Cotton bollworm transcription factor Taiman and application thereof

Abstract

The invention discloses a cotton bollworm transcription factor Taiman and application thereof, and particularly relates to the technical field of agricultural pest control. The nucleotide sequence of an open reading frame of a cotton bollworm transcription factor Taiman is shown as SEQ ID NO.1, and an inhibition factor dsRNA (called dsTaii) is synthesized aiming at the gene; the preparation method comprises the following steps of: further polymerizing dsTai and a nano-material chitosan (chitosan, called CS for short) to obtain a CS-dsTai nano-composite; the helicoverpa armigera larvae are ingested into bodies in a natural feeding mode, expression of a target gene Taiman is remarkably inhibited, and 79.17% of treated individuals die due to ecdysis failure. The invention has the beneficial effects that the Taiman gene can provide a molecular target for designing a specific and efficient insecticide, and a new strategy is provided for prevention and treatment of cotton bollworm by virtue of natural feeding and nano-material mediated RNAi (Ribonucleic Acid Interference).

Description

Technical Field

[0001] The invention relates to the technical field of agricultural pest control, and in particular to a cotton bollworm transcription factor Taiman and an application thereof. Background Art

[0002] cotton bollworm ( Helicoverpa armigera ) is a major agricultural pest with the characteristics of a wide host range, strong reproductive capacity, rapid growth and development, and the ability to migrate long distances.

[0003] RNA interference (RNAi) is a technology that uses exogenous double-stranded RNA to induce target gene silencing in organisms. Due to its specificity, high efficiency and simple operation, RNAi technology has shown great application potential in pest control. The implementation methods of insect RNAi mainly include microinjection, feeding, plant-mediated RNAi, microbial-mediated RNAi, and nanomaterial-mediated RNAi. Among them, the microinjection method bypasses the barriers of the insect body wall and digestive tract, allowing dsRNA / siRNA to reach the target tissue directly. This method is widely used in laboratory research, but it is not suitable for field pest control. The feeding method is to allow insects to ingest dsRNA / siRNA into the body through natural feeding. It is one of the most promising RNAi-mediated methods in the field of pest control. However, the efficiency of target gene silencing of RNAi in lepidopteran insects using the feeding method is low. The reason is that the exposed dsRNA is less stable under the alkaline conditions of the insect digestive tract and is easily degraded by nucleases. Recent studies have found that the use of nanomaterials (such as star-shaped polycationic nanoparticles) to encapsulate dsRNA (targeting the early response gene kr-h1 of juvenile hormone signaling) and spray it on tomato leaves can effectively prevent nuclease degradation of dsRNA after tomato leafminers feed on it, significantly improving the silencing efficiency of the target gene. However, there is no similar research on cotton bollworms.

[0004] Juvenile hormone is one of the important hormones that regulates the growth, development and reproduction of insects. In the larval stage, high concentrations of juvenile hormone keep the larvae in the larval state after molting. In the mature larval stage, when juvenile hormone is absent or the titer decreases, insects initiate changes in external morphology and internal structure. Studies have reported that Taiman first forms a functional dimer with the juvenile hormone receptor Met, and then induces the expression of downstream genes in the juvenile hormone signaling pathway, thereby regulating larval development and preventing premature changes in external morphology and internal structure. However, there are few studies on the function of the Taiman gene in Lepidoptera insects, and there are no reports of RNAi using Taiman as a target gene for pest control. Summary of the invention

[0005] The purpose of the present invention is to solve at least one of the technical problems existing in the prior art, to provide a cotton bollworm Taiman gene and its application in cotton bollworm control by targeted RNAi, and specifically to provide a cotton bollworm transcription factor Taiman and its application.

[0006] The present invention discloses a transcription factor of cotton bollworm Taiman, and designs an inhibitory factor dsRNA (called ds Or ), and further ds Or Combined with the nanomaterial chitosan (CS), CS-ds Ta The nanocomplex was used to ingest the cotton bollworm larvae through natural feeding, which significantly inhibited the expression of the target gene Taiman. The results showed that 79.17% of the fed individuals died due to molting failure, confirming that the nanomaterial-dsRNA complex significantly improved the interference efficiency of the target gene. The Taiman gene described in the present invention can provide a molecular target for the design of specific and efficient insecticides, and RNAi mediated by natural feeding and nanomaterials will provide a new strategy for the prevention and control of cotton bollworms. The technical solution of the present invention is as follows: In a first aspect, the present invention provides a cotton bollworm transcription factor Taiman, the nucleotide sequence of the open reading frame of which is shown as SEQ ID NO.1.

[0007] In a second aspect, the present invention provides an inhibitory factor ds1 of the transcription factor Taiman of cotton bollworm. Or The inhibitory factor dsTai is a dsRNA capable of inhibiting the expression of the transcription factor Taiman gene, and the nucleotide sequence of the inhibitory factor dsTai is shown in SEQ ID NO.2.

[0008] In a third aspect, the present invention provides an inhibitory factor ds Or The preparation method comprises the following steps: The cDNA of cotton bollworm is used as a template, and specific primers with T7 promoter are designed according to the nucleotide sequence of the open reading frame of the transcription factor Taiman. The template is PCR amplified using the specific primers to obtain PCR amplification products.

[0009] The purified PCR amplification product was used as a template and in vitro transcription synthesis was performed using the kit T7 RiboMAX™ Express RNAiSystem to obtain the inhibitory factor ds Or .

[0010] Optionally, the specific primer includes an upstream primer ds Or -F and downstream primer ds Or-R, the upstream primer ds Or -F sequence is shown in SEQ ID NO. 3, the downstream primer ds Or The sequence of -R is shown in SEQ ID NO. 4.

[0011] Optionally, the PCR amplification system includes: 17.5 μL of water, 2.5 μL of 10×Pfu Buffer, 2 μL of 2.5 mM dNTP mixture, 0.5 μL of 2.5 U / μL Pfu DNA polymerase, 0.5 μL of cDNA template, 10 μM upstream primer ds Or -F 1 μL, 10 μM downstream primer ds Or -R 1 μL; The PCR amplification conditions include: pre-denaturation at 94°C for 1 min; 94°C for 30 s; 35 cycles at 59°C for 30 s; 72°C for 40 s; and extension at 72°C for 5 min.

[0012] Optionally, the above-mentioned ds targeting the Taiman gene of cotton bollworm Or The preparation method is as follows: (1) searching the transcriptome database of cotton bollworm to obtain the transcript encoding the Taiman gene, cloning and verifying to obtain the ORF sequence of the Taiman gene of cotton bollworm; (2) designing an upstream primer SEQ ID NO: 3 and a downstream primer SEQ ID NO: 4 with a T7 sequence; (3) amplifying the target gene fragment by PCR: using the cDNA obtained in the first step as a template, designing specific primers to amplify the target fragment, and purifying to obtain a PCR product with a T7 sequence and the target gene fragment; (4) using the kit T7 RiboMAX™ Express RNAi System (Promega Company) to synthesize the ds Or .

[0013] In a fourth aspect, the present invention provides a CS-ds Or The method for preparing the nanocomposite comprises the following steps: The inhibitory factor ds Or Formulated as ds Or Solution; The concentration of 0.25 μg / μL ds Or The solution was mixed with a chitosan sodium acetate solution having a mass volume percentage concentration of 0.04% in a volume ratio of 1:1 to obtain CS-ds Or Nanocomposites.

[0014] In a fifth aspect, the present invention provides a CS-ds prepared by the above method. Or Nanocomposites.

[0015] In a sixth aspect, the present invention provides the CS-ds Or Application of nanocomposites in control of cotton bollworm.

[0016] The present invention is a method for controlling cotton bollworm by RNAi using Taiman gene of cotton bollworm as target. Controlling cotton bollworm by RNAi mainly refers to inhibiting the molting of cotton bollworm, thereby causing abnormal molting and death of cotton bollworm.

[0017] Optionally, the cotton bollworm control is by inhibiting the molting behavior of the cotton bollworm to cause its death.

[0018] Optionally, the inhibition of the molting behavior of cotton bollworm is achieved by reducing the expression level of Taiman gene of cotton bollworm.

[0019] Optionally, the application method comprises: The CS-ds Or The nanocomplex was taken into the body of cotton bollworms through feeding; Among them, ds Or The feeding dose is 1.25 μg / head.

[0020] Optionally, the feeding method is to feed CS-ds Ta iThe nanocomplex is dropped on the surface of artificial feed and fed to cotton bollworm larvae after it is fully absorbed.

[0021] The present invention has at least one of the following beneficial effects: 1. The transcription factor Taiman is an important transduction factor in the juvenile hormone signaling pathway. This invention proves that the Taiman gene can be used as a molecular target for pesticide design, and designs its inhibitory factor ds Or It can inhibit the expression of Taiman gene of cotton bollworm, thereby inhibiting the molting of cotton bollworm, thereby causing abnormal molting and death of cotton bollworm.

[0022] 2. The present invention also Or Mixed with chitosan to prepare CS-ds Or Nanocomplex, using the natural feeding method of larvae, wrapping ds with nanomaterials Or It was delivered into the larvae and successfully silenced the expression of the target gene Taiman, significantly improving the interference efficiency of the target gene. The results showed that 79.17% of the test larvae died due to molting failure.

[0023] 3. The present invention confirms that Taiman can be used as a target gene for RNAi control of cotton bollworm, and the nanomaterial-mediated delivery system can significantly improve the silencing efficiency of the target gene. The combination of the two will show great application value in the development of cotton bollworm control technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The agarose gel electrophoresis method for detecting different concentrations of ds GFP Fusion effect with chitosan ammonium salt nanoparticles. Lane M is Maker, and lane 1 is 1 μg / μL ds GFP Lane 2 is CS+2 μg / μLds GFP Lane 3 is CS+1 μg / μL ds GFP Lane 4 is CS+0.5 μg / μL ds GFP Lane 5 is CS+0.25 μg / μLds GFP Lane 6 is CS+0.125 μg / μL ds GFP .

[0025] Figure 2 Agarose gel electrophoresis detection of CS-ds in Example 1 of the present invention GFP The stability of the complex was tested after treatment with 4th instar cotton bollworm enteric matter or RNase A. Lane M is Maker, and lanes 1 to 3 are ds GFP , Lanes 4 to 6 are ds GFP+ Intestinal solution, lanes 7 to 9 are CS+ds GFP+ Intestinal solution, lanes 10 to 12 are ds GFP+ RNase A, lanes 13 to 15 are CS+ds GFP+ RNase A.

[0026] Figure 3 This is the detection of the silencing effect of the Taiman gene of cotton bollworm after feeding dsRNA for different time periods in Example 1 of the present invention. GFP :Feeding ds GFP CS: control group fed with chitosan. CS+ds GFP :Feeding chitosan-coated ds GFP Control group. ds Or : Feeding naked ds Or Experimental group. CS+ds Or :Feeding chitosan-coated ds Or Different lowercase letters indicate significant differences among treatments.

[0027] Figure 4 The effect of feeding cotton bollworm larvae with dsRNA targeting Taiman on larval mortality and pupation rate in Example 1 of the present invention. Wherein, A: mortality of cotton bollworm after 7 days of interference. B: pupation rate of cotton bollworm after interference. ds GFP :Feeding ds GFPCS: control group fed with chitosan. CS+ds GFP :Feeding chitosan-coated ds GFP Control group. ds Or : Feeding naked ds Or Experimental group. CS+ds Or :Feeding chitosan-coated ds Or Different lowercase letters indicate significant differences among treatments.

[0028] Figure 5 The effect of feeding cotton bollworm larvae with dsRNA targeting Taiman on larval molting in Example 1 of the present invention; wherein, ds GFP :Feeding ds GFP CS: control group fed with chitosan. CS+ds GFP :Feeding chitosan-coated ds GFP Control group. ds Or : Feeding naked ds Or Experimental group. CS+ds Or :Feeding chitosan-coated ds Or of the experimental group. DETAILED DESCRIPTION

[0029] In order to make the technical problems, technical solutions and beneficial effects solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0030] Unless otherwise specified, the reagents and biological materials used in the following examples are all commercial products. If no specific conditions are specified in the examples, the experiments were carried out according to conventional conditions or conditions recommended by the manufacturer.

[0031] The test insect sources in the following examples: cotton bollworm eggs were collected in Langfang, Hebei, and were raised in the laboratory for multiple generations using artificial feed. Cotton bollworm eggs were hatched in an artificial climate chamber at a temperature of 26±1°C and a relative humidity of 70%. Larvae were reared under the following conditions: temperature of 25±1°C, relative humidity of 40-50%, light intensity of 14 h: 10 h (L light: D dark), and cotton bollworm larvae were raised using artificial feed.

[0032] Example 1 1. Acquisition of cDNA templates from cotton bollworm Take the third-instar larvae of cotton bollworm, put them into a sterilized and pre-cooled mortar, add liquid nitrogen and grind them into powder. Take an appropriate amount of the powder and add 1 mL of Trizol ®Reagent (Invitrogen) was placed in a 1.5 mL RNase-free tube, vortexed to mix, placed on ice for 3-5 min, and then used TRIzol ® Total RNA was extracted using reagents, and then cDNA was synthesized using the FastKing One-Step Genomic cDNA First-Strand Synthesis Kit (Tiangen Biotechnology).

[0033] 2. Obtaining the Open Reading Frame (ORF) sequence of the Taiman gene of cotton bollworm According to the transcriptome database of cotton bollworm, a transcript encoding the Taiman gene of cotton bollworm was obtained by local BLAST method. Specific primers were designed to clone the ORF region sequence of the Taiman gene, and further sequencing was performed for verification.

[0034] The ORF region sequence of Taiman is shown in SEQ ID NO.1.

[0035] 3. Preparation of dsRNA targeting Taiman gene of cotton bollworm According to the ORF sequence of Taiman gene of cotton bollworm, the upstream and downstream primers with T7 promoter were designed by using Primer Premier 5.0 software, and the template with T7 promoter at both ends was obtained by PCR amplification.

[0036] Using cotton bollworm cDNA as template, high-fidelity Pfu DNA polymerase (Tiangen Technology) was used for PCR amplification. The PCR reaction system was as follows: SEQ ID NO. 3: TAATACGACTCACTATAGGGAAACACTTCTAAACCCCTGG SEQ ID NO. 4: TAATACGACTCACTATAGGGAAGGGTTGCGAGTGAGTTTC After mixing, the components were centrifuged. The PCR reaction conditions were as follows: pre-denaturation at 94°C for 1 min. 94°C for 30 s. 35 cycles: 59°C for 30 s; 72°C for 40 s. Extension at 72°C for 5 min. PCR products were detected by 1% agarose gel electrophoresis.

[0037] The positive clones were sent to Changsha Qingke Biotechnology Co., Ltd. for sequencing, and the strains with correct sequencing were added to LB liquid culture medium containing ampicillin for shaking and plasmid extraction. The plasmid was used as a template for large-scale PCR cloning, and the DNA product was purified and recovered using a DNA purification and recovery kit (Tiangen Biotechnology).

[0038] Using the purified product as a template, the recovered DNA was in vitro transcribed into dsRNA using an in vitro transcription system (T7 RiboMAX™ Express RNAiSystem, Promega) kit. After precipitation with sodium acetate-isopropanol and washing with 70% ethanol, it was placed in a clean bench to dry and dissolved in an appropriate amount of nuclease-free water. Take 1 μL of dsRNA product and add it to 9 μL of nuclease-free water. On the one hand, the purity and quality of the synthesized dsRNA were detected using 1% agarose gel, and on the other hand, the concentration of dsRNA was detected using a NanoPhotometer micro-spectrophotometer. The synthesized dsRNA was stored in a -80℃ refrigerator for future use.

[0039] The dsRNA of green fluorescent protein (GFP) was synthesized and purified according to the same steps. GFP ) was used as a negative control. The upstream and downstream primer sequences used for PCR amplification of the GFP fragment were ds GFP -T7F (SEQ ID NO. 5) and ds GFP -T7R (SEQ ID NO. 6).

[0040] SEQ ID NO. 5: TAATACGACTCACTATAGGAAGGGCGAGGAGCTGTTCACCG SEQ ID NO. 6: TAATACGACTCACTATAGGCAGCAGGACCATGTGATCGCGC 4. Preparation of CS-dsRNA nanocomposite particles and detection of fusion effect Use nuclease-free water to prepare a 0.1 M sodium acetate solution with a pH of 5.2, and then add an appropriate amount of chitosan ammonium salt to prepare a 0.04% (m / v) chitosan sodium acetate solution (CS) for use.

[0041] A 0.1 M sodium sulfate solution was prepared using nuclease-free water, and the prepared sodium sulfate solution was mixed with equal volumes of dsRNA with concentrations of 2 μg / μL, 1 μg / μL, 0.5 μg / μL, 0.25 μg / μL, and 0.125 μg / μL, respectively.

[0042] An equal volume of CS solution was added to the mixed solution, mixed well, and then allowed to stand at room temperature for 2-3 min, incubated at 55°C for 1 min, vortexed rapidly for 30 s, and then allowed to stand at room temperature for 15 min to obtain a CS-dsRNA nanocomplex.

[0043] The polymerization effect of dsRNA and CS was detected using 1% agarose gel. The results are as follows: Figure 1 As shown, lane M is Maker, and lane 1 is 1 μg / μL ds GFP Lane 2 is CS+2 μg / μL ds GFP Lane 3 is CS+1 μg / μL ds GFP Lane 4 is CS+0.5 μg / μL ds GFP Lane 5 is CS+0.25 μg / μL ds GFP Lane 6 is CS + 0.125 μg / μL ds GFP .

[0044] Figure 1 The results show that when ds GFP When the concentration was 0.25 μg / μL, CS and ds GFP The blocking of nucleic acid is most obvious when binding, and there is no obvious dragging and dispersion phenomenon at the gel hole, indicating that CS and ds GFP Aggregation works best.

[0045] 5. Stability testing of CS-dsRNA nanocomplexes after digestion with intestinal solution or ribonuclease A (RNase A) To CS-ds GFP 200 ng of RNase A (1 mg / mL) or intestinal solution of 4th instar larvae of cotton bollworm (100 mg / mL) were added to the nanoparticle complexes (1 μg of dsRNA).

[0046] Control group 1 was 1 μg of ds GFP Control group 2 and control group 3 were treated with 1 μg of ds GFP 200 ng of RNase A or intestinal solution of 4th instar cotton bollworm larvae (100 mg / mL) was added to the mixture and incubated in a metal bath at 37 °C for 2 h.

[0047] The protective effect of CS on dsRNA was detected by 1% agarose gel electrophoresis. Figure 2 As shown, lane M is Maker, and lanes 1-3 are ds GFP , Lanes 4-6 are ds GFP+ Intestinal solution, lanes 7-9 are CS+ds GFP+ Intestinal solution, lanes 10-12 are ds GFP+ RNase A, lanes 13-15 are CS+ds GFP+ RNase A.

[0048] The results showed that adding RNase A or enteric solution to ds GFP After the 450 bp size, no ds was detected GFP The bands (lanes 4-6; lanes 10-12) were not visible, while at 100-250 bp, diffuse bands appeared, indicating that ds GFP Degraded by intestinal solution or RNase A. When RNase A is added to CS-ds GFP After being loaded into the nanocomposite particles, clear and bright bands can still be seen in the loading wells (lanes 7-9; lanes 13-15), which proves that the nanoparticle CS has a good protective effect on dsRNA and prevents dsRNA from being degraded by intestinal solution or RNase A.

[0049] 6. CS-ds of cotton bollworm Taiman Or Applications of Nanocomposites Set ds separately GFP 、ds Or 、CS-ds GFP 、CS-ds Or CS and five different treatments. The 3rd instar cotton bollworm larvae were selected and starved for 5 h. The artificial diet of cotton bollworm was cut into 0.5 cm 3 Size, use a pipette to take 10 μL of nanocomplexes or dsRNA or CS, drop it on the surface of each feed, and transfer it to a 24-well plate after complete absorption, with a feed placed in each well. Then put the uniform and healthy early 3rd instar larvae of cotton bollworm that have been starved for 5 hours in each well. After treatment, the cotton bollworms were placed in an intelligent artificial climate box for continued breeding, with a temperature of 26±1℃, a photoperiod of 14 L: 10 D (14 h light: 10 h dark), and a relative humidity of 40-50%. Three biological replicates were set for each treatment, with no less than 24 individuals in each replicate. Total RNA was extracted after 24 h, 48 h, 72 h, 96 h, and 120 h of feeding, and the interference efficiency of the target gene was detected by qRT-PCR.

[0050] The primer sequences used are as follows: ß-actin-F (SEQ ID NO. 7): CTGGGACGATATGGAGAA ß-actin-R (SEQ ID NO. 8): CGAACATGATCTGTGTCA HaTai-F (SEQ ID NO. 9): CCATTTCGGTTGCGTATCG HaTai-R (SEQ ID NO. 10): ATGTCTTCGTCGCCCAGGA Figure 3This is the detection of the silencing effect of the Taiman gene of cotton bollworm after feeding dsRNA for different time periods in Example 1 of the present invention. GFP :Feeding ds GFP CS: control group fed with chitosan. CS+ds GFP :Feeding chitosan-coated ds GFP Control group. ds Or : Feeding naked ds Or Experimental group. CS+ds Or :Feeding chitosan-coated ds Or Experimental groups. Different lowercase letters indicate significant differences among treatments (Turkey test, P <0.05, SPSS Statistics 21). The results showed that relative to ds GFP Treatment group, fed CS-ds Or The maximum silencing effect of the complex reached 84.2% after 72 h ( P <0.001, and the silencing effect reached 62.90% at 96 h and 120 h, respectively ( P =0.042) and 38.75% ( P =0.66)( Figure 3 ).

[0051] Figure 4 The effect of feeding cotton bollworm larvae with dsRNA targeting Taiman on larval mortality and pupation rate. A: Mortality of cotton bollworm 7 days after interference. B: Pupation rate of cotton bollworm after interference. GFP :Feeding ds GFP CS: control group fed with chitosan. CS+ds GFP :Feeding chitosan-coated ds GFP Control group. ds Or : Feeding naked ds Or Experimental group. CS+ds Or :Feeding chitosan-coated ds Or The experimental groups were different. Different lowercase letters indicate significant differences among the treatments. The mortality rate of each group was statistically analyzed after 7 days of treatment. Or The larval mortality rate in the treatment group was 79.17%, significantly higher than that in the other groups ( Figure 4 A in ), and ds Or The mortality rate of the exposed group in the treatment group was 18.10%. Or The pupation rate of surviving individuals in the treatment group was only 13.10%, which was significantly lower than that of ds Or 86.30% of the naked group, ds GFP89.72% of the treatment group, 88.08% of the CS-treated group, and CS-ds GFP 86.82% ( Figure 4 B in the figure).

[0052] Figure 5 The effect of feeding cotton bollworm larvae with dsRNA targeting Taiman on larval molting, where ds GFP :Feeding ds GFP CS: control group fed with chitosan. CS+ds GFP :Feeding chitosan-coated ds GFP Control group. ds Or : Feeding naked ds Or Experimental group. CS+ds Or :Feeding chitosan wrapped ds Or The results showed that the larvae fed on CS-ds Or After the nanocomposite was added, there was an obvious phenomenon of molting failure and death ( Figure 5 ).

[0053] The above results prove that the ds Or Delivery into the larvae not only improves the stability of dsRNA, but also significantly increases the interference efficiency of the target gene Taiman. Therefore, natural feeding and nanomaterial-mediated RNAi will provide a new method for the control of cotton bollworm in the field.

[0054] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A cotton bollworm transcription factor Taiman, characterized in that The nucleotide sequence of its open reading frame is shown in SEQ ID NO.

1.

2. A suppressor of the transcription factor Taiman in cotton bollworm Tai , characterized in that, The inhibitory factor ds Tai It is a dsRNA capable of inhibiting the expression of the transcription factor Taiman gene, wherein the inhibitory factor ds Tai The nucleotide sequence is shown as SEQ ID NO.

2.

3. The inhibitory factor ds according to claim 2 Tai The preparation method is characterized in that The following steps are involved: Using the cDNA of cotton bollworm as a template, designing specific primers with a T7 promoter according to the nucleotide sequence of the open reading frame of the transcription factor Taiman, and performing PCR amplification on the template using the specific primers to obtain a PCR amplification product; The purified PCR amplification product was used as a template and in vitro transcription synthesis was performed using the kit T7 RiboMAX™ Express RNAiSystem to obtain the inhibitory factor ds Tai .

4. The preparation method according to claim 3, characterized in that: The specific primers include an upstream primer ds Tai -F and downstream primer ds Tai -R, the upstream primer ds Tai -F sequence is shown in SEQ ID NO. 3, the downstream primer ds Tai The sequence of -R is shown in SEQ ID NO.

4.

5. A CS-ds Tai The method for preparing a nanocomposite is characterized in that: The following steps are involved: The inhibitory factor dsTai according to claim 2 is formulated into ds Tai Solution; The ds Tai The solution was mixed with a chitosan sodium acetate solution having a mass volume percentage concentration of 0.04% in a volume ratio of 1:1 to obtain CS-ds Tai Nanocomposites.

6. A CS-ds Tai A nanocomposite, characterized in that The preparation method according to claim 5 is used to obtain the 7. A CS-ds as claimed in claim 6 Tai Application of nanocomposites in control of cotton bollworm.

8. The use according to claim 7, characterized in that: The CS-ds Tai The nanocomplex is ingested by the cotton bollworm through feeding.

9. The use according to claim 7, characterized in that: The cotton bollworm control is to inhibit the molting behavior of the cotton bollworm to cause its death.

10. The use according to claim 9, characterized in that: The inhibition of the molting behavior of cotton bollworm is achieved by reducing the expression level of Taiman gene of cotton bollworm.

Images