, the RNaseP gene fragment sequence is shown as SEQ ID NO.12.

[0021] The above-mentioned HA target gene fragment and RNaseP gene fragment are both artificially synthesized genes.

[0022] As some specific embodiments of the present invention, the method for rapid detection of Yamagata and Victoria influenza B viruses using the kit comprises the following steps: S1. Extract sample nucleic acid; S2, constructing a PCR amplification reaction system using a kit for the extracted sample nucleic acid, and performing multiplex fluorescence quantitative PCR amplification; S3. Interpret the sample results based on the fluorescence amplification signals and Ct values ​​of different channels.

[0023] As some specific embodiments of the present invention, in step S1, the sample nucleic acid is extracted using a nucleic acid extraction or purification reagent viral nucleic acid rapid extraction kit to prepare the sample nucleic acid RNA.

[0024] As some specific embodiments of the present invention, in step S2, the total volume of the PCR amplification reaction system is 20 to 50 μL.

[0025] As some specific embodiments of the present invention, in step S2, the reaction procedure for performing fluorescent quantitative PCR amplification includes: 50°C for 2 min; 95°C for 10 s; 95°C for 1 s, 58°C for 10 s, for a total of 42 to 44 cycles.

[0026] As some specific embodiments of the present invention, in step S3, the result interpretation method is: When the negative control test result is negative and the positive control and weak positive control test results are positive, and the FAM channel Ct value is ≤41 and the VIC channel Ct value is >42, it is judged as Yamagata-FluB positive; When the negative control test result is negative and the positive control and weak positive control test results are positive, and the Ct value of the FAM channel is >41 and the Ct value of the VIC channel is ≤42, it is judged as Victoria-FluB positive; When the negative control test was negative and the positive control and weak positive control test were positive, and the Ct value of the FAM channel was ≤41 and the Ct value of the VIC channel was ≤42, it was determined to be positive for Yamagata-FluB and Victoria-FluB; When the negative control tested negative and the positive control and weak positive control tested positive, and the Ct value of the FAM channel was >41, the Ct value of the VIC channel was >42, and the Ct value of the CY5 channel was ≤37, it was determined to be negative for Yamagata-FluB and Victoria-FluB.

[0027] The present invention designs specific primers and molecular beacons or Taqman probes based on the specificity of the HA gene of Victoria and Yamagata influenza B viruses, and uses real-time fluorescence PCR technology to identify Victoria-FluB and Yamagata-FluB based on different fluorescent labeling channels. At the same time, the present invention sets an internal standard, which is human ribonuclease P (RNaseP), which can effectively avoid false negatives in the test results and monitor the collection, transportation and extraction processes of the test samples.

[0028] Compared with the prior art, the present invention has the following beneficial effects: 1) The probe and primer composition and detection method for rapid detection of Victoria and Yamagata influenza B viruses of the present invention adopt multiplex fluorescence quantitative PCR technology, and according to the HA target gene in the conserved region of influenza B virus, specific Taqman probes are designed in the specific regions of Victoria and Yamagata, respectively, so as to specifically distinguish different lineages of influenza B virus.

[0029] 2) The present invention sets an internal standard, which can effectively avoid false negative test results and monitor the collection, transportation and extraction process of the test samples. Through the optimization of the reaction system and amplification program, the detection limit of Victoria and Yamagata influenza B viruses can reach 200 copies / mL, which improves the sensitivity of detection, has no overlap with other pathogens with similar symptoms to influenza B virus, and can complete the detection in half an hour. Therefore, the present invention can quickly and effectively realize the simultaneous detection of Victoria and Yamagata influenza B viruses in a single tube based on the combination of different gene amplification fragments and fluorescent probes and the fluorescent signals generated in different fluorescent channels.

[0030] 3) The present invention is simple to operate and can provide a rapid, highly sensitive and specific identification and diagnosis method for clinical detection of Victoria and Yamagata influenza B viruses. It can also be used for prevention and control of epidemic outbreaks and epidemiological monitoring of influenza B viruses.

[0031] 4) The present invention adopts a mixed enzyme system of RNase inhibitor, DNA polymerase and reverse transcriptase, which can realize the rapid typing detection of influenza B virus Yamagata and Victoria in clinical samples with a concentration of 200 copies / mL within about 30 minutes using the primer probe designed above, greatly shortening the conventional detection time of more than 1 hour.

[0032] 5) The mixed enzyme system and primer-probe combination of the present invention were used to perform fluorescent quantitative PCR on the typing of influenza B virus Yamagata and Victoria. Compared with other primer-probe combinations, the Ct value was lower, which can greatly improve the detection effect of PCR. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings: Figure 1 It is the specificity analysis result figure in Example 5; Figure 2 This is a sensitivity identification result diagram of Victoria influenza B virus in Example 6; Figure 3 This is a graph showing the sensitivity identification results of the Yamagata influenza B virus in Example 6. DETAILED DESCRIPTION

[0034] The present invention is described in detail below in conjunction with specific embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, several variations and improvements may be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0035] Example 1 Design of specific primers and probes The HA gene of Victoria influenza B virus, the HA gene of Yamagata influenza B virus and the RNaseP gene were downloaded from NCBI, and the specific amplification primers or Taqman probes of the above pathogens were designed using Primer Premier 5.0 or Primer 3 software, which were synthesized by Shanghai Shuoying Biotechnology Co., Ltd. The primers and probes used for detection are shown in Table 1: Table 1 Primer and probe sequence information

[0036] Example 2 Sample nucleic acid extraction (1) Clinical sample collection, storage and transportation: Clinical samples include throat swabs, sputum, etc.

[0037] Throat swab: Pass the swab over the root of the tongue, wipe the pharyngeal tonsils on both sides of the person being collected back and forth with a little force at least 3 times, then wipe up and down the posterior pharyngeal wall at least 3 times, immerse the swab head in a tube containing virus preservation solution (isotonic saline solution, tissue culture solution or phosphate buffer solution can also be used), discard the tail, and tighten the tube cap.

[0038] Sputum: Collect the coughed sputum in a 50 mL screw-capped plastic tube or sputum box containing virus preservation solution. Add an equal volume of sputum digestion solution (phosphate buffer containing 1g / L proteinase K) to the sputum sample, shake and mix, let it stand for 5 minutes for digestion, and then extract nucleic acid. The digested sputum sample can be used as a regular swab sample for subsequent processing.

[0039] Samples used for virus isolation and nucleic acid testing should be tested as soon as possible. Samples that can be tested within 24 hours can be stored at 4°C; samples that cannot be tested within 24 hours should be stored at -70°C or below (if -70°C storage conditions are not available, they should be temporarily stored in a -20°C refrigerator). Samples should not be frozen and thawed more than 5 times, otherwise the test results will be affected.

[0040] (2) Nucleic acid extraction: Sample nucleic acid was extracted using the nucleic acid extraction or purification reagent Viral Nucleic Acid Rapid Extraction Kit (Registration Numbers: Sutai Xiebei 20200090, Sutai Xiebei 20200411, Sutai Xiebei 20150182, Sutai Xiebei 20150256) produced by Jiangsu ShuoShi Biotechnology Co., Ltd., or the QIAamp® Viral RNA Mini Kit produced by Qiagen, and nucleic acid extraction was performed according to the instructions.

[0041] Example 3 Amplification and detection of nucleic acid samples using multiplex fluorescence quantitative PCR 1. The sample nucleic acid extracted in Example 2 was tested. The reaction system was 25 μL as an example. The amplification reaction system was prepared according to Table 2: Table 2 Amplification reaction system preparation table

[0042] The Victoria / Yamagata-FluB detection solution includes PCR buffer, dNTPs, primer probes and RNase-free water.

[0043] The PCR buffer is a Tris-HCl buffer including KCl, MgCl2, and DMSO, wherein the concentration of MgCl2 is 3.3 mM, the concentration of KCl is 50 mM, the volume content of DMSO is 10%, and the concentration of Tris-HCl is 50 mM.

[0044] The concentration of dNTPs is 0.2mM, and the ratio of dATP:dTTP: dCTP:dGTP:dUTP in dNTPs is 1:1:1:1:1.

[0045] Among the primer probes, the concentrations of the primer pairs and probes for detecting Yamagata influenza B virus with sequences shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, and the primer pairs for detecting Victoria influenza B virus with sequences shown in SEQ ID NO.4 and SEQ ID NO.5 are all 0.3 μM; the concentration of the probe for detecting Victoria influenza B virus with sequences shown in SEQ ID NO.6 is 0.5 μM; the concentrations of the primer pairs and probes for detecting RNaseP gene fragments with sequences shown in SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.9 are all 0.2 μM. The 5' end of the probe for detecting Yamagata influenza B virus is labeled with the fluorescent group VIC; the 5' end of the probe for detecting Victoria influenza B virus is labeled with the fluorescent group FAM; the 5' end of the probe for detecting RNaseP gene fragment is labeled with the fluorescent group CY5.

[0046] The enzyme mixture includes 1U RNase inhibitor (name: Murine RNase Inhibitor (Glycerol-free); Catalog No.: RL301-01; Source: Nanjing Novozymes Biotech Co., Ltd.), 2U DNA polymerase (name: Taq Pro HS DNA Polymerase; Catalog No.: PN101-01; Source: Nanjing Novozymes Biotech Co., Ltd.), and 1U reverse transcriptase (name: M-MLV (H-) Reverse Transcriptase; Catalog No.: R021-01; Source: Nanjing Novozymes Biotech Co., Ltd.).

[0047] RT-PCR amplification was performed according to the following program: 50°C for 2 min; 95°C for 10 s; 95°C for 1 s, 58°C for 10 s, for 44 cycles.

[0048] 2. The kit also includes a positive control, a weak positive control and a negative control. The positive control and the weak positive control include the HA target gene fragments of the Yamagata and Victoria influenza B viruses, and the negative control includes the RNaseP gene fragment.

[0049] The HA target gene fragment of the Yamagata influenza B virus is derived from MT556921.1Influenza B virus (B / Connecticut / 16 / 2020) segment 4 hemagglutinin (HA) gene, complete cds in the NCBI database, which has the nucleotide sequence shown below (SEQ ID NO.10): GCAAATCTCAAAGGAACAAGGACCAGAGGGAAACTATGCCCGGACTGTCTCAACTGTACAGATCTGGATGTGGCCTTGGGCAGGCCAATGTGTGTGGGGACCACACCTTCTGCTAAAGCTTCAATACTCCATGAGGTCAGACCTGTTACATCCGGGTGCTTTCCTATAATGCACGACAGAACAAAAATCAGACAACTACC; The HA target gene fragment of Victoria influenza B virus is derived from PQ600238.1Influenza B virus (B / Texas / 20 / 2024) segment 4 hemagglutinin (HA) gene, complete cds in the NCBI database, which has the nucleotide sequence shown below (SEQ ID NO.11): CCACTGACAACAACACCCACCAAATCTCATTTTGCAAATCTCAAAGGAACAGAAACCAGGGGGAAACTATGCCCAAAATGCCTAAACTGCACAGATCTAGATGTAGCCTTGGGCAGACCAAAATGCACAGGGAAAATACCCTCTGCAAGGGTTTCAATACTCCATGAAGTCAGACCTGTTACGTCTGGGTGCTTCCCTAT; The RNaseP gene fragment is derived from U77665.1 Human RNaseP protein p30 (RPP30) mRNA, complete cds in the NCBI database, and has the following nucleotide sequence (SEQ ID NO.12): GACTTCAGCATGGCGGTGTTTGCAGATTTGGACCTGCGAGCGGGTTCTGACCTGAAGGCTCTGCGCGGACTTGTGGAGACAGCCGCTCACCTTGGCTATTCAGTTGTTGCTATCAATCATATCGTTGACTTTAAGGAAAAGAAACAGGAAATTGAAAAACCAGTAGCTGTTTCTGAACTCTTCACAACTTTGCCAATTGTACAGGGAAAATCAAGACC.

[0050] Prepare the positive control according to Table 3: Table 3 Positive control preparation table

[0051] TE buffer is 10 mM Tris-HCl buffer containing 1 mM EDTA, and its pH is 8.0.

[0052] Prepare weak positive controls according to Table 4: Table 4 Weak positive control preparation table

[0053] Prepare negative control according to Table 5: Table 5 Negative control preparation table

[0054] The positive control, weak positive control, and negative control were tested in the same manner as the sample nucleic acid.

[0055] Example 4 Results Analysis When the instrument is normal, the negative control test result is negative, and the positive control and weak positive control test results are positive, determine whether the Victoria and Yamagata influenza B viruses to be tested are present in the sample based on the amplification curve and the internal standard amplification. The result interpretation method is shown in Table 6: Table 6 Result interpretation table

[0056] Example 5 Specificity Analysis The method of the present invention is used to treat 1.0×10 5 TCID 50 / mL concentration of adenovirus type 3, adenovirus type 7, cytomegalovirus, enterovirus, human parainfluenza virus type 1, human parainfluenza virus type 2, human parainfluenza virus type 3, measles virus, human coronavirus, human metapneumovirus, mumps virus, respiratory syncytial virus type B, rhinovirus type 1A virus, 1.0×10 6 CFU / mL concentration of Bordetella pertussis, Chlamydia pneumoniae, Mycoplasma pneumoniae, Haemophilus influenzae, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus salivarius, Staphylococcus aureus, Neisseria meningitidis, and non-toxic Mycobacterium tuberculosis, 1.0×10 5 TCID 50 Multiplex fluorescence quantitative PCR amplification analysis was performed on total nucleic acids of influenza A (H7N9), seasonal H1N1, influenza A (H3N2), influenza A (H5N1) and human leukocytes at a concentration of / mL.

[0057] The method of the present invention is used to detect the above-mentioned other pathogens with the same infection site or similar infection symptoms as the Yamagata strain and Victoria strain of influenza B virus, and no typical S-shaped amplification curve (such as Figure 1 As shown), no corresponding pathogens were detected; the positive controls of Yamagata and Victoria strains of influenza B virus were detected, and the S-type amplification curve could be detected normally, indicating that the primer probe and the detection method designed by the present invention have good specificity.

[0058] Example 6 Sensitivity Analysis The second-generation influenza B virus nucleic acid detection reagent national reference products (370052-201801) S1 and S2 and pseudoviruses containing artificially synthesized gene target fragments of Yamagata and Victoria viruses were gradiently diluted in a 10-fold ratio, and multiple fluorescent quantitative PCR amplification was performed according to Example 3 to analyze the minimum detection limit of the detection.

[0059] The sequence of the target fragment of the artificially synthesized gene of the Yamagata virus is shown in SEQ ID NO.10; the sequence of the target fragment of the artificially synthesized gene of the Victoria virus is shown in SEQ ID NO.11; and the sequence of the fragment containing the artificially synthesized RNaseP gene is shown in SEQ ID NO.12.

[0060] When the concentration of the sample is ≥2×10 2 When the number of copies / mL was 2.0, the method of the present invention could detect 100% of the Yamagata strain and Victoria strain of influenza B virus, among which Figure 2 and Figure 3 The detection concentration was 2×10 2PCR amplification patterns of Victoria and Yamagata lines at 2×10 copies / mL; when the detection concentration was less than 2×10 2 When the content of the precipitate was 0.34477 g / mL, the method of the present invention could only partially detect or fail to detect. The test results are shown in Table 7. The sensitivity of the method of the present invention is relatively high.

[0061] Table 7 Minimum detection limit results

[0062] Experimental Example 1 Validation of primer-probe combination For the Yamagata strain and Victoria strain influenza B virus, two sets of primer-probe combinations were set as shown in Table 8 below.

[0063] Table 8 Control primer probe sequence information

[0064] According to the primer probe sets in Table 8 above, the following 4 control experiments were designed: Control 1: Yamagata influenza B virus primer probe set 1 + Victoria influenza B virus set 1, i.e., a primer probe combination including the sequences of SEQ ID NO.13 to SEQ ID NO.15 and SEQ ID NO.19 to SEQ ID NO.21 in Table 8 above; Control 2: Yamagata influenza B virus primer probe set 1 + Victoria influenza B virus set 2, i.e., a primer probe combination as shown in SEQ ID NO.13 to SEQ ID NO.15, SEQ ID NO.22 to SEQ ID NO.24 in Table 8 above; Control 3: Yamagata influenza B virus primer probe set 2 + Victoria influenza B virus set 1, i.e., a primer probe combination as shown in SEQ ID NO.16 to SEQ ID NO.18 and SEQ ID NO.19 to SEQ ID NO.21 in Table 8 above; Control 4: Yamagata influenza B virus primer probe set 2 + Victoria influenza B virus group 2, i.e., a primer probe combination including the sequences shown in SEQ ID NO.16 to SEQ ID NO.18 and SEQ ID NO.22 to SEQ ID NO.24 in Table 8 above.

[0065] The above four groups of controls and the primer-probe combination of Example 1 were all used to detect different samples according to the method of Example 3. The Ct values ​​of the detection results are shown in Table 9 below.

[0066] Table 9 Ct value results of different primer-probe combinations

[0067] From the above test results, it can be seen that the primer-probe combination of Example 1 of the present invention has a Ct value lower than that of other primer-probe combinations when detecting Yamagata and Victoria positive samples, indicating that the detection effect of the primer-probe combination of the present invention is better than that of other primer-probe combinations.

[0068] Test Example 2: Verification of enzyme mixture The enzyme mixture in Example 3 of the present invention includes 1U of RNase inhibitor, 2U of DNA polymerase, and 1U of reverse transcriptase, and the dosage ratio of the three is 1:2:1. The dosage ratio is adjusted to set the following three control schemes: Scheme 1: RNase inhibitor: DNA polymerase: reverse transcriptase = 1:4:2 (the dosage of RNase inhibitor is 1U); Scheme 2: RNase inhibitor: DNA polymerase: reverse transcriptase = 2:4:1 (the dosage of reverse transcriptase is 1U); Scheme 3: RNase inhibitor: DNA polymerase: reverse transcriptase = 1:4:1 (the dosage of RNase inhibitor is 1U).

[0069] Except for adjusting the dosage ratio of the enzyme mixture, the remaining steps are carried out according to Example 3.

[0070] Different samples were tested using Example 3 and the above three groups of control solutions. The test results are shown in Table 10.

[0071] Table 10 Ct value results of different enzyme mixture ratios

[0072] From the above test results, it can be seen that the enzyme mixture ratio scheme of the present invention has a Ct value lower than that of other enzyme mixture ratio schemes when detecting Yamagata and Victoria positive samples, indicating that the detection effect of the enzyme mixture ratio scheme of the present invention is better than that of other enzyme mixture ratio schemes.

[0073] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A primer-probe combination for rapid detection of Victoria and Yamagata influenza B viruses, characterized in that: At least the following primer probe sets are included: A first primer probe set for detecting the HA gene of Yamagata influenza B virus, comprising a first primer pair having sequences as shown in SEQ ID NO.1 and SEQ ID NO.2, and a first probe having a sequence as shown in SEQ ID NO.3; The second primer probe set for detecting Victoria type B influenza virus HA gene comprises a second primer pair with sequences as shown in SEQ ID NO.4 and SEQ ID NO.5, and a second probe with sequence as shown in SEQ ID NO.

6.

2. The primer-probe combination according to claim 1, characterized in that: It also includes a third primer probe set for detecting RNaseP gene, including a third primer pair with sequences as shown in SEQ ID NO.7 and SEQ ID NO.8, and a third probe with a sequence as shown in SEQ ID NO.

9.

3. The primer-probe composition according to claim 2, characterized in that: The first, second and third probes shown have fluorescent groups and quenching groups at both ends, respectively, wherein the fluorescent group is selected from any one or more of FAM, VIC and CY5; the quenching group is selected from any one or more of BHQ1 and BHQ2.

4. A kit for rapid detection of Victoria and Yamagata influenza B viruses, characterized in that: Comprising the primer-probe combination and enzyme mixture as described in any one of claims 1 to 3; The enzyme mixture includes an RNase inhibitor, a DNA polymerase, and a reverse transcriptase.

5. The kit according to claim 4, characterized in that The ratio of RNAse inhibitor, DNA polymerase and reverse transcriptase in the enzyme mixture is 0.5-1:1-2:0.5-1; and / or, in the primer-probe composition, the concentration of the first primer pair and the first probe of the first primer-probe set, and the second primer pair of the second primer-probe set is 0.1-1 μM; The concentration of the second probe in the second primer probe set is 0.05-0.5 μM.

6. The kit according to claim 4, characterized in that Also included is a Victoria / Yamagata-FluB detection solution, wherein the Victoria / Yamagata-FluB detection solution includes a PCR buffer and dNTPs; The concentration of the dNTPs is 0.1-0.4 mM, wherein dATP:dTTP: dCTP:dGTP:dUTP=1:1:1:1:1; The PCR buffer is a Tris-HCl buffer including KCl, MgCl2, and DMSO.

7. The kit according to claim 4, characterized in that The kit also includes a positive control, a weak positive control and a negative control; the positive control and the weak positive control include HA target gene fragments of Yamagata and Victoria influenza B viruses, and the negative control includes an RNaseP gene fragment.

8. The kit according to claim 7, characterized in that The HA target gene fragment sequence of the Yamagata influenza B virus is shown in SEQ ID NO.10; And / or, the HA target gene fragment sequence of the Victoria influenza B virus is shown in SEQ ID NO.11; And / or, the RNaseP gene fragment sequence is shown as SEQ ID NO.

12.

9. The kit according to any one of claims 4 to 8, characterized in that The method for rapid detection of Victoria and Yamagata influenza B viruses using the kit comprises the following steps: S1. Extract sample nucleic acid; S2, constructing a PCR amplification reaction system using a kit for the extracted sample nucleic acid, and performing multiplex fluorescence quantitative PCR amplification; S3. Interpret the sample results based on the fluorescence amplification signals and Ct values ​​of different channels.

10. The kit according to claim 9, characterized in that In step S2, the reaction program for fluorescence quantitative PCR amplification includes: 50°C for 2 min; 95°C for 10 s; 95°C for 1 s, 58°C for 10 s, for 42 to 44 cycles.

Images