KASP marker closely linked with wheat thousand seed weight gene and application of KASP marker

Abstract

The invention relates to the technical field of molecular biology and crop breeding, in particular to a KASP marker closely linked with a wheat thousand seed weight gene and application of the KASP marker. The TGW265 is composed of a first primer or a derivative thereof, a second primer or a derivative thereof and a third primer; the TGW57 is composed of a fourth primer or a derivative thereof, a fifth primer or a derivative thereof and a sixth primer; the sequences of the first primer, the second primer, the third primer, the fourth primer, the fifth primer and the sixth primer are respectively as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6. The TGW265 and the TGW57 are molecular markers closely linked with thousand seed weight genes and can be used for molecular marker-assisted selection and screening of new wheat materials with high thousand seed weight. In addition, the KASP marker closely linked with the thousand seed weight gene is a molecular marker closely linked with the thousand seed weight gene, so that high-throughput and seedling-stage rapid auxiliary selection can be realized, and the breeding process is accelerated.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology and crop breeding, and in particular to a KASP marker closely linked to a wheat thousand-grain weight gene and an application thereof. Background Art

[0002] Wheat is one of the important food crops in my country. Faced with the dual pressures of my country's continued population growth and the continuous reduction of cultivated land area, it is particularly urgent to cultivate high-yield and stable-yield wheat varieties. Wheat yield is the result of the combined effect of multiple factors, among which thousand-grain weight, number of grains per ear and number of ears per mu constitute the three major elements of wheat yield. Among these factors, thousand-grain weight has become a relatively stable factor in improving wheat yield potential due to its high heritability. Exploring the key sites or genes of wheat thousand-grain weight and developing tightly linked molecular markers are of great significance for the improvement of wheat thousand-grain weight.

[0003] At present, a series of grain weight-related genes have been identified in wheat through homologous cloning of thousand-grain weight genes in model plants such as rice and Arabidopsis. Only a few genes have been obtained through forward cloning, including Tasg-D1, KAT-2A, TaACT7-D, TaTGW-7A, TaTPP-7A, and TaGL1. Among them, KAT-2A (Chen Y et al., 2020) and TaACT7-D (Li X et al., 2023) were located on chromosomes 6B and 1DS respectively by using mutants produced by EMS mutagenesis. TaTGW-7A is the earliest cloned wheat thousand-grain weight gene. Haplotype analysis found that the dominant allele TaTGW-7Aa with high thousand-grain weight has a high frequency in the core germplasm of Chinese wheat (65.0%) and 501 wheat varieties (86.0%), indicating that this allele has a strong positive selection effect in wheat breeding (Hu MJ, et al., 2016). TaTPP-7A is located on the short arm of chromosome 7A and encodes trehalose-6-phosphate phosphatase. This gene is specifically expressed during grain development and affects grain filling and size. Further studies have found that TaTPP-7A is an important target gene for domestication breeding, which mainly regulates the cleavage, transportation and utilization of endosperm sucrose through the T6P-SnRK1 pathway and sugar-abscisic acid interaction feedback (Liu H, et al., 2023). Tasg-D1 encodes a serine / threonine protein kinase glycogen synthase kinase 3 (GSK3) containing a TREE domain, which has a single cause and multiple effects, and simultaneously affects multiple traits such as plant height, 1000-grain weight, ear length, and ear density (Cheng X, et al., 2020). TaGL1 is located on chromosome 1B, and a 97bp insertion / deletion was found in the ninth intron, which co-segregated with the grain length phenotype. Overexpression of TaGL1 increased wheat grain length by 10.14% and 1000-grain weight by 12.45%. TaGL1 termination mutation can cause wheat grain length to decrease by 10.60-11.74% and 1000-grain weight to decrease by 16.33-36.53%, indicating that TaGL1 positively regulates wheat grain length, thereby changing total grain weight (Niaz M, et al., 2023).

[0004] A large number of QTLs related to grain weight have been found in wheat, and GS7D (Zhang YJ, et al., 2014), TG23 (Hu MJ, et al., 2016), TaGW8-7B (Yan XF, et al., 2019), TaSus2-2B (Hu MJ, et al., 2016), and TaGW8-7B (Yan XF, et al., 2019) have been developed. tgw(Shi Jia et al., 2018), CWI22 (Ma DY et al., 2012), CWI21 (Ma DY et al., 2012) and TKX3D (Lu J et al., 2015) and other corresponding functional markers can quickly and accurately identify the distribution of genes and their variant types that control grain weight in different wheat varieties. Against the backdrop of the continued growth of the global population, the surge in food demand has made research on increasing wheat yields particularly urgent. Therefore, exploring and utilizing more and richer new grain weight gene resources has become an important task in wheat breeding and research, and is of great significance for breeding new high-yield and widely adaptable wheat varieties. Summary of the invention

[0005] The purpose of the present invention is to provide a KASP marker closely linked to a wheat thousand-grain weight gene and its application, so as to screen wheat high thousand-grain weight new materials and accelerate the breeding process.

[0006] The technical solution for which the present invention seeks protection is as follows:

[0007] The present invention provides a KASP marker closely linked to a wheat thousand-grain weight gene, including TGW265 and TGW57; wherein the TGW265 is composed of a first primer or a derivative thereof, a second primer or a derivative thereof, and a third primer; and the TGW57 is composed of a fourth primer or a derivative thereof, a fifth primer or a derivative thereof, and a sixth primer;

[0008] The sequences of the first primer, the second primer, the third primer, the fourth primer, the fifth primer and the sixth primer are shown as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

[0009] The derivative of the first primer is a single-stranded DNA molecule as shown in SEQ ID NO:1 with the 5' end connected to the first fluorescent sequence; the derivative of the second primer is a single-stranded DNA molecule as shown in SEQ ID NO:2 with the 5' end connected to the second fluorescent sequence; the first fluorescent sequence is the fluorescent sequence FAM; the second fluorescent sequence is the fluorescent sequence HEX.

[0010] The derivative of the fourth primer is a single-stranded DNA molecule as shown in SEQ ID NO:4 with the 5' end connected to a third fluorescent sequence; the derivative of the fifth primer is a single-stranded DNA molecule as shown in SEQ ID NO:5 with the 5' end connected to a fourth fluorescent sequence; the third fluorescent sequence is the fluorescent sequence FAM; and the fourth fluorescent sequence is the fluorescent sequence HEX.

[0011] The nucleotide sequences of the two forward primers for the TGW265 alleles with different terminal bases are: 5'GAAGGTGACCAAGTTCATGCTccagaataacttccgcttccaC 3' (SEQ ID NO: 7), 5'GAAGGTCGGAGTCAACGGATTccagaataacttccgcttccaT 3' (SEQ ID NO: 8),

[0012] The nucleotide sequence of the TGW265 universal reverse primer is: 5'gacgagtcctcaataattCgataC 3' (SEQ ID NO: 3);

[0013] The nucleotide sequences of the two forward primers for the TGW57 alleles with different terminal bases are: 5'GAAGGTGACCAAGTTCATGCTggggtccagagagtcaccG 3' (SEQ ID NO: 9), 5'GAAGGTCGGAGTCAACGGATTggggtccagagagtcaccA 3' (SEQ ID NO: 10),

[0014] The nucleotide sequence of the TGW57 universal reverse primer is: 5'accaaggctcgaaacatgcaG 3' (SEQ ID NO: 6).

[0015] The invention also provides a PCR reagent containing the KASP marker closely linked to the wheat thousand-grain weight gene.

[0016] The invention also provides a test kit containing a KASP marker closely linked to a wheat thousand-grain weight gene or the PCR reagent.

[0017] The use of the KASP marker closely linked to the wheat thousand-grain weight gene, the PCR reagent, or the kit in at least one of the following also falls within the protection scope of the present invention:

[0018] (A) Identify or assist in identifying wheat thousand-grain weight;

[0019] (B) preparing and identifying or assisting in the identification of wheat thousand-grain weight products;

[0020] (C) detecting, selecting or breeding high thousand-grain weight wheat;

[0021] (D) preparing, testing, screening or breeding high thousand-grain weight wheat products;

[0022] (E) Identification or auxiliary identification of wheat thousand-grain weight genotypes.

[0023] The present invention also provides a method for identifying or assisting in identifying the thousand-grain weight of wheat, comprising the following steps: performing a KASP reaction on the wheat to be tested using the KASP marker tightly linked to the wheat thousand-grain weight gene, detecting the reaction product, and the thousand-grain weight of the wheat to be tested whose reaction product produces a color such as the color of the fluorescent sequence connected to the 5' end of the DNA molecule shown in SEQ ID NO:1 or SEQ ID NO:4 is greater than the thousand-grain weight of the wheat to be tested whose reaction product produces a color such as the color of the fluorescent sequence connected to the 5' end of the DNA molecule shown in SEQ ID NO:2 or SEQ ID NO:5.

[0024] The present invention also provides a method for identifying or assisting in identifying the thousand-grain weight genotype of wheat, comprising the following steps: using the KASP marker tightly linked to the wheat thousand-grain weight gene to perform a KASP reaction on the wheat to be tested, detecting the reaction product, and the wheat to be tested whose reaction product produces a color such as the fluorescent sequence connected to the 5' end of the DNA molecule shown in SEQ ID NO: 1 or SEQ ID NO: 4 is a high thousand-grain weight genotype wheat.

[0025] The present invention locates the thousand-grain weight gene on chromosome 4A through BSA-Seq preliminary positioning analysis; and uses KASP molecular marker development and genetic linkage map construction to determine that the thousand-grain weight is located in the approximately 3.05cM interval of 4AS markers TGW265 and TGW57. TGW265 and TGW57 are molecular markers that are closely linked to the thousand-grain weight gene and can be used for molecular marker-assisted selection to screen new wheat materials.

[0026] Beneficial effects:

[0027] The present invention provides a KASP marker tightly linked to a wheat thousand-grain weight gene and its application, wherein the marker includes TGW265 and TGW57, wherein TGW265 and TGW57 are molecular markers tightly linked to the thousand-grain weight gene, and can be used for molecular marker-assisted selection to screen wheat high thousand-grain weight new materials. In addition, the KASP marker tightly linked to the thousand-grain weight gene of the present invention is a molecular marker tightly linked to the thousand-grain weight gene, which can realize high-throughput, rapid assisted selection at the seedling stage, and accelerate the breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 1000-grain weight comparison of the wild-type Jing 411 and the mutant je0193 in the examples of the present invention; wherein: in A, the left is the wild-type Jing 411, and the right is the mutant je0193; in B, the left is the wild-type Jing 411, and the right is the mutant je0193.

[0029] Figure 2 This is a schematic diagram of the initial positioning analysis of the thousand-grain weight gene in the examples of the present invention.

[0030] Figure 3Schematic diagram of the genetic location of the thousand-grain weight gene on chromosome 4AS in the examples of the present invention.

[0031] Figure 4 : These are the TGW265 and TGW57 KASP marker detection results in the embodiments of the present invention; blue dots represent samples of the wild-type Jing411 genotype, red dots represent samples of the mutant je0193 genotype, and green dots represent heterozygous samples; wherein A is the TGW265 KASP marker detection result; and B is the TGW57 KASP marker detection result. DETAILED DESCRIPTION

[0032] The present invention will be further described in detail below in conjunction with specific examples. It should be understood that the following examples are only for explanation and illustration and do not limit the scope of the present invention in any way.

[0033] First Group of Examples: KASP Markers Tightly Linked to Wheat Thousand-Grain Weight Genes

[0034] This group of embodiments provides KASP markers closely linked to wheat thousand-grain weight genes, including TGW265 and TGW57; wherein the TGW265 is composed of a first primer or a derivative thereof, a second primer or a derivative thereof, and a third primer; and the TGW57 is composed of a fourth primer or a derivative thereof, a fifth primer or a derivative thereof, and a sixth primer;

[0035] The sequences of the first primer, the second primer, the third primer, the fourth primer, the fifth primer and the sixth primer are respectively shown in SEQ ID NO:1 (ccagaataac ttccgcttcc ac), SEQ ID NO:2 (ccagaataac ttccgcttccat), SEQ ID NO:3 (gacgagtcct caataattCg ataC), SEQ ID NO:4 (ggggtccagagagtcaccg), SEQ ID NO:5 (ggggtccaga gagtcaccA) and SEQ ID NO:6 (accaaggctcgaaacatgca g).

[0036] The derivative of the first primer is a single-stranded DNA molecule as shown in SEQ ID NO:1 with the 5' end connected to the first fluorescent sequence; the derivative of the second primer is a single-stranded DNA molecule as shown in SEQ ID NO:2 with the 5' end connected to the second fluorescent sequence; the first fluorescent sequence is the fluorescent sequence FAM; the second fluorescent sequence is the fluorescent sequence HEX.

[0037] The derivative of the fourth primer is a single-stranded DNA molecule as shown in SEQ ID NO:4 with the 5' end connected to a third fluorescent sequence; the derivative of the fifth primer is a single-stranded DNA molecule as shown in SEQ ID NO:5 with the 5' end connected to a fourth fluorescent sequence; the third fluorescent sequence is the fluorescent sequence FAM; and the fourth fluorescent sequence is the fluorescent sequence HEX.

[0038] The nucleotide sequences of the two forward primers for the TGW265 alleles with different terminal bases are: 5'GAAGGTGACCAAGTTCATGCTccagaataacttccgcttccaC 3' (SEQ ID NO: 7), 5'GAAGGTCGGAGTCAACGGATTccagaataacttccgcttccaT 3' (SEQ ID NO: 8),

[0039] The nucleotide sequence of the TGW265 universal reverse primer is: 5'gacgagtcctcaataattCgataC3' (SEQ ID NO: 3);

[0040] The nucleotide sequences of the two forward primers for the TGW57 alleles with different terminal bases are: 5'GAAGGTGACCAAGTTCATGCTggggtccagagagtcaccG3' (SEQ ID NO: 9), 5'GAAGGTCGGAGTCAACGGATTggggtccagagagtcaccA3' (SEQ ID NO: 10),

[0041] The nucleotide sequence of the TGW57 universal reverse primer is: 5'accaaggctcgaaacatgcaG3' (SEQ ID NO: 6).

[0042] Second Group of Embodiments: A PCR Reagent

[0043] This group of embodiments provides PCR reagents containing the KASP marker tightly linked to the wheat thousand-grain weight gene.

[0044] The third embodiment, a kit

[0045] This group of embodiments provides a kit containing a KASP marker tightly linked to a wheat thousand-grain weight gene or the PCR reagent.

[0046] Fourth group of embodiments: Application of KASP markers or PCR reagents or kits

[0047] This group of embodiments provides the use of the KASP marker tightly linked to the wheat thousand-grain weight gene described in the first group of embodiments, the PCR reagent described in the second group of embodiments, or the kit described in the third group of embodiments in at least one of the following:

[0048] (A) Identify or assist in identifying wheat thousand-grain weight;

[0049] (B) preparing and identifying or assisting in the identification of wheat thousand-grain weight products;

[0050] (C) detecting, selecting or breeding high thousand-grain weight wheat;

[0051] (D) preparing, testing, screening or breeding high thousand-grain weight wheat products;

[0052] (E) Identification or auxiliary identification of wheat thousand-grain weight genotypes.

[0053] Fifth group of embodiments: Method for identifying or assisting in identifying wheat thousand-grain weight

[0054] This group of embodiments provides a method for identifying or assisting in identifying the thousand-grain weight of wheat, comprising the following steps: performing a KASP reaction on the wheat to be tested using the KASP marker tightly linked to the wheat thousand-grain weight gene, detecting the reaction product, and the thousand-grain weight of the wheat to be tested whose reaction product produces a color such as the color of the fluorescent sequence connected to the 5' end of the DNA molecule shown in SEQ ID NO:1 or SEQ ID NO:4 is greater than the thousand-grain weight of the wheat to be tested whose reaction product produces a color such as the color of the fluorescent sequence connected to the 5' end of the DNA molecule shown in SEQ ID NO:2 or SEQ ID NO:5.

[0055] Sixth group of embodiments: Method for identifying or assisting in identifying wheat thousand-grain weight genotypes

[0056] This group of embodiments provides a method for identifying or assisting in identifying the thousand-grain weight genotype of wheat, comprising the following steps: performing a KASP reaction on the wheat to be tested using the KASP marker tightly linked to the wheat thousand-grain weight gene, detecting the reaction product, and the wheat to be tested whose reaction product produces a color such as the fluorescent sequence connected to the 5' end of the DNA molecule shown in SEQ ID NO: 1 or SEQ ID NO: 4 is a high thousand-grain weight genotype wheat.

[0057] Experimental example

[0058] Sources of biological materials:

[0059] Wild type wheat: Jing 411, a known variety that has passed variety approval (purchased from Beijing Seed Company).

[0060] Wheat mutant je0193: It is a stable 1000-grain weight mutant material derived from Jing 411 by EMS mutagenesis. The public can obtain it from the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. The mutagenesis method is as follows: After soaking Jing 411 dry seeds in water for 10 hours, they are treated with 1.0% EMS for 4 hours and gently shaken at 50 rpm in the dark. The treated seeds are rinsed under running water for 4 hours and then planted in the field. After 6 consecutive generations of planting, the stable 1000-grain weight mutant je0193 was screened out.

[0061] Experimental Example 1: Comparison of 1000-grain weight between wild type and mutant je0193

[0062] 1. Experimental Materials and Methods

[0063] The wild type Jing 411 and mutant je0193 were planted in the experimental field of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, with 15 plants per row and a row length of 2 meters. After the wheat matured and harvested in June, the thousand-grain weight was measured using the Wanshen SC-G automatic seed analysis and dry grain weight meter (Hangzhou Wanshen Testing Technology Co., Ltd.). The thousand-grain weight was measured for three consecutive years from 2022 to 2024, with at least 5 replicates each time.

[0064] 2. Experimental results

[0065] The thousand-grain weight of wild-type Jing 411 and mutant je0193 was identified. After three consecutive years of measurement, the results showed that the thousand-grain weight of wild-type Jing 411 and mutant je0193 were 44.7-58.7g and 29.1-45.4g, respectively. Through statistical comparison, it was found that the thousand-grain weight of mutant je0193 was significantly lower than that of wild-type Jing 411 (P<0.0001); compared with the wild type, the thousand-grain weight of mutant je0193 was reduced by 30% ( Figure 1 (middle B).

[0066] Experimental Example 2: Preliminary localization of thousand-grain weight genes based on exon capture resequencing

[0067] 1. Genetic population construction and experimental methods

[0068] The mutant je0193 was reciprocally crossed with the wild-type parent Jing 411 to obtain an F2 population with 524 individual plants for subsequent gene location analysis. Leaf samples of individual plants in the two F2 populations were taken and DNA was extracted for subsequent location analysis. Under normal field cultivation conditions, seeds were harvested after wheat matured and the thousand-grain weight of each plant was measured.

[0069] According to the phenotypic data of thousand-grain weight, 15-25 high and low thousand-grain weight extreme individuals were selected from the two F2 populations, and their DNA was mixed in equal amounts to construct extreme high thousand-grain weight pools and low thousand-grain weight pools. The mixed pool DNA and the two parents' DNA were resequenced using whole exon capture resequencing. Based on the genotype data obtained by resequencing, the QTLseqr algorithm was used to filter and analyze the differential sites of the mixed pool and parents to determine the chromosome segment of the thousand-grain weight gene.

[0070] 2. Experimental results

[0071] Combined with the BSA set segregation analysis method, the QTLseqr algorithm was used to filter and screen the exon capture sequencing data of the high and low 1000-grain weight F2 plant pools. According to the genotypes and sequencing depth of the obtained differential loci, combined with the phenotypic information of the pool, ED association analysis was performed, and the ED value was used to reflect the linkage strength between the SNP locus and the 1000-grain weight gene. A QTL controlling 1000-grain weight was found on chromosome 4A ( Figure 2 ).

[0072] Experimental Example 3: Analysis and verification of genetic linkage mapping of 1000-grain weight gene

[0073] 1. Experimental Methods

[0074] According to the polymorphic sites on chromosome 4A of the two parents Jing 411 and je0193 obtained by exon capture resequencing, two allele forward primers with different terminal bases and one reverse primer were designed based on the known flanking sequences, and sequences with different fluorescent probes were connected to the 5' ends of the two forward primers. The genotype of the sample can be determined by the fluorescent signal detected after PCR amplification using KASP Master mix (LGC). According to the SNP sites of Jing 411 and je0193 on chromosome 4A, a total of 67 pairs of KASP marker primers were designed. By detecting the genotypes of the parents and some populations, 14 pairs of KASP markers with good genotyping were screened and obtained for the construction of genetic linkage maps.

[0075] A total of 524 plants in the F2 population of Jing 411 / je0193 were analyzed, and the genotypes of each plant were determined using KASP marker detection. Combined with the genotype and 1000-grain weight phenotype data, genetic linkage analysis of the 1000-grain weight gene was performed using QTL IciMapping 4.0 software.

[0076] A pair of KASP markers TGW265 and TGW57 tightly linked to the wheat thousand-grain weight gene were obtained by the above method. The nucleotide sequences of the two forward primers for the TGW265 alleles with different terminal bases were: 5'GAAGGTGACCAAGTTCATGCTccagaataacttccgcttccaC 3' (SEQ ID NO:7), 5'GAAGGTCGGAGTCAACGGATTccagaataacttccgcttccaT 3' (SEQ ID NO:8), the nucleotide sequence of the universal reverse primer for TGW265 was: 5'gacgagtcctcaataattCgataC 3' (SEQ ID NO:3), and the length of the amplified band was 54 bp; the nucleotide sequences of the two forward primers for the TGW57 alleles with different terminal bases were: 5'GAAGGTGACCAAGTTCATGCTggggtccagagagtcaccG 3' (SEQ ID NO:9), 5'GAAGGTCGGAGTCAACGGATTggggtccagagagtcaccA 3' (SEQ ID NO:10), ID NO: 10), the nucleotide sequence of the TGW57 universal reverse primer is: 5'accaaggctcgaaacatgcaG 3' (SEQ ID NO: 6), and the length of the amplified band is 29 bp.

[0077] The fluorescent label sequences connected to the 5' ends of the forward primers of TGW265 and TGW57 are respectively: FAM and HEX; the sequences of FAM and HEX are shown in SEQ ID NO: 11 (5'GAAGGTGACCAAGTTCATGCT) and SEQ ID NO: 12 (5'GAAGGTCGGAGTCAACGGATT).

[0078] The TGW265 and TGW57 KASP reaction system is: 2×KASP Master mix 2.5μL, primer mix 0.07μL (two forward primers 12μL each, universal primer 36μL, and 40μL ultrapure water to 100μL, i.e. primer mix), 50mM MgCl2 0.04μL, 30ng genomic DNA, ultrapure water to 5μL. The PCR amplification program is: 94℃ pre-denaturation 15min; 94℃ denaturation 20s, 65℃ annealing 1min, a total of 9 cycles, each cycle lowering 0.6℃; 94℃ denaturation 20s, 57℃ annealing 1min, a total of 30 cycles.

[0079] The PCR product results were obtained by fluorescence signal detection using a FLUOstar Omega microplate reader. The amplified products with FAM sequence tags were marked in blue, and the amplified products with HEX sequence tags were marked in red. The primers for the FAM sequence tags were C site (TGW265) or G site (TGW57), and the primers for the HEX sequence tags were T site (TGW265) or A site (TGW57).

[0080] 2. Experimental results

[0081] The F2 segregating population was genotyped using KASP markers to obtain the population genotype, and a genetic linkage map was constructed based on the phenotype. The results showed that the thousand-grain weight gene was located at the 3.05 cM interval between markers TGW265 and TGW57 on the short arm of chromosome 4A (calculated by QTL IciMapping 4.0 software) ( Figure 3 ), the LOD value was 4.12, and the phenotypic contribution rate was 3.95% (the calculation method of LOD value and phenotypic contribution rate can be found in the following non-patent literature: Meng et al. 2015, QTL IciMapping: Integrated software for genetic linkage map construction and quantitative trait locus mapping in biparental populations. Crop Journal 3, 269-283.).

[0082] By fluorescence signal detection (FLUOstar Omega microplate reader), TGW265 ( Figure 4 Middle A) and TGW57 marker ( Figure 4 Middle B) The mutant je0193 genotype (red dots) and the Jing 411 genotype (blue dots) can be clearly separated. The genotypic information obtained using these two markers will predict the presence of the thousand-grain weight gene.

Claims

1. A KASP marker tightly linked to a wheat thousand-grain weight gene, characterized in that: Including TGW265 and TGW57; The TGW265 consists of a first primer or a derivative thereof, a second primer or a derivative thereof, and a third primer; The TGW57 is composed of a fourth primer or a derivative thereof, a fifth primer or a derivative thereof, and a sixth primer; The sequences of the first primer, the second primer, the third primer, the fourth primer, the fifth primer and the sixth primer are shown as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

2. The KASP marker tightly linked to the wheat thousand-grain weight gene according to claim 1, characterized in that: The derivative of the first primer is a single-stranded DNA molecule as shown in SEQ ID NO: 1 with its 5' end connected to a first fluorescent sequence; the derivative of the second primer is a single-stranded DNA molecule as shown in SEQ ID NO: 2 with its 5' end connected to a second fluorescent sequence.

3. The KASP marker tightly linked to the wheat thousand-grain weight gene according to claim 2, characterized in that: The first fluorescent sequence is the fluorescent sequence FAM; the second fluorescent sequence is the fluorescent sequence HEX.

4. The KASP marker tightly linked to the wheat thousand-grain weight gene according to claim 1, characterized in that: The derivative of the fourth primer is a single-stranded DNA molecule as shown in SEQ ID NO:4 with its 5' end connected to a third fluorescent sequence; the derivative of the fifth primer is a single-stranded DNA molecule as shown in SEQ ID NO:5 with its 5' end connected to a fourth fluorescent sequence.

5. The KASP marker tightly linked to the wheat thousand-grain weight gene according to claim 4, characterized in that: The third fluorescent sequence is the fluorescent sequence FAM; the fourth fluorescent sequence is the fluorescent sequence HEX.

6. A PCR reagent, characterized in that The PCR reagent comprises the KASP marker tightly linked to the wheat thousand-grain weight gene as described in any one of claims 1-5.

7. A kit, characterized in that: The kit comprises the PCR reagent of claim 6 or the KASP marker tightly linked to the wheat thousand-grain weight gene of any one of claims 1-5.

8. Use of the KASP marker tightly linked to the wheat thousand-grain weight gene according to any one of claims 1 to 5, the PCR reagent according to claim 6, or the kit according to claim 7 in at least one of the following: (A) Identify or assist in identifying wheat thousand-grain weight; (B) preparing and identifying or assisting in the identification of wheat thousand-grain weight products; (C) detecting, selecting or breeding high thousand-grain weight wheat; (D) preparing, testing, screening or breeding high thousand-grain weight wheat products; (E) Identification or auxiliary identification of wheat thousand-grain weight genotypes.

9. A method for identifying or assisting in identifying wheat thousand-grain weight, characterized in that: The method comprises the following steps: performing a KASP reaction on wheat to be tested using the KASP marker tightly linked to the wheat thousand-grain weight gene as described in any one of claims 2 to 5, detecting the reaction product, and the thousand-grain weight of wheat to be tested whose reaction product produces a color as the 5' end of the DNA molecule shown in SEQ ID NO: 1 or SEQ ID NO: 4 connected to the fluorescent sequence is greater than the thousand-grain weight of wheat to be tested whose reaction product produces a color as the 5' end of the DNA molecule shown in SEQ ID NO: 2 or SEQ ID NO: 5 connected to the fluorescent sequence.

10. A method for identifying or assisting in identifying wheat thousand-grain weight genotypes, characterized in that: The method comprises the following steps: using the KASP marker tightly linked to the wheat thousand-grain weight gene as described in any one of claims 2 to 5 to carry out KASP reaction on the wheat to be tested, detecting the reaction product, and the wheat to be tested whose reaction product produces the color of the fluorescent sequence connected to the 5' end of the DNA molecule shown in SEQ ID NO: 1 or SEQ ID NO: 4 is a wheat of high thousand-grain weight genotype.

Images