Cow myoblast CDKN1C gene super enhancer and application thereof

Abstract

The invention discloses a cattle myoblast CDKN1C gene super enhancer and application thereof, the super enhancer comprises Enh22, Enh38 and Enh40, the Enh22 is located at the 48802495 to the 48803999 position of the 29 chromosome of a cattle genome, the Enh38 is located at the 48902854 to the 48905629 position of the 29 chromosome of the cattle genome, and the Enh40 is located at the 48920416 to the 48922207 position of the 29 chromosome of the cattle genome. The super enhancer component can be used for improving the gene editing and transgenic breeding efficiency of beef cattle (for example, cutting and repairing of a gene sequence are not needed), and genome mutation (namely molecular genetic markers) related to beef cattle individual dominant characters (for example, large physique and high meat yield) can be conveniently screened, so that the breeding process of an excellent beef cattle group is accelerated.

Description

Technical Field

[0001] The invention relates to a bovine myoblast CDKN1C gene super enhancer and application thereof, and belongs to the field of livestock molecular breeding. Background Art

[0002] The p57Kip2 protein is encoded by the CDKN1C gene and has been identified as the third member of the CIP / Kip family, which also includes p27Kip1 and p21Cip1. Similar to these proteins, p57Kip2 can tightly bind to and inhibit cyclin / cyclin-dependent kinase complexes, thereby regulating the progression of the cell division cycle (Stampone et al., 2018). The CDKN1C gene is a known cell cycle inhibitor and is essential for maintaining the balance between cell proliferation and differentiation. As the expression of differentiation marker genes increases, the expression of the CDKN1C gene also increases, and CDKN1C prepares for differentiation by inhibiting cell proliferation. In muscle development, the CDKN1C gene, as a cell cycle inhibitor, is involved in the inhibition of G1 / S transition, playing a role not only in cell cycle control, but also in the differentiation and proliferation of muscle cells. Its role in muscle tissue seems to be more complex and specific. Osborn et al. (2011) showed that CDKN1C promotes the differentiation of muscle precursor cells through a positive feedback loop with MyoD (Osborn et al., 2011). In skeletal muscle cells, hypomethylation of long-range regulatory elements within the imprinting control region KvDMR1 allows MyoD to bind, while MyoD cannot bind to the CDKN1C promoter, thereby inducing CDKN1C expression (Andresini et al., 2016). In addition, Mademtzoglou et al. (2018) found that CDKN1C is not expressed in quiescent muscle stem cells (MuSCs), but is induced in activated and proliferating myoblasts and remains expressed in differentiated myotubes. Primary myoblasts from CDKN1C-deficient mice exhibit differentiation defects and accelerated proliferation (Mademtzoglou et al., 2018). This highlights the importance of CDKN1C being regulated by muscle development-related transcription factors during muscle cell differentiation, indicating that the activity of CDKN1C is essential for the growth regulation of muscle stem cells. The study of the CDKN1C gene is not limited to model organisms, but has also been explored in cattle. Methylation of KvDMR1 is involved in the regulation of bovine CDKN1C gene imprinting (Wang et al., 2015). In addition, Gao et al. (2021) explored the effect of SMAD2 / SMAD3 binding to CDKN1C on the proliferation of bovine muscle satellite cells and found that SMAD3 overexpression significantly increased the expression of CDKN1C (Gao et al., 2021). These studies reveal the multifaceted functions of CDKN1C in muscle development and emphasize its importance in genetic and epigenetic regulation. CDKN1C is negatively correlated with cell proliferation and aims to regulate the balance between proliferation and differentiation. These results indicate that the CDKN1C gene plays a key role in the proliferation and differentiation of bovine myoblasts.By inhibiting certain stages of the cell cycle, CDKN1C may promote the transformation of myoblasts into mature muscle cells, thereby affecting muscle growth and function. This discovery reveals the molecular mechanism of cattle muscle growth and identifies potential targets for improving cattle breeding and meat quality. Future research on the role of the CDKN1C gene in cattle myoblast proliferation will help to clarify the mechanism of muscle growth regulation and support progress in livestock production and meat quality improvement.

[0003] Super enhancers are important elements for gene expression regulation. They can bind to transcription factors and increase gene transcription frequency by interacting with promoters, thereby promoting target gene expression. Currently, there are no reports on transcriptional regulation of the bovine CDKN1C gene, especially super enhancers with regulatory effects. Summary of the invention

[0004] Purpose of the invention: The purpose of the present invention is to provide a bovine myoblast CDKN1C gene super enhancer and its application.

[0005] Technical solution: The present invention provides a bovine myoblast CDKN1C gene super enhancer, which includes Enh22, Enh38 and Enh40, Enh22 is located at positions 48802495-48803999 of chromosome 29 of the bovine genome, Enh38 is located at positions 48902854-48905629 of chromosome 29 of the bovine genome, and Enh40 is located at positions 48920416-48922207 of chromosome 29 of the bovine genome.

[0006] Furthermore, the nucleotide sequence of Enh22 is shown as SEQ ID NO.1, the nucleotide sequence of Enh38 is shown as SEQ ID NO.2, and the nucleotide sequence of Enh40 is shown as SEQ ID NO.3.

[0007] The present invention also provides primer pairs for amplifying the above-mentioned bovine myoblast CDKN1C gene super enhancer. The nucleotide sequences of the primer pairs for amplifying Enh22 are shown in SEQ ID NOs. 4 to 5, the nucleotide sequences of the primer pairs for amplifying Enh38 are shown in SEQ ID NOs. 6 to 7, and the nucleotide sequences of the primer pairs for amplifying Enh40 are shown in SEQ ID NOs. 8 to 9.

[0008] The present invention also provides the use of the bovine myoblast CDKN1C gene super enhancer in regulating bovine muscle growth.

[0009] The present invention also provides the use of the bovine myoblast CDKN1C gene super enhancer in the breeding of high-yield beef cattle.

[0010] Furthermore, the method for increasing meat production is to knock down one or more enhancers among Enh22, Enh38 or Enh40 in bovine myoblasts.

[0011] Furthermore, the specific steps of the method include: designing sgRNA primers of enhancers Enh22, Enh38 or Enh40, annealing the primers, and connecting them with the CRISPR / Cas9 basic vector to construct a recombinant vector.

[0012] Furthermore, the nucleotide sequences of the sgRNA primers of enhancer Enh22 are shown in SEQ ID NOs. 10 to 11.

[0013] Furthermore, the nucleotide sequences of the sgRNA primers of enhancer Enh38 are shown in SEQ ID NOs. 12 to 13.

[0014] Furthermore, the nucleotide sequences of the sgRNA primers of enhancer Enh40 are shown in SEQ ID NOs. 14 to 15.

[0015] Beneficial effects: Compared with the prior art, the present invention has the following outstanding and significant advantages: The present invention discovered a super enhancer located in the cattle CDKN1C gene, which can be used to improve the efficiency of gene editing and transgenic breeding of beef cattle (for example, without the need to cut and repair the gene sequence), and facilitate the screening of genomic mutations (i.e., molecular genetic markers) related to individual advantageous traits of beef cattle (for example, large physique and high meat production), thereby accelerating the breeding process of excellent beef cattle groups. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a microscopic photograph of bovine myoblasts isolated and cultured in an example of the present invention.

[0017] Figure 2 Schematic diagram of molecular level screening of candidate super enhancers in an embodiment of the present invention.

[0018] Figure 3 This is the result of identifying the activity of the target super enhancer in bovine myoblasts in the examples of the present invention.

[0019] Figure 4 This is the effect of the target super enhancer in the examples of the present invention on the mRNA expression of the CDKN1C gene in bovine myoblasts.

[0020] Figure 5 This is the effect of the target super enhancer in the examples of the present invention on the expression of the CDKN1C gene protein in bovine myoblasts. DETAILED DESCRIPTION

[0021] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0022] Example 1

[0023] 1. Identification of candidate super-enhancer activity in bovine myoblasts

[0024] 1.1 Candidate super enhancers

[0025] First, we used CUT&Tag (H3K27ac and H3K4me1) high-throughput sequencing technology to analyze the longissimus dorsi muscle of fetal bovine and adult bovine to identify regulatory elements near CDKN1C; then we performed chromatin accessibility high-throughput sequencing (ATAC-seq) data analysis to identify enhancers in the open region; finally, we screened super enhancers that interacted with the CDKN1C promoter based on Hi-C-loop data. Figure 2 and Figure 3 The results showed that the 10 candidate enhancers (Enh8, Enh20, Enh22, Enh38, Enh40, Enh59, Enh63, Enh64, Enh71 and Enh72) shown in Table 1 (ARS-UCD1.2) had long-range interactions with the CDKN1C gene promoter, among which Enh8, Enh20, Enh22, Enh38 and Enh40 were super enhancer components.

[0026] Table 1. Location information of candidate super enhancers

[0027]

[0028] 1.2 Super enhancer PCR amplification

[0029] The longissimus dorsi muscle of fetal bovine was isolated, and the genomic DNA was isolated, extracted and purified according to the method of Sambrock et al (2002).

[0030] The bovine CDKN1C gene sequence (GenBank NC_037356.1) published in the NCBI database (http: / / www.ncbi.nlm.nih.gov / ) was used as a reference sequence, and PCR cloning primers were designed using Primer 5.0 to amplify the candidate super enhancers in Table 1. The obtained candidate super enhancer PCR amplification products were used to construct the pGL3-Promoter-Enh recombinant vector.

[0031] Table 2. PCR cloning primer information (10 candidate enhancers in Table 1)

[0032]

[0033]

[0034] PCR amplification system: 50 ng / μL of the genome of fetal bovine longissimus dorsi muscle as template, 4 μL of DNA, 1.5 μL of 10 pmol / L upstream and downstream primers (primer pairs in Table 2), 50 μL of 2×Max, and 43 μL of deionized water, a total of 100 μL.

[0035] The reaction procedure of PCR amplification was as follows: (1) 98°C for 2 min; (2) 98°C for 10 s, 55°C for 15 s, 72°C for 20 s, 36 cycles; (3) 72°C for 5 min. The amplified product was verified by sequencing.

[0036] 1.3 Construction of recombinant vector pGL3-Promoter-Enh

[0037] Fetal bovines at about 90 days of gestation were collected in Xiaogang Village, Kunming City, Yunnan Province in October 2022. Bovine myoblasts were extracted from the collected fetal bovines using conventional methods and subcultured for subsequent transfection of recombinant vectors.

[0038] The PCR amplification product of the candidate super enhancer was purified by SanPrep column PCR product purification kit (Sangong, Order NO.B518141) to obtain product S1 for future use. The pGL3-Promoter empty vector (Promega) was linearized by BamH I and SalⅠ digestion, and the digestion product was recovered by SanPrep column DNA gel recovery kit (Sangong, Order NO.B518131) to obtain product S2 for future use. Enzyme digestion system: 50ng / μL PCR product or pGL3-Promoter vector 20μL, enzyme digestion buffer 10μL, each endonuclease (e.g., BamH I and Sal I) 4μL, and deionized water 62μL, a total of 100μL. The program is: 37℃20min. Ligation system: 1 μL of 50 ng / μL product S2, 1 μL of 50 ng / μL product S1, 1 μL of 10×T4 ligase buffer, 0.5 μL of T4 ligase, and 6.5 μL of deionized water, a total of 10 μL. Different products S1 and S2 were DNA-ligated by T4 DNA ligase, and the ligation was carried out at 16°C overnight. After the ligation products were transformed into competent cells DH5α (Tiangen Biochemical Technology Co., Ltd.), after ampicillin resistance screening, positive single clones were confirmed by Sanger sequencing, and the pGL3-Promoter-Enh recombinant vector was extracted using the SanPrep column plasmid DNA small-scale extraction kit (Sangon, Order NO.B518191), which was used to transfect bovine myoblasts and identify the activity of candidate super enhancers.

[0039] 1.4 Cell transfection with recombinant vector

[0040] Reference transfection reagent TurboFect (Thermo Scientific TM ) instructions, pGL3-Promoter-Enh recombinant vector and pRL-TK internal reference vector (Promega), pGL3-Promoter empty vector and pRL-TK internal reference vector were transfected into bovine myoblasts to detect the activity of candidate super enhancers.

[0041] 1.5 Screening of super enhancers

[0042] To identify the activities of the 10 candidate super enhancers in Table 1, the operation process was as follows The assay was performed according to the instruction manual of ReporterAssay System (Promega): the determination was made based on the difference in the relative fluorescence activity of the transfected super enhancer (after transfection with the pGL3-Promoter-Enh recombinant vector and the pRL-TK internal reference vector, the ratio of the firefly fluorescence divided by the internal reference pRL-TK Renilla fluorescence, R1) and the relative fluorescence activity of the untransfected super enhancer (after transfection with the pGL3-Promoter-NC and pRL-TK internal reference vectors, the ratio of the firefly fluorescence divided by the internal reference pRL-TK Renilla fluorescence, R2): if the ratio R1 was significantly higher than the ratio R2, it indicated that the candidate region had super enhancer activity.

[0043] The present invention uses CUT&Tag (H3K27ac and H3K4me1) high-throughput sequencing technology to identify regulatory elements near CDKN1C; chromatin openness high-throughput sequencing (ATAC-seq) data analysis to identify super enhancers in open areas; based on Hi-C-loop data, screen super enhancers that interact with the CDKN1C promoter; use a dual-luciferase vector reporter system to identify the activity of super enhancers; because TAD has insulation, according to Hi-C-TAD data, select super enhancers located inside TAD for subsequent experimental verification. Finally, CRISPRi, real-time fluorescence quantitative PCR and Western Blot are used for verification, so that super enhancer components that can promote the expression of the CDKN1C gene in bovine myoblasts can be effectively identified.

[0044] The analysis results showed that a total of 10 candidate enhancers were screened (Table 1), namely Enh8, Enh20, Enh22, En h38, Enh40, Enh59, Enh63, Enh64, Enh71 and Enh72. Among them, 5 candidate super enhancer components interacted with the CDKN1C gene promoter at a distance, namely Enh8, Enh20, Enh22, Enh38 and Enh40; 5 candidate enhancers were active in bovine myoblasts (1.5 times higher than NC), namely Enh22, Enh38, Enh40, Enh64 and Enh71. Hi-C-TAD data analysis showed that 3 of the candidate super enhancer components (Enh22, Enh38, Enh40) were inside the TAD together with the CDKN1C gene. Therefore, Enh22 (SEQ ID NO. 1: CACTGGCCCCTGAGCTGCGGAGCGGGCAGGCTGAGGCAGGCGGGCAGGAAAGGAGCTGGCGGCAGGGCTGCAGAGGCCGCAGGCCCAGGC

[0045] TTGTGCGCCCCAGGCCTGGCAGGCGCTCCGAATCCCACTCCTGAACCCTGGCACA

[0046] CAGGCCCTCCCCCAACACGCTCCCCGCCAGCCCCTCCTGCACAGGGGCAGGGGTA

[0047] AGGGGCACACCAGTTCCTGCTCCTGACCAGAGCCCAGGGCCCCTTCGGCAGTTCC

[0048] TGGGGACTTGGGGGCATTCCCCAGGGTTTGGGGGACATGGCAACCCCATCTGGCT

[0049] GAAGACAGCCTTTTATACACAGCACAAAGCCTCCTCAGGTGGCCCCCTACTCTTGC

[0050] AGCGGGCTGCCCTCCCCCAGCCCTTCCTGTGGGGCTTCCAGGCCAGGCCCGCGCC

[0051] CTTGCTCATCCCTGCCTGGGCTCCGCTGACCCGCGGCCAGGAGCGTCCTTCCCCAG

[0052] CCAAGCCCAGCTCTGTGCAGGCTCGCGCGGCCCCTCGGAGGCCCTGGTGGATCCG

[0053] TGAACACTGTTTATTCCTCTGTCCTGGACGCAGCTGAGGGCTGGGAGCACGTTCG

[0054] GACAGCCCTAGAATCCCGTGTGGAGGCCTTTGTCCTCATTTGCCCAGCATGGAGCC

[0055] CCGGCTGGGGTCCAGGGCTGCGCACGGCCTCACCGGCTTTGTCCCTTCTCTGTCTT

[0056] TAGGCTCCCAGGGGCCACGCTGGCAGGTGCCCTGCTGCCCAGCTCGCACTGGGAC

[0057] CCATGCTGTCCCCCTATCTCCTTCTTGGAAGGAGTGGCCAGGGCAGCCCCCGCCTG

[0058] GGCGGGCCCCCTAAATGCCATGAGGCCATGTGGGGGCCTCAGAGTGGGCTGTGGA

[0059] GCATTAGAGCCAGGGCGTGGTCCAGCCTGCCTTCAGGCCAGGGCATGAGCAATGT

[0060] GGAGCATCTGCTGGGAGGGTCCTGCGGCTGGGGGCTGGCGGGGGCGCTCAGGGT

[0061] GGGCAGTGCTCCTCGGCCTGCAGCACAAGGGCATGGAGAGATGGCAGTAGCTTCA

[0062] CCACTCCCAGCTGGCAGTCCTGAGGAGGCGACGCTCCCCTCCCCTGTGAGCCCCT

[0063] ACTTTCCAGACCATGGAGGAAGCATCCGGTGCCCCTCTATCCCCTGGTGAGAGCCA

[0064] CCCTGGGGGTGCCTGGGGAGGTCAGCACCTGGCCACGTGTGCCCTGGCACCTGTC

[0065] CCCACTTCTCAGGGACCCTGGGGGTGCTGGGCTCGCGTCGAGAAGTAGGGCAGCT

[0066] GCCAGAAGCACCATCCCCAAGGCGTGGGCGGTGGGAGAAGCCGGGGTGAGACCC

[0067] TGAGCCCTGGAAGGGGACTGCCATGGTGCGGGTGGAGTCTGGCTGCCTGTGCCCG

[0068] AGGATGGCACTGGGAAGACGGTGGGCGTGGGCAAGCCTGGGAGGCAGCGCCAGG

[0069] GCGCCAGCCCTGCTGGCCAGGAACAGCGAGGGGAGGCCGAGTCCACTGTC

[0070] CTGCTGCCCTCCTCCCCTGCAATAGAGAGTCTAGAAC),Enh38(SEQ ID NO.2:C

[0071] TTGAAAGCCCTTTCCGGGGTGGCCTTGGCGCTGTCCACGTCCTCAGAGGCCCTGG

[0072] GCCCACCCAGCCCAAAGGGCCTGGAGATCAGGGATGAGTGGCTGTGGAAAC

[0073] GGCAGGCCTGGGCAGGAAGTGGGGGCAGGCACGCTCTGGGGTGGGATGCGCCGT

[0074] GGGAAGAAGCTGCCTCTGGAAGGTAGTGATAAGAAAGGCCCTGTAGGCGACGGG

[0075] TCTGGCAGGGCGCAGCTCACTTTGCTTTCCCACCCCCTATGCCTGGCGTGCAGCCA

[0076] GGCCCAAGCAGGTGCTCAGGAGACAGCTGCTGAGCTAACCCGCGTCGAAGCGGG

[0077] GGCCCTGGGGGAGTCGGGGTTGGCTCAGGGAGGCTTGGCCATGCAATGCCCAAAC

[0078] ACACACACACACGGCACAGCTGCCCTCCTGATGGGAAGTGACCCACACCCCACGC

[0079] TGCCACTCAGCAGGACCGCCTGCCCTCGAGACCCCCCACCCATCCGGCATCACGT

[0080] TCTTGCTGACCCCAATTCAGGAAAGGAAATCTGCTCGTGAGGGAAGGCGGGACTG

[0081] ACCTGAGGGCAGCGTGATTGTCTAAAGGCACTTCCCCCACCCCATAATTCCACTCC

[0082] TGTTTCCTTCTTAGAGAAGGGGTGCTGGGGGGGAGGCCCAAGAACATCCTGGAAT

[0083] TGGGAGGCGCAGGCCCCAGCTGGTCACACTTGGGCCCCACCCCGGGCCCAAGCA

[0084] GCTAACATGGGCAGGGTACCAATACGGCCATGCCTGTGGATGGATACCCCCCCAGG

[0085] CCGTGGGGTGTCTCTGTAGCTGGGGGTAGGGGAGGTCTCTTAAGATTGTCCAGCTG

[0086] ACCCTTAACTTTCCCTCCAAACCCACCCTGTGCTTTCCTGCAGCTCGCCCTTGGCC

[0087] TCAGTCTCGGAGTCCTCCCTAAGCTGCCTCACACAGGAGCCCTTGGCCTGGCTGTT

[0088] TCTTCTACCTCCGTGGCCACCACCTGCTGCCCAGGCTCCTGCCTCTCTCACTGGGC

[0089] AATGCCGAGTCTCTCCACAGCCCTGCTGGGCCCCCTTGCCTCCCTGCCCACTCCAG

[0090] TTCTCTCTCCATTCAGCAGCCAGAGTGATCTTTCCAGAAGGGAGACCTGAGCCTCA

[0091] CCACCTCTCTTCTCTCCCCAAGACTTTGCAGAGCTGACCCACACTGTACTTCATCC

[0092] CCACCCTGGCCTGCAAGGCCACCCCGCCCTCGATGGGGCTGTCGAGCTCAGAAGT

[0093] GCAGAACACAGGCCAGGGAGATTTGGGGGAAAGAGCAGTGGGTGGGGATGGGAG

[0094] GGTCACAGAGCCCCCACCCAGGACAGCTGTGGGGGTGGGTGTCGCCCGCAGCGA

[0095] GTGCGCAGCTCTGAGAGGGACCCGGGGTGGGGGTGGGGGGCGCCGTGGGCAGAG

[0096] GATGTGGAGACTGTGGTCTCCACTGTCTTGGCAACTGCGTCAGGCACACAGGGAG

[0097] ACCCCAGGCTCTTCGGCCCTCTCTGCATTCCTGTTCACTTCTGGGAGCAGCGTGGG

[0098] GAGAGGGGCCTCCCGGGGAAGATGGGGCTGAGCTGGCCACGTGGCCCTGGGCCT

[0099] CTCTGCTTTGGAGGGAAGCAGCTCTCTGGGAACCTGGCTGAGCTGAAGCTGGTCC

[0100] CACCCTGAGACTCTCGGGGTGGGGAGAGCTGGAGGCAAGCCGTGGCTCAGAGCA

[0101] CCCTCGGCGGGTCCTGCACCCCTGGCACTTGGTGAGGCTCCCACCCCCTTGCCCTC

[0102] CCGGCCCCCGCGTTGAGGAGAACTGGTGTTTCCTCCGGGACTGGCGGGGCTCTGG

[0103] GCCCCATCCGCACTTCTGTGCTGGCAAAAGCAGGAGAATTAGCTCAGCGACTTCC

[0104] TCCCTTAATCCCCCGCCCCCATTCTAAATGCCTCAGAATCGAGAGAAAAGCCCAGT

[0105] GGACATTCAGAGCCTAATTCTCTTCAGCTGTGAGTGCGTGTGCGTGCGTGCACTCG

[0106] GGCGCAGGGGCCCGCAAGGAAACCTTCTGAACCTCAAATATCAGTGCCGGAGGG

[0107] AGCAGCCCTCACCAGGGATGGATGAGATAAACCAGATGCCCTCTGTCACATGGGG

[0108] AGCCAGAGTCAAGGCCGCCAGGTGCCCAGGCTCTCTGCCCCACGCCCACCCCGCA

[0109] GTCTTGAGGGGTGCCACACCCCCAGGGCCTCCAGGACCAGGGAGCCCCTGTGGCT

[0110] GTTCCGGGCTGGGGAGGGACCTCAGTATAACCCGGCAAGGAGCTGGCCATGCCTG

[0111] GCACTCCCTTGCTGAATTCTGCCCATGTGCCTAAGGCCAGCTCCAGGCTCCCCTCC

[0112] CCCGCTGCCCGCCTGGCAGCCCCCAGTCTGTCCCGGGCTGGCCTGGAGTCTGCCC

[0113] AGCCTCACAGGCTTCTTCAGCCAATTCCCACGTGTCTCTTGTCTCCCGACGAGACA

[0114] ACAAACCCCTCTCAGTATCGGACTGTTTTCCTCTCTGTCTCCCCCAGAGGACCGGG

[0115] GGAGGCGGGGCCGGGGGGCGCACAACAGGTGCGCCGGGCTGGCGGCAGCACCG

[0116] GCTGATTGACAGCGCCCCATGTGCGGCGAGGGGGTGAGGGCTGAGCACACGGAA

[0117] CCACCCTTCCCCAGGCCGTGTCAGAAAGGACAGCAGCGGGCTCCAGGCCTGGCTG

[0118] AAACATGGCCCCGGGGAGACACTCACACAGGCACACAAAATTGCGGTGCCCACG

[0119] GCGTTCCTCCGCAAGCTGGTCTGTGAGGGGACAGTCCGAGGGCCTGTGGTCTCAG

[0120] GGCCTGAGGTGAGAGGGCACATGGGTGCGAGCCCCGTCACGGGAAACCACGCAC

[0121] GCACGGATTCAGCCACTCCTGCAA),Enh40(SEQ ID NO.3:GGGGCACTGACCC

[0122] CTCCCTCACACGGGGACATCAAAGGGAAGCAGGAAGCAGCGAGCGGCTGACCCC

[0123] TGGCGGGTGGGGAAAGTGCAGGGTCACAGCTCAGCCGGGGCCCAACGGCTGGGG

[0124] ATTTTCCATCCCACCAGGATTTCCGCAGGACACCCCAACTACAGCCCGAGAGACTC

[0125] CTTGGGAACCAGGGTCTGGACTGGAAGCCCCTGTCCTCAGTCTCTCTGTGACTTG

[0126] CTGGCTGCTGGCCCAGACACGTCAGAACTCTGTACCCTGGGCTCTGGGACCTGGC

[0127] TGGGGAGGGAAGGCCACAGACTGAGCAGAGGGCCTGAGAAGAATGGAGAAGGG

[0128] AACCTGCCGCTCCCCGGCTAGTCATCCCTCCTTGATTGGGGTCAGGGGGTCAAGGC

[0129] CACTGAGTAGGCTGTGTCAGAGGGTGGACCATACAAACAGTCCCGAGTTCCAGGT

[0130] TCCCAGGAAGCCCTCTGGAATACTCTGCAGCAGCCCCAGTGCAGGCAGGGGCGCT

[0131] GTGTGGACCACTGGGCTCACGGGTGTGTATCTGCTGACCAAAGCCTTCTGCACAG

[0132] TGTAGCGCTGAGGGCAGCTGTGGGCAGGCTGGGCTCTCCCAGCCTCAACCCGAGG

[0133] CCATGAGGCCTGGGAATCCGGTACCCTCGACAGTCACTGTACTTGGTGAACAGTCT

[0134] CTCCACTGCAGTTTGTGGGCTATGATCCACTTGATACACCCTGATAAGGGCATCTGT

[0135] GTCACTCCCTGGCACCCTGTCCCCAGCTGAGACTACCATGTCTTCACCCCAAGTTA

[0136] TTGCTCCTGCCTCAGCAAGCCAGCCCTGGCCCTGTCCTTGCCTTCATTCACCAGAA

[0137] GGATGAACCAGGCATGCCACGGGTCACGAGGACCCTCATGGACCTGGGTTGGCCT

[0138] CTAGGCTGGTGACTGGACTGATATACGCCAGGGACCTCTGGCTGGAGAAACTGCC

[0139] CCTGAGTCCTTTGTTTGTCCTGTGGGAGTGGGCAGAGGAGTGCTTGCGCCAGAGG

[0140] AGCTGCGGTTCTGTGGTTGGAGGCCAGCGGTCCCGGGCTGAAGACAGGGCTGAGT

[0141] AGGACACCCCAGTCTTGAACAAGGGTTTGCCATCTGAGTGGGGACCCACATTTAG

[0142] TCCAGCAGCCACAGTCTATACAGCCCAGAGCTCGGCCTAGGAGCAGGCGTGTCCG

[0143] TGTGCAAAGTGCTGGCAGCCAGGCTCAAGATCCAATTACAGCAGCTGTCTCACAG

[0144] GAACGTGCTGCCCAGGGCTGGGAGCTGTTGTTCCGGGGCTGCGAGGAGACTCAGT

[0145] GCTGGGCCAGGTGGGGTGTCCATTGCTGGGAATTGTTTCAAAATAATCACAGAAA

[0146] CTTGGCAGGCAGGGACTCTGCACGTGAGGGGCCCAGTCTCCTTATGGGACCCATG

[0147] TCCTGCTGATGAGTGTGCTCCTCCCCTGGCCAGGCACAGTGTGCTGTGGTCTGGGG

[0148] CCTGGCTTCCCAGCCCAGTGACATTATCGGGAGAGGCATGTCTGCTCCCTGCATCA

[0149] CAGGGCCTTAGAGTCAGACAGCGAGACTGGAGCTGGTTATCGGGGGGCTGGATGG

[0150] GCAGGCACAGCTGTGTTCTCAGGAAAGCATAGAAAACCCCAAAAGTGAGGGAGC

[0151] GAGATGGGGCAAAGGATGATTTACCATTGACATAGGCTTGCTAGAGGTGGGCCCA

[0152] GCACACTTCTCTACTCTCCCATCCCCTGGGTGGGTGAGAGTCAGAGGGGCCTAGG

[0153] GCAGACCCCACCATGATTCTCACTAGAGTGAGGCACAGAGTATGCAGGCTGGTGGCGAGTGGGCCAGGAC) candidate enhancer groups were identified as target super enhancers.

[0154] 2. Regulation of CDKN1C gene expression by target super enhancers

[0155] 2.1 Construction of recombinant vector pX330a dCas9-KRAB

[0156] The double-stranded oligonucleotide primer pair P12-P15 was used as a primer (Table 3), and double-stranded oligonucleotide S3 (NC control group and sgRNA experimental group) was obtained by annealing. Double-stranded oligonucleotide annealing synthesis system: 100 μmol / L of the upstream and downstream primers corresponding to the primer pair P12-P15, 1 μL each, and 8 μL of deionized water, a total of 10 μL; the double-stranded oligonucleotide annealing synthesis procedure was: 95°C for 5 min, and slowly cooled at room temperature. The pX330a dCas9-KRAB vector (addgene: #92361) was linearized by Bbs I, and the linearized vector was recovered using the SanPrep column DNA gel recovery kit to obtain product S4 for standby use. Enzyme digestion system: 40 μL of 50 ng / μL pX330a dCas9-KRAB vector, 10 μL of enzyme digestion buffer, 1 μL of Bbs I endonuclease, and 49 μL of deionized water, a total of 100 μL; the enzyme digestion program is: 95°C for 3 h.

[0157] The ligation system was calculated as 10 μL: 1 μL of 50 ng / μL linearized vector, 1 μL of double-stranded oligonucleotide, 1 μL of 10×T4Ligase buffer, 0.5 μL of T4 ligase, and 6.5 μL of deionized water; the ligation procedure was: overnight ligation at 16°C. Different products S3 and S4 were connected using T4 DNA ligase. The ligation products were transformed into DH5α, screened for ampicillin resistance, and positive single clones were confirmed by Sanger sequencing. The pX330a dCas9-KRAB-NC and pX330a dCas9-KRAB-sgRNA recombinant vectors (collectively referred to as pX330a dCas9-KRAB recombinant vectors) were extracted using the SanPrep column plasmid DNA small-scale extraction kit.

[0158] Table 3. Double-stranded oligonucleotide primer information

[0159]

[0160] 2.2 Cell transfection with recombinant vector

[0161] Reference transfection reagent TurboFect (Thermo Scientific TM ) Instructions for use, pX330adCas9-KRAB-NC and pX330a dCas9-KRAB-sgRNA were transfected into bovine myoblasts, respectively, for experiments to inhibit the activity of target super enhancers.

[0162] 2.3 RNA isolation, extraction, purification and reverse transcription

[0163] Total RNA was extracted from bovine myoblasts transfected with the pX330a dCas9-KRAB recombinant vector using the TRIzol (Takara) method and transcribed using Takara's PrimeScript TM The extracted RNA was reverse transcribed into cDNA using RT reagent Kit with gDNAEraser for identification of bovine CDKN1C gene expression.

[0164] 2.4 Identification of bovine CDKN1C gene expression

[0165] The bovine CDKN1C gene sequence (GenBank NC_037356.1) published in the NCBI database (http: / / www.ncbi.nlm.nih.gov / ) was used as the reference sequence. Primer 5.0 was used to design real-time fluorescence quantitative PCR primers (Table 4) to amplify the CDKN1C gene sequence. The amplification system was as follows: 2 μL of 10 ng / μL template cDNA, 1 μL of each of the upstream and downstream primers corresponding to primer pair P16 or primer pair P17 at 10 pmol / L, 10 μL of 2×SYBR Green qPCR Mix, and 6 μL of deionized water, for a total of 20 μL. The reaction procedure was as follows: (1) 95°C for 30 s; (2) 95°C for 10 s, 60°C for 30 s, for 39 cycles.

[0166] Table 4. Primer information for real-time fluorescence quantitative PCR

[0167]

[0168] Based on 2 -ΔΔCt The expression of CDKN1C gene in myoblasts was detected. The experimental results showed that the expression of CDKN1C gene mRNA in the experimental group transfected with pX330adCas9-KRAB-sgRNA (experimental interference vector) was significantly lower than that in the negative control group transfected with pX330adCas9-KRAB-NC ( Figure 4 ), among which Enh38 had the best effect. By Western Blot, the expression of CDKN1C gene protein in the experimental group was significantly lower than that in the negative control group transfected with pX330adCas9-KRAB-NC ( Figure 5 ). CDKN1C expression decreased significantly, indicating that the activity of the target super enhancer was inhibited. The above results show that the target super enhancer component can promote CDKN1C gene expression. It is proved that the super enhancer is active in the longissimus dorsi muscle tissue of cattle. Since the CDKN1C gene is a key gene that affects important economic shapes of mammals, the three target super enhancer components identified in this application can be used as target sites for gene editing and transgenic breeding of beef cattle, by knocking down the above super enhancer to inhibit CDKN1C gene expression, thereby promoting muscle development and increasing meat production; or by screening important mutations that affect the activity of the super enhancer for marker-assisted selection of beef cattle.

Claims

1. A bovine myoblast CDKN1C gene super enhancer, characterized in that: The super enhancer components include Enh22, Enh38 and Enh40, Enh22 is located at positions 48802495-48803999 of chromosome 29 of the bovine genome, Enh38 is located at positions 48902854-48905629 of chromosome 29 of the bovine genome, and Enh40 is located at positions 48920416-48922207 of chromosome 29 of the bovine genome.

2. The bovine myoblast CDKN1C gene super enhancer according to claim 1, characterized in that: The nucleotide sequence of Enh22 is shown in SEQ ID NO.1, the nucleotide sequence of Enh38 is shown in SEQ ID NO.2, and the nucleotide sequence of Enh40 is shown in SEQ ID NO.

3.

3. A primer pair for amplifying the super enhancer of the bovine myoblast CDKN1C gene according to any one of claims 1 to 2, characterized in that: The nucleotide sequences of the primer pair for amplifying Enh22 are shown in SEQ ID NOs. 4-5, the nucleotide sequences of the primer pair for amplifying Enh38 are shown in SEQ ID NOs. 6-7, and the nucleotide sequences of the primer pair for amplifying Enh40 are shown in SEQ ID NOs. 8-9.

4. Use of the bovine myoblast CDKN1C gene super enhancer according to any one of claims 1 to 2 in regulating bovine muscle growth.

5. Use of the bovine myoblast CDKN1C gene super enhancer according to any one of claims 1 to 2 in breeding high-beef-yielding cattle.

6. The use according to claim 5, characterized in that: The method for improving meat production is to knock down one or more enhancers among Enh22, Enh38 or Enh40 in bovine myoblasts.

7. The use according to claim 6, characterized in that: The specific steps of the method include: designing sgRNA primers of enhancers Enh22, Enh38 or Enh40, annealing the primers, and connecting with the CRISPR / Cas9 basic vector to construct a recombinant vector.

8. The use according to claim 7, characterized in that: The nucleotide sequences of the sgRNA primers of enhancer Enh22 are shown in SEQ ID NOs. 10 to 11.

9. The use according to claim 7, characterized in that: The nucleotide sequences of the sgRNA primers of enhancer Enh38 are shown in SEQ ID NOs. 12 to 13.

10. The use according to claim 7, characterized in that: The nucleotide sequences of the sgRNA primers of enhancer Enh40 are shown in SEQ ID NOs. 14 to 15.

Images