Escherichia coli engineering bacterium, and construction method and application thereof

Abstract

The invention provides an escherichia coli engineering bacterium. The engineering bacterium is obtained by knocking out at least one of an nfo gene, a nei gene, a nth gene and an endA gene in a bacterium body. The invention also discloses a preparation method and application of the recombinant protein, and a corresponding method for reducing nuclease residues in the recombinant protein. The recombinant protein is produced by using the escherichia coli with the nuclease gene knocked out, and the recombinant protein with extremely low nuclease pollution can be obtained, so that the generation of nuclease is controlled from the source of enzyme production, and the nuclease pollution is reduced.

Description

Technical Field

[0001] The patent of this invention relates to an engineered Escherichia coli, its construction method and application, and belongs to the field of biotechnology. Background Art

[0002] Metabolism is the basis of life activities and the most important feature of life activities. Many complex and regular material changes and energy changes that constitute metabolism are carried out under the catalysis of enzymes. With the continuous deepening of enzyme science research in the 20th century and the increasing sophistication of protein structure analysis technology, more and more enzymes have been discovered, isolated, and promoted to scientific research or industrial applications. Enzyme engineering has become an important pillar of contemporary bioengineering.

[0003] Although the purpose of using enzyme preparations is different and the purity requirements of enzyme preparations are different, in the fields of life sciences, biomedicine, etc., as tool enzymes, highly purified enzyme preparations are required to avoid interference from other enzymes or proteins. For example, various tool enzymes used in genetic engineering have high purity requirements. Endonucleases cannot contain exonucleases, and vice versa, otherwise the results cannot be judged.

[0004] Therefore, in enzyme preparations, especially in enzyme-mediated reactions involving nucleic acid molecules such as nucleic acid amplification and gene knockout, the detection of nuclease activity in enzyme preparations is one of the important quality controls. Among them, endonuclease activity detection is the most common nuclease activity detection item to ensure that there is no enzyme contamination by cutting or non-specific nucleic acid degradation. In order to reduce nuclease contamination and improve purity and batch consistency, the existing technology mostly starts with purification and separation technology, pursuing the specificity of purification and separation, which undoubtedly increases the cost. Summary of the invention

[0005] The purpose of the present invention is to provide an engineered Escherichia coli bacterium which can be used to express recombinant proteins, and the expressed recombinant proteins have lower endonuclease contamination.

[0006] The technical solution adopted by the present invention is:

[0007] An engineered Escherichia coli bacterium is obtained by knocking out at least one of the nfo gene, the nei gene, the nth gene and the endA gene in the bacterium.

[0008] Preferably, the sequences of the nfo gene, nei gene, nth gene and endA gene are shown as SEQ ID NO.1-4 respectively.

[0009] In the present invention, the nfo gene encodes endonuclease IV; the nei gene encodes endonuclease VIII; the nth gene encodes endonuclease III; and the endA encodes periplasmic endonuclease I.

[0010] Preferably, the gene knockout method is selected from CRISPR / Cas9-mediated gene knockout, suicide plasmid pCVD-mediated gene knockout, Red / ET recombination-mediated gene knockout, type II intron insertion-mediated gene knockout, Cre-LoxP recombination-mediated gene knockout, TALEN gene targeting or RNA interference.

[0011] Preferably, the gene knockout method is CRISPR / Cas9-mediated gene knockout.

[0012] Preferably, the strain of Escherichia coli is selected from the following strains: Rosetta (DE3), BL21 (DE3), Origami (DE3), JM109, HSM174 (DE3), AS1.357, TOP10 or DH5α strain.

[0013] The present invention also discloses the use of the above-mentioned engineered bacteria in expressing recombinant proteins. Preferably, the recombinant protein is an enzyme or a functional fragment thereof. The enzyme of the present invention can be a wild type, a mutant thereof, or a variant such as a fusion of two or more enzymes; or it can be a functional fragment of an enzyme, such as a functional domain. In some embodiments of the present invention, the enzyme is selected from BsaI restriction endonuclease, Taq DNA polymerase, or T4 DNA ligase.

[0014] The present invention also discloses a method for constructing the above-mentioned engineered bacteria. Specifically, a pEcCas plasmid carrying a Cas9 nuclease gene and a RED recombinant protein gene is pre-transformed into an Escherichia coli competent cell, and based on this, a pEcgRNA recombinant plasmid carrying an sgRNA expression element and a homologous arm of a knockout target gene is transformed into a competent cell containing a pEcCas plasmid; subsequently, a monoclonal bacterial cell with successful gene editing is screened; finally, the two tool plasmids pEcCas plasmid and the pEcgRNA recombinant plasmid are induced to be eliminated in the cell, thereby obtaining an Escherichia coli engineered bacterium with a knockout target gene, wherein the target gene refers to one or more of the nfo gene, the nei gene, the nth gene, and the endA gene.

[0015] Preferably, the sequences of the sgRNA expression elements of the nfo gene, nei gene, nth gene, and endA gene are shown as SEQ ID NOs. 42-45, respectively.

[0016] The invention also discloses a method for reducing the residual nuclease in the recombinant protein, which uses an engineered Escherichia coli bacterium in which the endogenous nuclease gene is knocked out to express the recombinant protein.

[0017] Escherichia coli is one of the common recombinant protein expression systems. Studies have reported that it is suitable for a variety of recombinant protein expressions. The expression system is easy to operate and soluble, and its cost is relatively low and easier to mass produce. The present application starts with the enzyme preparation expression system, hoping to control the production of nucleases from the source of enzyme production, thereby reducing the pollution of nucleases. The present invention applies the knockout of nuclease genes in Escherichia coli to the preparation of recombinant proteins with low nuclease residues. Especially applied to enzyme preparations. Candidate nuclease genes are selected in the following ways: after the Rosetta (DE3) strain is fermented, the total protein after the Rosetta (DE3) cell is crushed is subjected to a conventional purification process (including Ni column and DEAE column purification, etc.), and each sample purified by the process is analyzed by spectrum sequencing. After the purification process, there are still more residual nuclease proteins, which are considered to be the main types of nuclease residues that affect the purification of recombinant proteins. These nuclease residues cannot be removed by the purification process, so these nuclease genes are knocked out from the cell source. The genes finally screened include the following endonuclease genes: at least one or more combinations of nfo gene, nei gene, nth gene, and endA gene. By using E. coli with nuclease gene knocked out to produce recombinant proteins, recombinant proteins with extremely low nuclease contamination can be obtained, thereby controlling the production of nucleases from the source of enzyme production and reducing nuclease contamination. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the result of agarose gel electrophoresis identification of the nfo gene knockout strain.

[0019] Figure 2 This is the result of agarose gel electrophoresis identification of the nei gene knockout strain.

[0020] Figure 3 This is the result of agarose gel electrophoresis identification of the nth gene knockout strain.

[0021] Figure 4 This is the result of agarose gel electrophoresis identification of the EndA gene knockout strain.

[0022] Figure 5 These are the results of endonuclease residue detection in BsaI proteins expressed by different gene knockout strains and wild-type strains.

[0023] Figure 6 These are the results of residual endonuclease detection in Taq DNA polymerase (Taq) and T4 DNA ligase (ligase) proteins expressed by different gene knockout strains and wild-type strains, respectively. DETAILED DESCRIPTION

[0024] The specific implementation modes of the present invention are further described below in conjunction with the accompanying drawings, but the description of the embodiments does not impose any limitation on the protection scope of the present invention.

[0025] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by technicians in the technical field to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0026] Unless otherwise specified, the materials and instruments used in the following examples can be obtained from conventional commercial channels.

[0027] In some embodiments of the present invention, in CRISPR / Cas9-mediated gene knockout, the sgRNA expression element used to knock out the endonuclease nfo gene is selected from the following nucleotide sequences:

[0028] TGAAAAATATCACTACACAT(SEQ ID NO:42)

[0029] The sgRNA expression element used to knock out the endonuclease nei gene is selected from the following nucleotide sequences:

[0030] TAAAGCGAAAGATCTCAATG(SEQ ID NO:43)

[0031] The sgRNA expression element used to knock out the endonuclease nth gene is selected from the following nucleotide sequences:

[0032] GACGGCGAAACTCTACCCGG(SEQ ID NO:44)

[0033] The sgRNA expression element used to knock out the periplasmic endonuclease endA gene is selected from the following nucleotide sequences:

[0034] GTTGTTGATCTGCAATCGTG(SEQ ID NO:45)

[0035] Example 1: Knockout of endonuclease gene in Rosetta (DE3) genome

[0036] 1. Primer Design

[0037] The effective sgRNA sequences of nfo, nei, nth and endA genes were predicted by the chopchop website (https: / / chopchop.cbu.uib.no / ), and the ORF sequences of the four genes are shown in SEQ ID NOs: 1-4. The upstream and downstream homologous recombination arm primers, recombinant plasmid construction primer sequences were designed according to the upstream and downstream sequences of the nuclease gene on the Rosetta (DE3) genome, as shown in Table 1.

[0038] Table 1

[0039]

[0040]

[0041] 2. Amplification of targeting sequences and construction of targeting vectors

[0042] The genome of Rosetta (DE3) was extracted using a genome extraction kit as a PCR template, and a high-fidelity DNA polymerase was used to amplify the upstream and downstream homologous recombination arms; the pEcgRNA plasmid was used as a template to amplify the sgRNA expression element and the vector backbone sequence. There were overlapping sequences between the fragments, and then the homologous recombination kit (Yisheng Biotechnology (Shanghai) Co., Ltd., ES10912) was used to connect the "upstream and downstream repair homologous recombination arms" + "sgRNA expression element" + "vector backbone" to obtain the targeting construction vector. DH5α strains (Yisheng Biotechnology (Shanghai) Co., Ltd.) were inoculated, and the extracted plasmids were sequenced correctly, which were the targeting vectors: pEcgRNA-nfo, pEcgRNA-nei, pEcgRNA-nth, and pEcgRNA-endA.

[0043] 3. Preparation of pEcCas competent cells

[0044] 1) Preheat a water bath to 42°C.

[0045] 2) Take out the competent cell EP tube from -80℃ refrigerator and place it on ice to thaw for 5-10 minutes.

[0046] 3) Add 1-10 μL (≥10 ng) of the pEcCas plasmid used for transformation to 100 μL Rosetta (DE3) competent cells and pipette 3-5 times to mix.

[0047] 4) Place in ice bath for 30 minutes.

[0048] 5) Heat in a 42°C water bath for 90 seconds and immediately remove from the ice bath.

[0049] 6) Place in ice bath for 2 to 3 minutes.

[0050] 7) Add 800 μL of sterile LB medium (without antibodies) into the EP tube.

[0051] 8) The EP tube was placed at an angle and fixed in an incubator, and cultured at 37°C with shaking (180-200 rpm) for 1 hour.

[0052] 9) Depending on the bacterial solution concentration, take about 150 μL of the bacterial solution and spread it on LB medium containing Kan antibiotic (50 μg / mL) for overnight culture.

[0053] 10) The next day, a single clone was picked and inoculated into 100 mL LB medium with Kan resistance (50 μg / mL), and 0.2% arabinose was added to induce the expression of RED recombinase on the pEcCas plasmid. After culturing at 37°C and 220 rpm for 2 hours, the bacterial concentration was monitored every 20-30 minutes. When the OD600 value reached about 0.4-0.5 at 37°C and 220 rpm, the culture was stopped and the conical flask was placed on ice for 30 minutes for precooling;

[0054] 11) Pour the bacterial solution into a 50 mL centrifuge tube, centrifuge at 4°C, 4000 rpm for 10 min, discard the supernatant, and collect the bacteria;

[0055] 12) Add 50 mL of pre-cooled ultrapure water to the centrifuge tube, resuspend the cells, centrifuge at 4000 rpm for 10 min at 4°C, discard the supernatant, and wash twice;

[0056] 13) Add 1 mL of 10% glycerol solution to the centrifuge tube to resuspend the cells, and quickly dispense 100 μL / tube into pre-cooled 1.5 mL centrifuge tubes and place on ice for later use.

[0057] 4. Electroporation:

[0058] 1) Clean the electric rotating cup, dry it and pre-cool it on ice;

[0059] 2) Take 100-200 ng of the targeting vectors pEcgRNA-nfo, pEcgRNA-nei, pEcgRNA-nth, and pEcgRNA-endA and add them to the pECcas-Rosetta (DE3) competent cells respectively, and flick to mix;

[0060] 3) Transfer the competent mixture to a pre-cooled electroporation cup, wipe off the moisture on the outer wall, and perform electroporation transformation;

[0061] 4) After the electroporation, quickly add 1 mL of LB medium, mix well with a pipette, and transfer to a 1.5 mL centrifuge tube;

[0062] 5) Resuscitate the cells in a shaking incubator at 37°C and 200 rpm for 1 h, then coat the cells with LB plates containing Kan (50 μg / mL) and SmR (50 μg / mL) dual antibodies.

[0063] 5. Screening and identification of positive clones

[0064] 1) Pick 8 colonies from each plate and place them into 200 μL LB liquid culture medium containing Kan (50 μg / mL) and SmR (50 μg / mL) dual antibodies, and culture at 37°C, 220 rpm shaking for 2 h.

[0065] 2) PCR verification of bacterial solution was performed using upstream and downstream verification primers of each gene (Table 2). The identification results are shown in Figure 1-4 The amplified bands of the knockout strains were all less than those of the original Rosetta (DE3) strain. The knockout-positive strains were named rosetta (DE3)-△nfo, rosetta (DE3)-△nei, rosetta (DE3)-△nth, and rosetta (DE3)-△endA.

[0066] Table 2

[0067]

[0068]

[0069] 6. Plasmid Elimination

[0070] Rhamnose-induced excision of the targeting plasmid and spectinomycin resistance screening and verification

[0071] 1) The strain with successful gene knockout was inoculated into 2 mL of LB medium containing rhamnose (10 mM) and kanamycin (50 μg / mL).

[0072] 2) The culture was shaken at 220 rpm overnight, and then diluted and spread on solid LB medium containing kanamycin (50 μg / mL) and incubated at 37°C overnight.

[0073] 3) Screening was performed on LB culture dishes containing kanamycin (50 μg / mL) and spectinomycin (50 μg / mL). The single clone sensitive to spectinomycin was the strain in which the targeting plasmid was eliminated.

[0074] Screening of pEcCas plasmid-eliminated strains by SacB gene lethality

[0075] 4) Inoculate the bacteria with the target plasmid removed into 4 mL of liquid LB medium containing glucose (5 g / L) and incubate at 37°C with shaking at 220 rpm overnight. Then dilute the bacterial solution (about 10% with PBS) -4The pEcCas plasmid was inoculated on an LB plate containing glucose (5 g / L) and sucrose (100 g / L). Sucrose was added to the culture medium because the pEcCas plasmid contains the SacB gene, which can convert sucrose into fructose when sucrose is present. The accumulation of fructose is toxic to Escherichia coli, causing the cells containing the pEcCas plasmid to die. The cells were incubated at 37°C overnight. A single colony was dipped with an inoculation loop and screened on LB plates with and without kanamycin. The colonies sensitive to kanamycin were all strains that eliminated the pEcCas plasmid.

[0076] Example 2: Expression and purification of BsaI recombinant protein in different strains and detection of endonuclease residues

[0077] 1. Expression of BsaI recombinant protein in different strains

[0078] The pET-BsaI recombinant plasmid (BsaI protein sequence is shown in SEQ ID NO.5) was transformed into Rosetta (DE3) strain and four endonuclease knockout strains (rosetta (DE3)-△nfo, rosetta (DE3)-△nei, rosetta (DE3)-△nth and rosetta (DE3)-△endA), and the positive clones were selected for expansion culture. Each bacterial solution was inoculated into 200mL fresh 2×YT liquid medium at a ratio of 2%, and cultured at 37°C and 220rpm until OD 600 When the value was about 0.8, 0.5 mM IPTG was added and cultured at 37°C and 220 rpm for about 4 h to induce the expression of exogenous proteins and collect the bacterial liquids.

[0079] 2. Bacteria disruption

[0080] After centrifugation at 4°C and 5500rpm for 15min, discard the supernatant; according to the weight of the bacteria, use lysis buffer A (20mM Tris-HCl, 50mM NaCl, 10% Glycerol, pH7.4) to lyse the bacteria. Add 9g of bacteria to 90mL of lysis buffer A, 4°C, and stir magnetically for 60min. Stir with a stirrer until the bacteria are thawed and evenly dispersed in the lysis solution. No lumps of bacteria are observed visually. Add PMSF to 2mM before lysis and perform ultrasonic disruption. The disruption conditions are as follows: 60%, super 3' stop 5', 15min / time*2, ice bath. After the end, centrifuge at 12000g for 30min and take the supernatant.

[0081] 3. Nickel column purification

[0082] The purification procedure and purification buffer are shown in the following table:

[0083]

[0084] Buffer A: 20mM Tris; 800mM NaCl; 10% Glycerol; pH7.6

[0085] Buffer B: 20mM Tris; 500mM NaCl; 0.5M imidazole; 10% Glycerol; pH7.6

[0086] Buffer C: 20mM Tris; 1.5M NaCl; 10% Glycerol; pH7.6

[0087] 4.DEAE Purification

[0088] The purification procedure and purification buffer are shown in the following table:

[0089]

[0090]

[0091] Buffer D: 20mM Tris-HCl, 0.1mM EDTA, 1mM DTT, 10% Glycerol, pH8.0

[0092] Buffer E: 20mM Tris-HCl, 1M NaCl, 0.1mM EDTA, 1mM DTT, 10% Glycerol, pH7.4

[0093] 5. Protein stock solution preparation

[0094] The sample was dialyzed into 2× storage buffer at a ratio of 1:100, dialyzed overnight in a 4°C refrigerator, taken out the next day, added with an equal volume of glycerol, filtered with a 0.22μm filter membrane, and stored at -20°C. The final storage buffer for BsaI protein is: 10mMTris-HCl, 0.2M NaCl, 0.1mM EDTA, 1mM DTT, 50% glycerol, pH 7.4.

[0095] 6. Test for residual endonuclease activity in BsaI recombinant proteins expressed by different strains

[0096] The ΦX174 RFIDNA supercoiled plasmid (NEB) was used as a template and incubated with the BsaI recombinant protein expressed by different strains. The incubation system and reaction conditions are shown in the following table:

[0097]

[0098] After the reaction is completed, add 3μL 6×DNAloading buffer to the system, mix well and then run 1% agarose gel electrophoresis. Observe the plasmid bands. The plasmid gel is generally divided into three bands: supercoiled plasmid, relaxed circular molecule, and linear molecule. Observe the changes in the three bands of the plasmid by running the gel to determine whether there is residual nickase. If the plasmid bands in the test enzyme are consistent with the plasmid bands in the negative control, it means that there is no endonuclease residue; if diffuse bands appear or even the bands are blurred and invisible, the nucleic acid endonuclease residue is serious; if the supercoiled plasmid band becomes weaker (less), and the relaxed or linear bands become brighter (more), it means that there is slight endonuclease residue.

[0099] like Figure 5 As shown, the supercoiled plasmid bands incubated with the recombinant protein expressed by the original rosetta (DE3) strain became weaker and the relaxed or linear bands became brighter, with obvious endonuclease residues. Compared with the original rosetta (DE3) strain, the plasmids incubated with the recombinant proteins expressed by the four strains in which the nuclease was knocked out, rosetta (DE3)-△nfo, rosetta (DE3)-△nei, rosetta (DE3)-△nth, and rosetta (DE3)-△endA, showed significant improvement in the endonuclease residues, among which the two strains in which the nei and endA genes were knocked out had more obvious improvements, and the expressed BasI protein had almost no endonuclease residues.

[0100] Example 3: Expression and purification of Taq DNA polymerase and T4 DNA ligase recombinant proteins in different strains and detection of residual endonucleases

[0101] 1. Expression of Taq DNA polymerase and T4 DNA ligase recombinant proteins in different strains

[0102] The pET-Taq DNA polymerase or pET-T4 DNA ligase recombinant plasmid (the protein sequences of Taq DNA polymerase and T4 DNA ligase are shown in SEQ ID NO.6 and SEQ ID NO.7, respectively) was transformed into Rosetta (DE3) strain and two endonuclease knockout strains (rosetta (DE3)-△nei and rosetta (DE3)-△endA), and the positive clones were selected for expansion and culture. Each bacterial solution was inoculated into 200 mL of fresh 2×YT liquid culture medium at a ratio of 2%, and cultured at 37°C and 220 rpm until OD 600 When the value was about 0.8, 0.5 mM IPTG was added and cultured at 37°C and 220 rpm for about 4 h to induce the expression of exogenous proteins and collect the bacterial cultures.

[0103] 2. Bacteria disruption

[0104] After centrifugation at 4°C and 5500rpm for 15min, discard the supernatant; according to the weight of the bacteria, use lysis buffer A (20mM Tris-HCl, 50mM NaCl, 10% Glycerol, pH7.4) to lyse the bacteria. Add 9g of bacteria to 90mL of lysis buffer A, 4°C, and stir magnetically for 60min. Stir with a stirrer until the bacteria are thawed and evenly dispersed in the lysis solution. No lumps of bacteria are observed visually. Add PMSF to 2mM before lysis and perform ultrasonic disruption. The disruption conditions are as follows: 60%, super 3' stop 5', 15min / time*2, ice bath. After the end, centrifuge at 12000g for 30min and take the supernatant.

[0105] 3. Nickel column purification

[0106] The purification procedure and purification buffer are shown in the following table:

[0107]

[0108] Buffer A: 20mM Tris; 800mM NaCl; 10% Glycerol; pH7.6

[0109] Buffer B: 20mM Tris; 500mM NaCl; 0.5M imidazole; 10% Glycerol; pH7.6

[0110] Buffer C: 20mM Tris; 1.5M NaCl; 10% Glycerol; pH7.6

[0111] 4.DEAE Purification

[0112] The purification procedure and purification buffer are shown in the following table:

[0113]

[0114] Buffer D: 20mM Tris-HCl, 0.1mM EDTA, 1mM DTT, 10% Glycerol, pH8.0

[0115] Buffer E: 20mM Tris-HCl, 1M NaCl, 0.1mM EDTA, 1mM DTT, 10% Glycerol, pH7.4

[0116] 5. Protein stock solution preparation

[0117] The sample was dialyzed into 2× storage buffer at a ratio of 1:100, and dialyzed overnight in a refrigerator at 4°C. The next day, an equal volume of glycerol was added after removal, filtered with a 0.22μm filter membrane, and stored at -20°C. The final storage buffer for Taq DNA polymerase protein is: 20mM Tris-HCl, 100mM KCl, 0.1mM EDTA, 1mM DTT, 0.5% Tween-20; 0.5% NP-40, 60% glycerol. The final storage buffer for T4 DNA ligase protein is: 10mM Tris-HCl, 50mM KCl, 1mM DTT, 0.1mM EDTA, 60% glycerol, pH7.4.

[0118] 6. Test for residual endonuclease activity in Taq DNA polymerase and T4 DNA ligase recombinant proteins expressed by different strains

[0119] ΦX174 RFIDNA supercoiled plasmid (NEB) was used as a template and incubated with Taq DNA polymerase and T4 DNA ligase recombinant proteins expressed by different strains. The incubation system and reaction conditions are shown in the following table:

[0120]

[0121] After the reaction is completed, add 3μL 6×DNAloading buffer to the system, mix well and then run 1% agarose gel electrophoresis. Observe the plasmid bands. The plasmid gel is generally divided into three bands: supercoiled plasmid, relaxed circular molecule, and linear molecule. Observe the changes in the three bands of the plasmid by running the gel to determine whether there is residual nickase. If the plasmid bands in the test enzyme are consistent with the plasmid bands in the negative control, it means that there is no endonuclease residue; if diffuse bands appear or even the bands are blurred and invisible, the nucleic acid endonuclease residue is serious; if the supercoiled plasmid band becomes weaker (less), and the relaxed or linear bands become brighter (more), it means that there is slight endonuclease residue.

Claims

1. A method for reducing residual nuclease in a recombinant protein, characterized in that: The recombinant protein is expressed by using an engineered Escherichia coli bacterium in which the endogenous nuclease gene is knocked out.

2. An engineered Escherichia coli, characterized in that: The engineered bacteria is obtained by knocking out at least one of the nfo gene, the nei gene, the nth gene, and the endA gene in the bacteria.

3. The engineered bacteria according to claim 2, characterized in that The sequences of the nfo gene, nei gene, nth gene and endA gene are shown in SEQ ID NO.1-4 respectively.

4. The engineered bacteria according to claim 2 or 3, characterized in that: The gene knockout method is selected from CRISPR / Cas9-mediated gene knockout, suicide plasmid pCVD-mediated gene knockout, Red / ET recombination-mediated gene knockout, group II intron insertion-mediated gene knockout, Cre-LoxP recombination-mediated gene knockout, TALEN gene targeting or RNA interference methods.

5. The engineered bacteria according to claim 4, characterized in that The gene knockout method is CRISPR / Cas9-mediated gene knockout.

6. The engineered bacteria according to claim 4, characterized in that The strain of Escherichia coli is selected from the following strains: Rosetta (DE3), BL21 (DE3), Origami (DE3), JM109, HSM174 (DE3), AS1.357, TOP10 or DH5α strain.

7. Use of the engineering bacteria according to any one of claims 2 to 6 in expressing recombinant proteins in vitro.

8. The use according to claim 7, characterized in that: The recombinant protein is an enzyme or a functional fragment thereof.

9. The method for constructing an engineering bacterium according to any one of claims 2 to 6, characterized in that: The pEcCas plasmid carrying the Cas9 nuclease gene and the RED recombinant protein gene is pre-transformed into competent E. coli cells, and based on this, the pEcgRNA recombinant plasmid carrying the sgRNA expression element and the homologous arm of the knockout target gene is transformed into competent cells containing the pEcCas plasmid; then, the bacteria with successful gene editing are screened; finally, the pEcCas plasmid and the pEcgRNA recombinant plasmid are induced to be eliminated in the bacteria, thereby obtaining the E. coli engineered bacteria with the knockout target gene; The target gene is selected from one or more of the nfo gene, the nei gene, the nth gene and the endA gene.

10. The method for constructing an engineering bacterium according to claim 9, characterized in that: The sequences of the sgRNA expression elements of the nfo gene, nei gene, nth gene, and endA gene are shown in SEQ ID NOs. 42-45, respectively.

Images