Preparation method for biosynthesizing vanillin by using escherichia coli with glucose as substrate

Abstract

The invention belongs to the technical field of synthetic biology, and particularly relates to a method for artificially synthesizing vanillin by taking glucose as a substrate. According to the method, escherichia coli transformed bacteria transformed with a ferulic acid efficient synthesis module TTF, a ferulic acid synthesis vanillin function module AEL and a ferulic acid synthesis vanillin function module ODR are utilized, and the vanillin is prepared through fermentation with glucose as a substrate. The engineering bacterium constructed by the invention can efficiently synthesize and prepare natural vanillin, has a relatively prominent yield effect, and shows a relatively good application prospect. The microbial fermentation method is low in production cost, mild in preparation condition and low in preparation cost, and the prepared vanillin belongs to natural vanillin and can better meet the requirements of the fields of food, medicines, cosmetics and the like on natural vanillin, so that the method has better technical popularization and application significance.

Description

Technical Field

[0001] The present application belongs to the technical field of synthetic biology, and specifically relates to a method for preparing vanillin by artificial synthesis using glucose as a substrate. Background Art

[0002] Vanillin, chemical name: 4-hydroxy-3-methoxybenzaldehyde, is an aromatic small molecule compound, Vanilla planifolia ) The pods have a unique aroma, slightly sweet, with a creamy vanilla flavor. They are widely used in cosmetics, food, agriculture, and even industrial rubber products.

[0003] In the prior art, the main production methods of vanillin include chemical synthesis and natural extraction, among which chemical synthesis is dominant. However, due to factors such as the single aroma, low quality, many by-products and difficulty in separation of chemically synthesized vanillin, as well as the high risk of environmental pollution, chemically synthesized vanillin cannot meet the demand for vanillin in the food and pharmaceutical markets.

[0004] Studies have shown that natural vanillin has multiple biological functions such as antioxidant, antibacterial, anti-inflammatory, analgesic and anti-cancer. Therefore, there is a huge demand for natural vanillin in the pharmaceutical and food fields. However, due to the high cost, difficulty, low yield and long plant cultivation cycle of extracting and isolating natural vanillin from natural plants, the price of natural vanillin remains high, which seriously limits the application of vanillin in food, pharmaceuticals and other fields.

[0005] When using microbial fermentation to produce antibiotics, or even products such as vanillin involved in this application, it has advantages such as simple fermentation process, low cost, mild production conditions and no odor, and it is also "natural vanillin", so it has good prospects for promotion and application. However, when using relevant microbial strains to ferment and prepare vanillin products in the prior art, there is still a defect of low yield, so there are still many problems in its actual production and application. Summary of the invention

[0006] The present application lays a certain technical foundation for the artificial synthesis of vanillin by microbial fermentation through the connection and recombination of relevant key gene sequences in the natural vanillin synthesis pathway, and through the transformation and construction of the recombinant genes to obtain vanillin engineered bacteria.

[0007] The technical solution adopted in this application is described in detail as follows.

[0008] A method for preparing vanillin by artificial synthesis using glucose as a substrate, wherein the vanillin is 4-hydroxy-3-methoxybenzaldehyde, and the molecular formula is: C8H8O3; The preparation specifically includes the following steps: 1. Connection and recombination of key gene sequences for vanillin synthesis The key genes for vanillin synthesis include: Genes encoding tyrosine ammonia lyase (sam8), 4-coumarate 3-hydroxylase (sam5), feruloyl-CoA ligase (feruloyl-CoA synthase, fcs), and enoyl-CoA hydratase / aldolase (ech) from Streptomyces Sp.; The gene encoding ferulic acid decarboxylase (fdc) from Bacillus sp.; The gene encoding caffeic acid O-methyltransferase (comt) from Arabidopsis thaliana; The gene encoding the carotenoid cleavage oxygenase (cos2) from Caulobacter segnis. When gene sequences are connected: The first expression cassette (sam8-comt-sam5) is composed of the coding genes corresponding to tyrosine ammonia lyase, caffeic acid O-methyltransferase, and 4-coumaric acid 3-hydroxylase in series. The nucleotide sequence of the first expression frame is shown in SEQ ID No. 1 (the tyrosine ammonia lyase encoding gene sequence corresponds to the nucleotide sequence at positions 69-1686, the caffeic acid O-methyltransferase encoding gene sequence corresponds to the nucleotide sequence at positions 1787-2827, and the 4-coumaric acid 3-hydroxylase encoding gene sequence corresponds to the nucleotide sequence at positions 2978-4598); The second expression cassette (ech-fcs) is composed of the coding genes corresponding to enoyl-CoA hydratase / aldolase and feruloyl-CoA ligase in series. The nucleotide sequence of the second expression frame, the enoyl-CoA hydratase / aldolase coding sequence corresponds to the nucleotide sequence at positions 70-1000 on the nucleotide sequence, and the feruloyl-CoA ligase coding gene sequence corresponds to the nucleotide sequence at positions 1158-2654 on the nucleotide sequence; The third expression cassette (cos2-fdc) is composed of the coding genes corresponding to carotenoid cleavage oxygenase and ferulic acid decarboxylase in series. The nucleotide sequence of the third expression frame, the nucleotide sequence of positions 4648-6063 on the nucleotide sequence corresponding to the gene encoding carotenoid cleavage oxygenase, and the nucleotide sequence of positions 6164-6730 on the nucleotide sequence corresponding to the gene encoding ferulic acid decarboxylase; The first expression cassette, the second expression cassette, the third expression cassette and the promoter gene are connected through the ribosome binding sequence RBS to form a linear DNA recombinant gene sequence; The promoter sequence reference is: taatacgactcactataggaaggag; 2. Preparation of recombinant plasmid Using pACYADuet plasmid as a vector, ligating and recombining nucleotides 69-4598 of the first expression frame nucleotide sequence shown in SEQ ID No. 1, to prepare a recombinant plasmid: pACYADuet-sam8-comt-sam5 recombinant plasmid; Using pETDuet plasmid as a vector, ligating the nucleotides 70-2654 in the nucleotide sequence of the second expression frame as the nucleotides to prepare a recombinant plasmid: pETDuet-ech-fcs recombinant plasmid; Using pET28a plasmid as a vector, ligating and recombining nucleotides 4468-6730 in the nucleotide sequence of the third expression frame, to prepare a recombinant plasmid: pET28a-cos2-fdc recombinant plasmid; 3. Transformation and screening Using a chemical transformation method or a heat shock transformation method, the three recombinant plasmids obtained in step (ii) are co-transformed into competent E. coli BL21 (DE3) cells, and after transformation, the recombinant engineering strains that are simultaneously transformed with the three recombinant plasmids are screened to obtain the correct transformation; Alternatively, the pACYADuet-sam8-comt-sam5 recombinant plasmid containing the first expression frame and the pET28a-cos2-fdc recombinant plasmid containing the third expression frame obtained in step (ii) are co-transformed into Escherichia coli BL21 (DE3) competent cells, and after transformation, the recombinant engineering strain that is transformed with the two recombinant plasmids is screened to obtain the correct transformation; 4. Fermentation culture The correctly transformed recombinant engineering strain obtained by screening in step (iii) is inoculated into a medium containing 2-10 g / L glucose for cultivation; The fermentation culture product was collected.

[0009] In this application, the inventors selected and recombined the key enzymes in the natural vanillin synthesis pathway based on the idea of ​​synthetic biology technology and combined with the characteristics of microbial expression strains. The main design ideas are as follows (e.g. Figure 3 , Figure 4 As shown in the figure): Establish the ferulic acid efficient synthesis module TTF (TTF Module), the ferulic acid synthesis vanillin functional module AEL (AELModule) and the ferulic acid synthesis vanillin functional module ODR (ODR Module); the specific transformation and optimization ideas are: Overlap extension method was used to knock out the methyl donor SAM global regulatory gene in Escherichia coli BL21 (DE3) metJ , to increase the yield of ferulic acid in the synthesis of vanillin; In the AEL module, the TCA cycle isocitrate dehydrogenase gene was deleted. icdA Gene, which prompts Escherichia coli to use the glyoxylate bypass to convert acetyl-CoA into coenzyme A more efficiently than the TCA cycle, so as to improve the efficiency of the AEL pathway in catalyzing the conversion of ferulic acid into vanillin; In the ODR module, 1 mM FeCl2 was added at the same time as isopropyl-β-D-thiogalactoside (IPTG) to promote the E. coli cells expressing CSO2 to more efficiently convert 4-vinylguaiacol to vanillin; Through the above optimization, the ferulic acid efficient synthesis module TTF (TTF Module), the ferulic acid synthesis vanillin functional module AEL (AELModule) and the ferulic acid synthesis vanillin functional module ODR (ODR Module) were jointly introduced into Escherichia coli to obtain a modified Escherichia coli engineered bacteria capable of efficiently synthesizing vanillin.

[0010] Preliminary experimental results show that the engineered bacteria constructed in this application can efficiently synthesize and prepare natural vanillin, and its yield effect is relatively outstanding, showing good application prospects. Since this microbial fermentation method has low production cost, mild preparation conditions, low preparation cost, and the prepared vanillin belongs to natural source vanillin, it can better meet the demand for natural vanillin in the fields of food, medicine and cosmetics. Therefore, this application has good technical promotion and application significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 This is the HPLC identification result of natural vanillin standard; Figure 2 HPLC identification results of products of three recombinant plasmid engineering strains transformed simultaneously; Figure 3 Schematic diagram of the assembly of the synthetic module containing three types of vanillin; Figure 4 Schematic diagram of the assembly of the synthetic module containing two types of vanillin; Figure 5 HPLC identification results of the products of two recombinant plasmid engineering strains transformed simultaneously. DETAILED DESCRIPTION

[0012] The present application is further explained below in conjunction with the embodiments. Before introducing the specific embodiments, some experimental backgrounds in the following embodiments are briefly introduced as follows.

[0013] Biomaterials: pACYADuet plasmid (product number C0069) was purchased from Biosai Biotechnology; pETDuet plasmid (product number P0023) and pET28a plasmid (product number P0048) were purchased from Miaoling Biotechnology; Escherichia coli engineered strains BL21 (DE3) (Product No. C504-02) and DH5α (Product No. C502-02) were purchased from Nanjing Novozyme Biotech Co., Ltd.; Experimental reagents: Vanillin standard (Specification: B21366-20mg, CAS#: 121-33-5, Purity: HPLC>98%, LOT (Product Number): F08IB206772), produced by Shanghai Yuanye Biotechnology Co., Ltd.

[0014] Example 1 Based on the principles of synthetic biology, combined with the characteristics of prokaryotic expression systems, and using bioinformatics analysis methods, the inventors selected and optimized the key biological enzymes required in the synthesis of vanillin, and finally determined: Tyrosine ammonia lyase (sam8), 4-coumarate 3-hydroxylase (sam5), feruloyl-CoA ligase (feruloyl-CoA synthase, fcs), and enoyl-CoA hydratase / aldolase (ech) from Streptomyces Sp.; ferulic acid decarboxylase (fdc) from Bacillus sp.; Caffeic acid O-methyltransferase (comt) from Arabidopsis thaliana; carotenoid cleavage oxygenase (cos2) from Caulobacter segnis.; It is the key biological enzyme required for the subsequent prokaryotic expression and synthesis of vanillin.

[0015] Combined with the existing genome data, the genomes of Streptomyces Sp., Bacillus sp., Arabidopsis thaliana, and Caulobacter segnis. were used as templates (the relevant strains were purchased from Sai Biotechnology Hangzhou Baoji Co., Ltd., and the bacterial genome extraction kit (DC103-01) of Nanjing Novozymes Biotechnology Co., Ltd. was used to extract the relevant microbial genomes according to its instructions), and the PCR amplification method was used to clone the above-mentioned: sam8, comt, sam5, ech, fcs, fdc, and cos2 gene sequences (the sequences were all commissioned to Sangon Biotechnology (Shanghai) Co., Ltd. for synthesis).

[0016] During PCR amplification, the relevant primers were designed as follows: sam8-F:5'-tcatcaccacagccaggatccATGACGCAGGTCGTGGAACG-3', sam8-R: 5'-aggcgcgccgagctcgaattcTCATCCGAAATCCTTCCCG-3'; sam5-F:5'-taagaaggagatatacatatgATGACCATCACGTCACCTGCG-3', sam5-R: 5'-ggtttctttaccagactcgagTCAGGTGCCGGGGTTGAT-3'; comt-F: 5'-ccgGAATTCTAATACGACTCACTATAGGAAGGAGATGGGTTCTACCGCAACTCA-3', comt-R: 5'-ataagaatGCGGCCGCTTACAGTTTTTTCAGCAGTTCGATCAGG-3'; fcs-F:5'-ccgGAATTCATGCGCAACCAGGGTC-3', fcs-R: 5'-gggAAGCTTtcaGTGGGTGATGGTGATGATGGCCGAAGCGGCGGCG-3'; ech-F: 5'-ggaattcCATATGATGAGCACAGCGGTCG-3', ech-R: 5'-cggCTCGAGctaGTGGTGATGGTGATGATGCTTCTCCGGGTCGAA-3'; fdc-F: 5'-cccAAGCTTtaatacgactcactataggtttgtttaactttaagaaggagaATGGATCAATTTATCGGCTGCA-3', fdc-R: 5'-ccgCTCGAGTTATTTGCGACCAGCACGAATCTC-3'; cos2-F: 5'-cagcaaatgggtcgcggatccATGACCGCACGCTTCCCG-3', cos2-R: 5'-gcaagcttgtcgacggagctcTTAAACCGCTTTGATAGAGGACG-3'.

[0017] The reference design of PCR amplification system is as follows: rTaq (5 U / μL), 0.25 μL; 10× Buffer, 5 μL; dNTP Mixture, 4 μL; Template DNA, 2.5 ng; R primer, 1 μL (20 μ mol / L); F primer, 1 μL (20 μ mol / L); Sterile water, add to 50 μL; The PCR amplification program was as follows: denaturation at 95°C for 5 minutes; then denaturation at 95°C for 30 seconds, annealing at 65°C for 30 seconds, and extension at 72°C for 1.5 minutes, for 30 cycles; and finally extension at 72°C for 10 minutes.

[0018] After electrophoresis detection of the amplified products, recovery and purification, the amplified sam8, comt, sam5, ech, fcs, fdc, cos2 genes, ribosome binding sequence RBS and isopropyl-β-D-thiogalactoside inducible promoter (glycosome binding sequence RBS and isopropyl-β-D-thiogalactoside inducible promoter are carried by plasmid vector) are connected into a multi-gene tandem expression unit using a homologous recombination kit. The specific recombination connection method (taking the first expression frame as an example) is as follows: First, the amplified sam8, comt, and sam5 genes were connected into a multi-gene tandem expression unit using a homologous recombination kit (ClonExpress II One Step Cloning Kit, a product of Novozymes, refer to its instructions for operation); Simultaneously, the plasmid pACYADuet was double-digested with NcoI and XhoI. The enzyme digestion system is as follows: NcoI, 10 μL; XhoI, 10 μL; Buffer T, 20 μL; Buffer BSA, 20 μL; Buffer Trition, 20 μL; Plasmid, ≤10,000 ng; Sterile water, add to 200 μL; Enzyme digestion was performed at 37°C for 2 h; the digestion products were subjected to agarose gel electrophoresis and then the double digestion products were recovered and purified using a purification kit; Subsequently, the above-mentioned open reading frame of the target gene with the same sticky end (i.e., the multi-gene tandem expression unit) and the expression vector pACYADuet after restriction digestion were connected using homologous ligase; the connection system is as follows: 5x CE Entry Buffer, 8 µL; DNA, 200 ng; Vector, 2 µL; CE Entry Vector, 2 µL; ddH2O, add to 40µL; 16 ºC for 30 min; Finally, referring to the conventional operations of existing molecular biology techniques, transformation and screening were performed to obtain the correctly connected recombinant plasmid pACYADuet-sam8-comt-sam5 (i.e., the 69th to 4598th positions of the nucleotide sequence of the first expression frame shown in SEQ ID No.1 are nucleotides, and the ferulic acid efficient synthesis module TTF).

[0019] When preparing the recombinant plasmid pETDuet-ech-fcs (connecting the nucleotides 70-2654 in the recombinant second expression frame nucleotide sequence and the ferulic acid vanillin synthesis functional module AEL), the preparation process is as described above, and only the restriction sites are adjusted to: EcoRI and XhoI sites; When preparing the pET28a-cos2-fdc recombinant plasmid (the 4468-6730 positions in the nucleotide sequence of the third expression frame are connected and recombined as nucleotides, and the ferulic acid synthesis vanillin functional module ODR), only the restriction sites are adjusted to the BamHI and XhoI sites.

[0020] The specific sequence is as follows: The first expression cassette SEQ ID No.1 (8134 bp):

[0021] Second expression cassette (7721bp):

[0022] The third expression frame (7433bp):

[0023] Example 2 The inventors further transformed and induced protein expression of the recombinant plasmid finally prepared in Example 1. The specific process is briefly described as follows.

[0024] 1. Transformation and screening The pACYADuet-sam8-comt-sam5 recombinant plasmid, pETDuet-ech-fcs recombinant plasmid and pET28a-fdc-cos2 recombinant plasmid constructed in the above Example 1 were co-transformed into Escherichia coli BL21 (DE3) competent cells by chemical transformation. The operation process is as follows: After thawing BL21 (DE3) competent cells on ice, add the three recombinant plasmids (equal proportions) and mix well, and place on ice for 30 min; Take another BL21 (DE3) competent cell that has been dissolved on ice in advance, add two recombinant plasmids (recombinant plasmids with the first expression cassette and the third expression cassette, in equal proportions), mix well, and place on ice for 30 min; Subsequently, the mixed bacterial solution was heat-shocked in a 42°C water bath for 90 seconds. After the heat shock, the centrifuge tube containing the bacterial solution was quickly transferred to ice and kept in an ice bath for about 5 minutes. Then, add 800 μL of LB liquid medium to the centrifuge tube and culture in a shaker at 37°C and 200 r / min for 1 hour; After the culture was completed, centrifuge at 4000 r / min for 5 min, pour out the supernatant, and vortex and resuspend the remaining 200 μL of bacterial solution, then evenly spread it on an LB plate containing ampicillin and chloramphenicol resistance (ampicillin and chloramphenicol concentrations were 50 ng / L, respectively). After inverted culture at 37°C for about 12 h, pick the positive transformants for colony PCR verification; Finally, the correct positive monoclonal clones were selected and verified (sequencing verification was commissioned by Sangon Biotech (Shanghai) Co., Ltd.) and inoculated into LB medium containing ampicillin and chloramphenicol resistance (ampicillin and chloramphenicol concentrations were 50 ng / L, respectively) for expansion and culture, and the following were obtained: Three recombinant plasmids were transformed into recombinant engineering bacteria (recorded as E. coli-BH092720, this number has no special technical meaning and is only an experimental record number); The recombinant engineering bacteria (denoted as E. coli-BL061423) having two recombinant plasmids (respectively, the recombinant plasmids of the first expression frame and the third expression frame) were transformed at the same time.

[0025] (II) Inducible expression The correctly transformed recombinant engineered bacteria E. coli-BH092720 and E. coli-BL061423 obtained by screening in step (i) were respectively transferred to LB liquid culture medium containing 10 g / L glucose, and cultured at 37°C and 220 rpm in the dark with shaking. When the OD600 of the bacterial liquid was about 0.8, IPTG (isopropyl-β-D-thiogalactoside) was added to a final concentration of 1‰, and further cultured at 26°C and 220 rpm in the dark with shaking for about 24 hours to induce protein expression and synthesis of vanillin.

[0026] After the cultivation, the fermentation yield of vanillin in the above fermentation products was detected and analyzed by high performance liquid chromatography (HPLC) with vanillin standard as a control. The specific details are briefly described as follows.

[0027] Preparation of samples to be tested: Take the fermentation liquid after the above culture is completed, centrifuge it at 15000×g for 10 minutes, and keep the supernatant; filter the supernatant with a 0.2 μm filter and use it as the sample to be tested (the sample is directly tested and analyzed or stored at -80℃ for testing).

[0028] Preparation of standard curve: Prepare standard solutions with vanillin standard (dissolved in acetonitrile): 0 mg / L, 0.1 mg / L, 1.0 mg / L, 10.0 mg / L, 50.0 mg / L, 200.0 mg / L, 400.0 mg / L, 600.0 mg / L; High performance liquid chromatography (HPLC) analysis was performed using an Agilent 1200 series instrument; the chromatographic column was: EclipseXDB-C18 column (4.6×150 mm), and the Ultal3000 photodiode array detector was maintained at 25°C; The mobile phases were: solvent A (0.1% trifluoroacetic acid in water) and solvent B (0.1% trifluoroacetic acid in acetonitrile), with a flow rate of 1 ml / min; Use gradient elution program: 0 min, 95% solvent A + 5% solvent B; 8 min, 20% solvent A + 80% solvent B; 10 min, 80% solvent A + 20% solvent B; 11 min, 95% solvent A + 5% solvent B; The injection volume was 10 μL; The linearity of the standard curve is: Y=8.76e+003X, correlation coefficient: 0.9999.

[0029] Assay Control: Referring to the above operation, the sample to be tested in this application was tested and compared with the standard sample. The results showed that: The HPLC characteristic peak of the fermentation product of the engineering strain E.coli-BH092720 of this application has only one main product peak ( Figure 2 The peak of vanillin standard (80 mg / L) was 9.85 min, and the signal-to-noise ratio met the qualitative requirements. Figure 1 To ( Figure 1 As shown), this indicates that the vanillin product produced by the fermentation of the engineered bacteria is natural vanillin; The fermentation products of the recombinant engineering bacteria E. coli-BL061423 transformed with two plasmids were detected by HPLC. The results showed that its characteristic peak had only one main product peak ( Figure 5 The peak of vanillin standard (80 mg / L) was 9.85 min, and the signal-to-noise ratio met the qualitative requirements. Figure 1 To ( Figure 1 ), which indicates that when only two recombinant plasmids are transformed, the vanillin product produced by the fermentation of the engineered bacteria is still natural vanillin.

[0030] Further calculation results of product peak area showed that under the conditions of 10 g / L glucose as substrate, 26°C, 220 rpm, and overnight shaking culture in the dark, the results showed that: The vanillin shake flask yield in the recombinant bacteria transformed with three plasmids simultaneously reached 33.8 mg / L; The vanillin shake flask yield in the recombinant engineered bacteria transformed with two plasmids simultaneously reached 42.72 mg / L; both showed good yield effects.

[0031] The vanillin yields of different fermentation substrates reported in existing literature are summarized, and the results are shown in Table 1 below.

[0032] Table 1. Research progress of microbial synthesis of vanillin using different substrates It can be seen from the statistical results in the above table that the vanillin production of this application also has obvious technical advantages, which also lays a good technical foundation for its further industrialization, promotion and application.

Claims

1. A method for preparing vanillin by artificial synthesis using glucose as a substrate, characterized in that: The vanillin is 4-hydroxy-3-methoxybenzaldehyde, and its molecular formula is: C8H8O3; the method comprises the following steps:

1. Connection and recombination of key gene sequences for vanillin synthesis The key genes for vanillin synthesis include: The first expression cassette sam8-comt-sam5 is composed of the coding genes corresponding to tyrosine ammonia lyase, caffeic acid O-methyltransferase, and 4-coumaric acid 3-hydroxylase in series; The nucleotide sequence of the first expression cassette is shown in SEQ ID No. 1; The second expression cassette ech-fcs is composed of the coding genes corresponding to enoyl-CoA hydratase / aldolase and feruloyl-CoA ligase in series. The third expression cassette cos2-fdc is composed of the coding genes corresponding to carotenoid cleavage oxygenase and ferulic acid decarboxylase in series; The first expression cassette, the second expression cassette, the third expression cassette and the promoter gene are connected through the ribosome binding sequence RBS to form a linear DNA recombinant gene sequence; 2. Preparation of recombinant plasmid Using pACYADuet plasmid as a vector, ligating and recombining nucleotides 69-4598 of the first expression frame nucleotide sequence shown in SEQ ID No. 1, to prepare a recombinant plasmid: pACYADuet-sam8-comt-sam5 recombinant plasmid; Using pETDuet plasmid as a vector, ligating the nucleotides 70-2654 in the nucleotide sequence of the second expression frame to prepare a recombinant plasmid: pETDuet-ech-fcs recombinant plasmid; Using pET28a plasmid as a vector, ligating and recombining nucleotides 4468-6730 in the nucleotide sequence of the third expression frame to prepare a recombinant plasmid: pET28a-cos2-fdc recombinant plasmid; 3. Transformation and screening The three recombinant plasmids obtained in step (ii) or the pACYADuet-sam8-comt-sam5 recombinant plasmid and the pET28a-cos2-fdc recombinant plasmid are co-transformed into competent E. coli cells, and after transformation, the recombinant engineering strains that are transformed with the three or two recombinant plasmids simultaneously are screened to obtain the correct transformation; 4. Fermentation culture Inoculate the correctly transformed recombinant engineering strain obtained by screening in step (iii) into a medium containing glucose for cultivation; The fermentation culture product was collected.

2. The method for preparing vanillin by artificial synthesis using glucose as a substrate as claimed in claim 1, characterized in that: In step (iii), heat shock transformation is used for transformation.

3. The method for preparing vanillin by artificial synthesis using glucose as a substrate as claimed in claim 1, characterized in that: In step (iv), the glucose content is 2-10 g / L.

4. A three-module gene combination for artificially synthesizing vanillin using glucose as a substrate, characterized in that: It includes a ferulic acid efficient synthesis module TTF, a ferulic acid deacetylation reaction synthesis vanillin functional module AEL and a ferulic acid oxidative decarboxylation synthesis vanillin functional module ODR; The ferulic acid efficient synthesis module TTF, whose nucleotide sequence is the 69th to 4598th nucleotides in the first expression frame nucleotide sequence shown in SEQ ID No.1; The ferulic acid deacetylation reaction synthesizes the vanillin functional module AEL, whose nucleotide sequence is the 70th to 2654th nucleotides in the nucleotide sequence of the second expression frame; The ferulic acid oxidative decarboxylation to synthesize vanillin functional module ODR has a nucleotide sequence of nucleotides 4468-6730 in the nucleotide sequence of the third expression frame.

5. A two-module gene combination for artificially synthesizing vanillin using glucose as a substrate, characterized in that: It includes a ferulic acid efficient synthesis module TTF and a ferulic acid oxidative decarboxylation synthesis vanillin functional module ODR; The ferulic acid efficient synthesis module TTF, whose nucleotide sequence is the 69th to 4598th nucleotides in the first expression frame nucleotide sequence shown in SEQ ID No.1; The ferulic acid oxidative decarboxylation to synthesize vanillin functional module ODR has a nucleotide sequence of nucleotides 4468-6730 in the nucleotide sequence of the third expression frame.

Images