Fusion protein of CD3 antibody and luciferase and application thereof

Abstract

The invention discloses a fusion protein of a CD3 antibody and luciferase and application of the fusion protein. The fusion protein comprises a CD3 antibody and luciferase which is subjected to fusion expression with the CD3 antibody, and the fusion protein can be combined with CD3 and emits light after catalyzing a substrate of the luciferase. The antibody luciferase fusion protein provided by the invention is used for ELISA detection, has the advantages of few reaction steps, low cost, no need of a fluorescent light source and the like, and can be applied to clinical detection or related scientific research.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a fusion protein of a CD3 antibody and luciferase and an application thereof. Background Art

[0002] The CD3 protein is a T cell marker that is only found in T cells. In malignant lymphomas, CD3 is a broad T cell lineage-restricted antigen that can be detected in 80% to 97% of T cell lymphomas. CD3 is an important marker for the classification of malignant lymphomas and lymphoid leukemias. CD3 plays a signaling role by forming a complex with the T cell receptor (TCR) on the surface of T lymphocytes. When the antigen presenting cell (APC) activates the TCR, the TCR-mediated signal is transmitted across the cell membrane through the CD3 chains CD3D, CD3E, CD3G and CD3Z, and the TCR-CD3 complex assembly is initiated by forming two heterodimers, CD3D / CD3E and CD3G / CD3E. In addition to the role of signal transduction in T cell activation, CD3E also plays a vital role in the correct development of T cells. Therefore, as an important target for drug development, the development of CD3E antibodies has received widespread attention; in scientific research, it is also necessary to develop antibodies that can easily and quickly detect this target.

[0003] Enzyme-linked immunosorbent assay (hereinafter referred to as ELISA) is the most widely used technology in enzyme immunoassay technology. Its basic method is to adsorb known antigens or antibodies on the surface of a solid phase carrier, allow the enzyme-labeled antigen-antibody reaction to proceed on the solid phase surface, and use a washing method to wash away the free components in the liquid phase. Commonly used ELISA methods include double antibody sandwich method and indirect method. The former is used to detect macromolecular antigens, and the latter is used to determine specific antibodies. In various immunoassays such as WB, ELISA, and immunofluorescence, secondary antibodies are often used in combination with primary antibodies to detect target proteins. Many secondary antibodies carry markers, such as fluorescent dyes or horseradish peroxidase (HRP), so that the signal of the secondary antibody can be detected. Primary antibodies with markers can also be used in experiments, but the primary antibodies are chemically labeled (coupled) in a complex and expensive way, and the coupling reaction (with amino acid specificity) may also interfere with the recognition of the antigen by the primary antibody.

[0004] Schematic diagram of the ELISA technology principle for commonly used antigen detection Figure 1 As shown, the basic method is to adsorb known antigens or antibodies on the surface of a solid phase carrier, detect the antigen through an antibody coupled to a fluorescent label or HRP, or detect the primary antibody through a labeled secondary antibody to briefly identify the antigen or antibody.

[0005] Direct detection of antigens requires labeling or coupling of the primary antibody, which is costly and may reduce the sensitivity of antibody-antigen recognition. Indirect detection of antigens using secondary antibodies requires many reaction steps, and the binding efficiency of the secondary antibody and the primary antibody may affect the detection of the antigen. Summary of the invention

[0006] The technical problem to be solved by the present invention is that the prior art lacks a detection method suitable for CD3, and provides a fusion protein of a CD3 antibody and luciferase and its application. The fusion protein of the present invention does not require further modification such as coupling labeling of the antibody, has dual activity of antibody and luciferase, has immunological activity to specifically recognize antigens, and can be detected by the luminescent signal of luciferase.

[0007] The present invention solves the above technical problems through the following technical solutions.

[0008] The first aspect of the present invention provides a fusion protein, which includes a CD3 antibody and a luciferase expressed by fusion with the CD3 antibody. The fusion protein can bind to CD3 and emit light after catalyzing a substrate of the luciferase.

[0009] In some embodiments of the present invention, the CD3 is human CD3 or mouse CD3.

[0010] In some embodiments of the present invention, the CD3 is selected from free CD3 protein and tissues and cells expressing CD3;

[0011] In some embodiments of the present invention, the CD3 is a natural CD3 protein or a recombinant CD3 protein.

[0012] In some embodiments of the present invention, the luciferase is bacterial luciferase, firefly luciferase, pyralis luciferase, Renilla luciferase, Gaussia luciferase, Nanoluc luciferase or spiny shrimp luciferase; for example, Gaussia luciferase.

[0013] In some embodiments of the present invention, the structure of the CD3 antibody is IgG, Fab, scFV or VHH.

[0014] In some preferred embodiments of the present invention, the CD3 antibody comprises a heavy chain, and the heavy chain is expressed by fusion with the luciferase.

[0015] In some more preferred embodiments of the present invention, the heavy chain and the luciferase are connected via a flexible peptide to form a recombinant heavy chain.

[0016] In some specific embodiments of the present invention, the heavy chain comprises the amino acid sequence shown in SEQ ID NO:11.

[0017] In some specific embodiments of the present invention, the flexible peptide comprises the amino acid sequence shown in SEQ ID NO:12.

[0018] In some specific embodiments of the present invention, the amino acid sequence of the Gaussia luciferase is shown in SEQ ID NO:13.

[0019] In some specific embodiments of the present invention, the recombinant heavy chain further includes a heavy chain signal peptide, and the heavy chain signal peptide is conventional in the art, for example, comprising an amino acid sequence as shown in SEQ ID NO:10.

[0020] In some specific embodiments of the present invention, the recombinant heavy chain comprises the amino acid sequence shown in SEQ ID NO:1.

[0021] The fusion protein of the present invention has two activities. On the one hand, it can bind to the CD3 antigen in a targeted manner, and on the other hand, it can catalyze the self-luminescence of the luciferase substrate. Therefore, when applied to ELISA, it is not necessary to chemically couple or modify the antibody, and no secondary antibody is needed to detect the primary antibody. At the same time, it has the advantages of fewer reaction steps, low cost, and no need for a fluorescent light source, and can be applied to clinical testing or related scientific research.

[0022] The second aspect of the present invention provides an isolated nucleic acid encoding the fusion protein as described in the first aspect.

[0023] In some specific embodiments of the present invention, when the amino acid sequence of the recombinant heavy chain is as shown in SEQ ID NO:1, the nucleotide sequence encoding it is as shown in SEQ ID NO:2; wherein, the nucleotide sequence encoding the heavy chain signal peptide is positions 1-57 of the nucleotide sequence shown in SEQ ID NO:2, and the nucleotide sequence encoding the heavy chain is positions 58-744 of the nucleotide sequence shown in SEQ ID NO:2.

[0024] The third aspect of the present invention provides a recombinant vector, which comprises the nucleic acid as described in the second aspect.

[0025] The fourth aspect of the present invention provides a transformant, which comprises the nucleic acid as described in the second aspect or the recombinant vector as described in the third aspect.

[0026] The fifth aspect of the present invention provides a method for purifying a fusion protein, the method comprising expressing and purifying the fusion protein as described in the first aspect.

[0027] In some embodiments of the present invention, the purification method may be conventional in the art, such as ion exchange chromatography (Q column, P column), hydrophobic chromatography, heparin column chromatography, and / or ammonium sulfate precipitation.

[0028] The sixth aspect of the present invention provides a method for preparing a fusion protein, the method comprising culturing the transformant as described in the fourth aspect in a suitable culture medium to produce the fusion protein.

[0029] The seventh aspect of the present invention provides a method for detecting CD3, which comprises using the fusion protein as described in the first aspect to specifically target CD3 and simultaneously catalyze the self-luminescence of a substrate.

[0030] In some embodiments of the invention, the detection is for non-diagnostic purposes.

[0031] The eighth aspect of the present invention provides a conjugate of a protein or a fragment thereof, wherein the protein or the fragment thereof is the fusion protein or the fragment thereof as described in the first aspect.

[0032] In some embodiments of the present invention, the conjugate further comprises other functional protein molecules or small molecules, such as nucleic acids.

[0033] The ninth aspect of the present invention provides a use of the fusion protein as described in the first aspect or a conjugate of the protein or its fragment as described in the eighth aspect in ELISA, WB, in vitro clinical testing and sequencing.

[0034] The fusion protein and the conjugate of the protein or its fragments of the present invention are not only suitable for ELISA detection, but also can be used for WB detection when combined with a substrate with high stability. If the chemiluminescence camera is combined with a microscope, it can also be applied to immunohistochemistry detection. Because the luminescence pattern of luciferase is different from that of previous systems, it may have the advantage of low luminescence background compared with traditional methods.

[0035] On the basis of being in accordance with the common sense in the art, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0036] The reagents and raw materials used in the present invention are commercially available.

[0037] The positive and progressive effects of the present invention are:

[0038] The fusion protein of the CD3 antibody and luciferase of the present invention can be used to detect CD3, and the protein can specifically recognize CD3 and has the function of self-luminescence. The ELISA detection using the antibody-luciferase fusion protein provided by the present invention has the advantages of fewer reaction steps, low cost, no need for fluorescent light source, etc., and can be applied to clinical detection or related scientific research. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 Schematic diagram of the principle of ELISA technology commonly used to detect antigens.

[0040] Figure 2Schematic diagram of the CD3 antibody heavy chain and luciferase fusion protein expression plasmid anti-mCD3 Fab-H-Gluc_pEE12.4.

[0041] Figure 3 Schematic diagram of CD3 antibody light chain expression plasmid_anti-mCD3 Fab-L_pEE6.4.

[0042] Figure 4 This is the mCD3-2C11_mH_pEE12.4 plasmid sequence.

[0043] Figure 5 This is the purification result of CD3 Fab antibody Gluc fusion protein.

[0044] Figure 6 This is the result of luciferase activity detection of CD3 Fab antibody Gluc fusion protein.

[0045] Figure 7 The application of CD3 Fab antibody Gluc fusion protein in ELISA. DETAILED DESCRIPTION

[0046] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0047] In this example, luciferase protein and CD3 antibody were cloned and recombined by PCR technology to construct CD3 antibody / Gluc fusion protein recombinant vector, which was transfected into HEK293 cells, and the transfected cells were centrifuged at low temperature to obtain supernatant, and the supernatant was separated and purified by nickel column; ELISA experiment was used to identify the affinity activity of the antibody part of the fusion protein; enzyme activity experiment was used to identify the self-luminous activity of the luciferase part. The results showed that the fusion protein well retained the activity of the two parts of the protein.

[0048] Example 1: Construction of a recombinant eukaryotic expression vector of CD3 antibody-luciferase fusion protein

[0049] The fusion protein plasmid constructed in this example is a eukaryotic expression plasmid, wherein the CD3 antibody is a Fab antibody, and the expression plasmid map of the heavy chain and luciferase fusion protein is as shown in FIG. Figure 2 shown.

[0050] The expression plasmid of the CD3 antibody heavy chain and Gluc fusion protein (anti-mCD3-Fab-H-Gluc) containing a signal peptide includes the base sequence shown in SEQ ID NO: 2, and the amino acids encoded by it include the amino acid sequence shown in SEQ ID NO: 1, wherein the amino acids 1-19 are signal peptides (bold), the amino acids 20-248 are CD3 heavy chain sequences (italics), the 249-254 are flexible peptide sequences, and the 255-422 are Gaussia luciferase sequences (underlined). A purification tag containing 6 histidines (6×His) is fused to its C-terminus to facilitate protein purification, and the restriction sites at both ends are HindIII and EcoRI.

[0051] SEQ ID NO: 1:

[0052]

[0053] SEQ ID NO:2:

[0054]

[0055]

[0056] SEQ ID NO:3:

[0057]

[0058] SEQ ID NO:4:

[0059]

[0060] The expression plasmid map of CD3 antibody light chain is as follows Figure 3 shown.

[0061] The expression plasmid of the CD3 antibody light chain containing a signal peptide includes the base sequence shown in SEQ ID NO: 4, and the amino acids encoded by it include the amino acid sequence shown in SEQ ID NO: 3, wherein amino acids 1-20 are signal peptides (bold), and amino acids 21-234 are CD3 light chain sequences.

[0062] 1. Construction of heavy chain insert

[0063] The synthesized wild-type Gaussia luciferase (Gluc WT, GenBank: BAR71165.1) was dissolved in deionized water and diluted to 10 ng / μL as template DNA. KOD FX neo enzyme (Toyobo, KFX-201S) was used to prepare the PCR reaction system and PCR reaction according to its instructions to prepare the insert fragment. The primer sequences used in the PCR reaction are shown in Table 1, the reaction system is shown in Table 2, and the reaction conditions are shown in Table 3.

[0064] Table 1:

[0065]

[0066] Table 2:

[0067] Components Volume (μL) 2×PCR buffer 25 2mM dNTPs 10 10μM Primer insert-F 1.5 10μM Primer insert-R 1.5 Template DNA (10 ng / μL) 2.5 KOD FX Neo 1 PCR grade water 8.5 Total volume 50

[0068] Table 3:

[0069]

[0070] 0.5 μL of DpnI enzyme (NEB, R0176S) was added to the reaction system, and the template was digested by incubation at 37°C for 3 hours. Then, the product of about 627 bp was recovered from the gel, which was the insert fragment.

[0071] 1.2 Construction of heavy chain vector

[0072] Using mCD3-2C11_mH_pEE12.4 vector (SEQ ID NO: 5) as template, the plasmid map is as follows Figure 4 As shown, the vector is linearized by PCR to facilitate recombination with the inserted fragment. KOD FX neo enzyme is used to prepare the PCR reaction system and perform PCR reaction according to its instructions; wherein, the PCR reaction primers are shown in Table 4, the reaction system is shown in Table 5, and the reaction conditions are shown in Table 6.

[0073] Table 4:

[0074] name Sequence (5'-3') Upstream primer caccatcacggctcctgatgagaattcattgatcataatcag (SEQ ID NO:8) Downstream primer gcaagcttggatccgcgacccatttgctgtc(SEQ ID NO:9)

[0075] Table 5:

[0076]

[0077]

[0078] Table 6:

[0079]

[0080] Add 0.5 μL DpnI enzyme to the reaction system, incubate at 37°C for 3 hours to digest the template, and then recover the product of about 5318 bp from the gel, which is the linearized vector vector.

[0081] The insert and vector were recombined using the In-Fusion Cloning Kit (TAKARA, Z9648N) according to the reaction system shown in Table 7 and incubated at 50° C. for 15 minutes.

[0082] Table 7:

[0083] Components Volume (μL) insert(10ng / μL) 5 vector (10 ng / μL) 3 Premix 2 Total volume 10

[0084] Take 2.5 μL of the above reaction product and transform it into DH5α competent cells, spread it on a plate containing ampicillin with a final concentration of 100 μg / mL, pick a single clone from the plate the next day, extract the plasmid for sequencing, and ensure that the target fragment is correctly inserted into the vector. The obtained plasmid is the eukaryotic expression of recombinant CD3 antibody Gluc fusion protein plasmid anti-mCD3-Fab-H-Gluc_pEE12.4. Similarly, the light chain expression plasmid anti-mCD3 Fab-L_pEE6.4 can be obtained by PCR.

[0085] Example 2: Eukaryotic expression and protein purification of CD3 antibody-Gaussia luciferase fusion protein

[0086] The anti-mCD3-Fab-H-Gluc_pEE12.4 and anti-mCD3 Fab-L_pEE6.4 plasmids obtained in Example 1 were purified by ExpiFectamine TM The cells were transfected into 30 mL of Expi-CHO cells according to the instructions of the CHO transfection kit (Gibco, A29129). Seven days after transfection, the cell viability was less than 90%, and the cells were centrifuged at 8000 rpm for 10 min at 4°C and the supernatant was collected.

[0087] Add 2 mL of HisTrap FF filler (Cytiva, 17531806) to each handmade column (purchased from Bio-Tech, model F506607-0001# affinity chromatography column empty column), and rinse the equilibrated filler with 30 mL of binding buffer. Then add about 30 mL of filtered cell supernatant. Rinse 10 times (10 mL / time) with rinse buffer (50 mM Tris, pH 8.0, 250 mM NaCl, 10 mM imidazole), then elute the protein 4-5 times with 500 μL of elution buffer (50 mM Tris, pH 8.0, 250 mM NaCl, 300 mM imidazole), and collect the eluted proteins. The final purified sample was dialyzed or ultrafiltered into PBS, and the electrophoresis results were as follows: Figure 5As shown, the samples were quickly frozen in liquid nitrogen and stored at -80°C.

[0088] Example 3: Detection of the luciferase activity of the CD3 antibody Gaussia luciferase

[0089] The fusion protein prepared in Example 2 was diluted to 3 nM with substrate diluent (50 mM Tris, pH 8.0, 100 mM NaCl), and 10 μL was added to a black 96-well plate. Then 90 μL of substrate coelenterazine (CTZ) (purchased from Biolabs) diluted to 10 μM with the same solution was added, and the luminescence intensity was read using a microplate reader self-luminescence module.

[0090] The results are as follows Figure 6 As shown in the figure, when the substrate CTZ of Gluc luciferase is added to the antibody-luciferase fusion protein (black solid line), the luminescent signal is detected by the microplate reader, and the signal gradually weakens as the reaction time increases. While the substrate diluent is used as the blank control (dashed line), the microplate reader does not detect the signal, indicating that the signal in the fusion protein sample detected by the microplate reader is the luminescent signal catalyzed by luciferase.

[0091] Example 4: Application of CD3 antibody-luciferase fusion protein in ELISA

[0092] Coat 100 μL of the antigen CD3 protein at a concentration of 1 μg / mL on a black 96-well plate and incubate overnight at 4°C. Add 200 μL of PBST and wash with shaking for 10 min 3 times, and wash with shaking PBS 3 times. Add 200 μL of 2% BSA-PBS and block at 37°C for 1 hour. 200 μL of PBST, 5 minutes, wash 3 times. Add 100 μL of 1 μg / mL fusion protein solution and incubate at 37°C for 1 hour. 200 μL of PBST, 5 minutes, wash 3 times. Add 100 μL of the substrate coelenterazine diluted to 10 μM with a solution, and read the luminescence intensity using the self-luminescence module of an enzyme reader. Using irrelevant protein, no antibody 1, and no antigen as controls, the luciferase signal was detected only when the CD3-Fab-Gluc fusion protein was added, as shown in the figure. Figure 7 shown.

Claims

1. A fusion protein, characterized in that The fusion protein comprises a CD3 antibody and a luciferase expressed by being fused with the CD3 antibody. The fusion protein can bind to CD3 and emit light after catalyzing a substrate of the luciferase.

2. The fusion protein according to claim 1, characterized in that The CD3 is human CD3 or mouse CD3; And / or, the CD3 is selected from free CD3 protein and tissues and cells expressing CD3; And / or, the CD3 is a natural CD3 protein or a recombinant CD3 protein; and / or, the luciferase is bacterial luciferase, firefly luciferase, pyralis luciferase, Renilla luciferase, Gaussia luciferase, Nanoluc luciferase or spiny shrimp luciferase; And / or, the structure of the CD3 antibody is IgG, Fab, scFV or VHH.

3. The fusion protein according to claim 1 or 2, characterized in that The CD3 antibody comprises a heavy chain, and the heavy chain is fused with the luciferase for expression; Preferably, the heavy chain comprises the amino acid sequence as shown in SEQ ID NO: 11; and / or, the heavy chain and the luciferase, such as Gaussia luciferase, are connected via a flexible peptide to form a recombinant heavy chain; More preferably, the flexible peptide comprises the amino acid sequence shown in SEQ ID NO:

12.

4. An isolated nucleic acid, characterized in that The nucleic acid encodes the fusion protein according to any one of claims 1 to 3.

5. A recombinant vector, characterized in that: The recombinant vector comprises the nucleic acid according to claim 4.

6. A transformant, characterized in that The transformant comprises the nucleic acid according to claim 4 or the recombinant vector according to claim 5.

7. A method for purifying a fusion protein, characterized in that: The method comprises expressing and purifying the fusion protein according to any one of claims 1 to 3.

8. A method for preparing a fusion protein, characterized in that: The method comprises culturing the transformant according to claim 6 in a suitable culture medium to allow it to produce the fusion protein.

9. A method for detecting CD3, characterized in that: The method comprises using the fusion protein as described in any one of claims 1 to 3 to specifically target CD3 and simultaneously catalyze the self-luminescence of the substrate; preferably, the detection is for non-diagnostic purposes.

10. A conjugate of a protein or a fragment thereof, characterized in that: The protein or fragment thereof is the fusion protein or fragment thereof as described in any one of claims 1 to 3; preferably, the conjugate also includes other functional protein molecules or small molecules.

11. Use of the fusion protein according to any one of claims 1 to 3 or a conjugate of the protein or fragment thereof according to claim 10 in ELISA, WB, in vitro clinical testing and sequencing.

Images