Primer combination, kit and method for identifying biotype of spodoptera frugiperda

Abstract

The invention provides a primer combination, a kit and a method for identifying biological types of spodoptera frugiperda, and relates to the technical field of biology. The primer combination for identifying the biotype of the spodoptera frugiperda comprises a primer combination 1, a primer combination 2 and a primer combination 3, the primer combination 1 comprises an upstream primer E2F1 and a downstream primer E3R2; the primer combination 2 comprises an upstream primer SfCF7 and a downstream primer E3R2; the primer combination 3 comprises an upstream primer SfRF7 and a downstream primer E3R2. According to the primer combination provided by the invention, all the primers are located on the OR13 gene exon, the marking stability is high, effective identification of'rice type 'and'corn type' grassland spodoptera frugiperda can be realized only through PCR and gel electrophoresis, the detection time is fast, the cost is low, and the problem that'rice type 'false positive identification depends on Tpi-370 [C / T] in the past is solved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a primer combination, a kit and a method for identifying biotypes of fall armyworm. Background Art

[0002] The fall armyworm (Spodoptera frugiperda) is an important agricultural pest originally distributed in tropical and subtropical regions of America. It can be divided into two biotypes, "corn type" and "rice type", according to its preference for feeding on host plants. Rapid and accurate identification of the biotype attributes of the fall armyworm is of great guiding significance for the formulation of targeted prevention and control measures.

[0003] Cytochrome c oxidase subunit I (COI) and triosephosphate isomerase (Tpi) are the two most commonly used markers for biotype identification of fall armyworm, of which COI is derived from mitochondria and Tpi is derived from the nuclear genome. Since the COI gene has the characteristics of maternal inheritance, the Tpi gene can more accurately reflect the whole genome background information, so the Tpi gene has been widely used in biotype identification of fall armyworm.

[0004] Tpi gene identification is mainly based on specific primer PCR amplification of a fragment of about 400bp in length, including part of exon 3, all of intron 3 and part of exon 4 sequence, and judgment is made based on 10 difference sites in the "rice type" and "corn type" sequences, among which site Tpi-370[C / T] is considered to be the core site, and the biotype judgment of "rice type" and "corn type" can be completed based on this site alone.

[0005] However, the above method has the following disadvantages:

[0006] (1) Existing methods rely on PCR and Sanger sequencing, which have low detection efficiency and high cost.

[0007] (2) Regarding the 10 loci for Tpi typing identification, as the number of tested samples increased, some loci (Tpi-174 / 175) have been confirmed to be inconsistent with the previous typing characteristics (Zhang Lei, Liu Bei, Jiang Yuying, et al. Analysis of molecular characteristics of biotypes of fall armyworm populations in different regions of China [J]. Plant Protection, 2019, 45(4): 8. DOI: 10.16688 / j.zwbh.2019296.), showing the limitations of the early establishment of typing loci.

[0008] (3) A unique Tpi haplotype (Tpi-specific type) was detected in the Old World invasive population. The Tpi-specific type met the characteristics of the "rice type" at the core locus Tpi-370[C / T], but the characteristics of other loci did not meet the "rice type" or "maize type". The results of whole genome sequencing analysis showed that the "Tpi-specific type" was closer to the "maize type" genetic background. Therefore, the existence of the "Tpi-specific type" affected the accuracy of the previous judgment method based on Tpi-370[C / T].

[0009] In view of this, the present invention is proposed. Summary of the invention

[0010] The first objective of the present invention is to provide a primer combination for identifying biotypes of Spodoptera frugiperda to solve the above technical problems.

[0011] The second object of the present invention is to provide the use of the above primer combination in the preparation of a product for identifying biotypes of Spodoptera frugiperda.

[0012] The third object of the present invention is to provide a kit for identifying biotypes of Spodoptera frugiperda.

[0013] The fourth object of the present invention is to provide a method for identifying the biotype of Spodoptera frugiperda.

[0014] In order to achieve the above objectives, the following technical solutions are adopted:

[0015] In a first aspect, the present invention provides a primer combination for identifying biotypes of fall armyworm, comprising primer combination 1, primer combination 2 and primer combination 3;

[0016] The primer combination 1 includes an upstream primer E2F1 and a downstream primer E3R2;

[0017] The primer combination 2 includes an upstream primer SfCF7 and a downstream primer E3R2;

[0018] The primer combination 3 includes an upstream primer SfRF7 and a downstream primer E3R2;

[0019] The upstream primer E2F1 has a nucleotide sequence as shown in SEQ ID NO.1;

[0020] The upstream primer SfCF7 has a nucleotide sequence as shown in SEQ ID NO.2;

[0021] The upstream primer SfRF7 has a nucleotide sequence as shown in SEQ ID NO.3;

[0022] The downstream primer E3R2 has a nucleotide sequence as shown in SEQ ID NO.4.

[0023] In a second aspect, the present invention provides the use of the above primer combination in the preparation of a product for identifying biotypes of Spodoptera frugiperda.

[0024] As a further technical solution, the biotypes of the fall armyworm include "corn type" fall armyworm and "rice type" fall armyworm.

[0025] In a third aspect, the present invention provides a kit for identifying biotypes of Spodoptera frugiperda, comprising the primer combination and PCR premix.

[0026] As a further technical solution, the PCR premix includes Plus Master MixⅡ.

[0027] As a further technical solution, the kit also includes a negative control and a positive control;

[0028] The negative control includes water;

[0029] The positive controls include "corn type" fall armyworm and "rice type" fall armyworm.

[0030] In a fourth aspect, the present invention provides a method for identifying the biotype of fall armyworm, comprising the following steps: using the genomic DNA of the sample to be tested as a template, performing PCR amplification using the primer combination or the kit, and determining and identifying the biotype of fall armyworm based on the result of amplification.

[0031] As a further technical solution, if primer combination 1 has an amplification product, primer combination 2 has an amplification product, and primer combination 3 has no amplification product, then the sample to be tested is a "corn type" fall armyworm;

[0032] If primer combination 1 has an amplification product, primer combination 2 has no amplification product, and primer combination 3 has an amplification product, then the sample to be tested is "rice type" fall armyworm;

[0033] If primer combination 1 has an amplification product, primer combination 2 has an amplification product, and primer combination 3 has an amplification product, the sample to be tested is a hybrid of "rice type" and "corn type".

[0034] As a further technical solution, gel electrophoresis is used to detect the amplified product.

[0035] As a further technical solution, the PCR amplification program is: pre-denaturation: 94°C, 3-5min; denaturation: 94°C, 15-30s, annealing: 55°C, 15-30s, extension: 72°C, 30-45s, a total of 30-35 cycles; extension: 72°C, 5min.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] The inventors have found that the OR13 gene (odorant receptor) is very conservative, and there is a stable amino acid variation between the "rice-type" fall armyworm and the "corn-type" fall armyworm. Based on this, the present invention proposes a primer combination for the OR13 gene, all of which are located in exons, with strong labeling stability, and can effectively identify the "rice-type" and "corn-type" fall armyworm only through PCR and gel electrophoresis, with fast detection time and low cost, solving the problem of false positives of "rice-type" identified by relying on Tpi-370[C / T]. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0039] Figure 1 The difference in amino acid levels of OR13 gene between "corn type" and "rice type" fall armyworm;

[0040] Figure 2 The differences in nucleotide levels of OR13 gene between “corn type” and “rice type” fall armyworm;

[0041] Figure 3 Schematic diagram for primer design;

[0042] Figure 4 This is the peak diagram of OR13 gene fragment sequencing;

[0043] Figure 5 The following are the results of gel electrophoresis, where No. 1 represents COI primers (COX1F1, COX1R1) as a control; No. 2 represents combination 1 (E2F1 forward primer and E3R2 reverse primer); No. 3 represents combination 2 (SfCF7 forward primer and E3R2 reverse primer); No. 4 represents combination 3 (SfRF7 forward primer and E3R2 reverse primer). DETAILED DESCRIPTION

[0044] The embodiments of the present invention will be described in detail below in conjunction with the embodiments and examples, but it will be appreciated by those skilled in the art that the following embodiments and examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. If specific conditions are not specified, proceed according to normal conditions or conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0045] In a first aspect, the present invention provides a primer combination for identifying biotypes of fall armyworm, comprising primer combination 1, primer combination 2 and primer combination 3;

[0046] The primer combination 1 includes an upstream primer E2F1 and a downstream primer E3R2;

[0047] The primer combination 2 includes an upstream primer SfCF7 and a downstream primer E3R2;

[0048] The primer combination 3 includes an upstream primer SfRF7 and a downstream primer E3R2;

[0049] The upstream primer E2F1 has a nucleotide sequence as shown in SEQ ID NO.1;

[0050] The upstream primer SfCF7 has a nucleotide sequence as shown in SEQ ID NO.2;

[0051] The upstream primer SfRF7 has a nucleotide sequence as shown in SEQ ID NO.3;

[0052] The downstream primer E3R2 has a nucleotide sequence as shown in SEQ ID NO.4.

[0053] The OR13 gene is located in the nuclear genome and is a sex pheromone receptor gene with a total amino acid length of 435 bp. The gene is very conservative, but there is a stable amino acid variation between the "rice type" and the "corn type". Accordingly, the present invention provides a primer combination, the primers of which are all located in exons, and the marker stability is strong. Through the amplification of more than 200 samples of fall armyworm DNA, it shows a strong amplification versatility; the "rice type" and "corn type" fall armyworm can be effectively identified only by PCR and gel electrophoresis, and the detection time is fast and the cost is low, which solves the problem of false positives of "rice type" identified by Tpi-370 [C / T]. In addition, the primer combination can also be combined with the Sanger sequencing method to identify the biotype of the sample to be tested.

[0054] In a second aspect, the present invention provides the use of the above primer combination in the preparation of a product for identifying biotypes of Spodoptera frugiperda.

[0055] The primer combination provided by the present invention can be used for identifying the biotype of fall armyworm, and thus can be used for preparing a product for identifying the biotype of fall armyworm.

[0056] In some optional embodiments, the product comprises a kit.

[0057] In some optional embodiments, the fall armyworm biotypes include "corn type" fall armyworm and "rice type" fall armyworm.

[0058] In a third aspect, the present invention provides a kit for identifying biotypes of Spodoptera frugiperda, comprising the primer combination and PCR premix.

[0059] The kit includes the primers of the present invention and can therefore be used for identifying biotypes of Spodoptera frugiperda.

[0060] In some optional embodiments, the PCR premix includes but is not limited to Plus Master Mix II, or other premixes known to those skilled in the art.

[0061] In some optional embodiments, the kit further comprises a negative control and a positive control;

[0062] The negative control includes water;

[0063] The positive controls include "corn type" fall armyworm and "rice type" fall armyworm.

[0064] In a fourth aspect, the present invention provides a method for identifying the biotype of fall armyworm, comprising the following steps: using the genomic DNA of the sample to be tested as a template, performing PCR amplification using the primer combination or the kit, and determining and identifying the biotype of fall armyworm based on the result of amplification.

[0065] The method is simple, low-cost and has a fast detection time.

[0066] In some optional embodiments, if primer combination 1 has an amplification product, primer combination 2 has an amplification product, and primer combination 3 has no amplification product, then the sample to be tested is a "corn type" fall armyworm;

[0067] If primer combination 1 has an amplification product, primer combination 2 has no amplification product, and primer combination 3 has an amplification product, then the sample to be tested is "rice type" fall armyworm;

[0068] If primer combination 1 has an amplification product, primer combination 2 has an amplification product, and primer combination 3 has an amplification product, the sample to be tested is a hybrid of "rice type" and "corn type".

[0069] In some optional embodiments, gel electrophoresis is used to detect the amplified product.

[0070] In some optional embodiments, the PCR amplification program is: pre-denaturation: 94°C, 5 min; denaturation: 94°C, 30 s, annealing: 55°C, 30 s, extension: 72°C, 45 s, a total of 30-35 cycles; extension: 72°C, 5 min;

[0071] In some optional embodiments, the PCR amplification program is: pre-denaturation: 94°C, 3 min; denaturation: 94°C, 15 s, annealing: 55°C, 15 s, extension: 72°C, 30 s, a total of 30-35 cycles; extension: 72°C, 5 min;

[0072] In some optional embodiments, the program of PCR amplification is: pre-denaturation: 94°C, 4 min; denaturation: 94°C, 20 s, annealing: 55°C, 20 s, extension: 72°C, 35 s, a total of 30-35 cycles; extension: 72°C, 5 min.

[0073] The present invention is further described below by means of specific examples. However, it should be understood that these examples are only used for more detailed description and should not be construed as limiting the present invention in any form.

[0074] It should be noted that the "Tpi-specific type" is a type of "corn-type" fall armyworm.

[0075] Example 1

[0076] The whole genome of the "rice-type" and "corn-type" fall armyworm collected from the Americas was sequenced and assembled, and the whole genome sequences of the "rice-type" and "corn-type" fall armyworm were obtained respectively. The full-length nucleic acid sequence and corresponding amino acid sequence of the OR13 gene were obtained according to the annotation file. The OR13 gene is located in the nuclear genome and is a sex pheromone receptor gene with a total amino acid length of 435bp. The gene is very conservative. Analysis found that it has a stable amino acid (amino acid 70) variation between the "rice-type" and "corn-type" ( Figure 1 , among which numbers 1 and 2 are "corn type", and numbers 3 and 4 are "rice type").

[0077] The amino acid variation corresponds to a variation at the nucleotide level in three consecutive bases in exon 2 of the OR13 gene (positions 594 / 595 / 596 of the OR13 full-length gene, i.e., positions 152 / 153 / 154 of exon 2 of the OR13 gene, the reference genome is GCA_012979215.2) ( Figure 2 , where numbers 1 and 2 are "maize type", and numbers 3 and 4 are "rice type"). Based on the analysis of 581 resequencing data of fall armyworm (63 "rice type" and 518 "maize type") published in public databases and measured by our laboratory, and through the results of whole-genome SNPs analysis, it was found that the above three nucleotide variations are closely related to the "rice type" and "maize type" typing.

[0078] Example 2

[0079] Targeting the three base mutations in exon 2 of the OR13 gene, specific primers were designed upstream and downstream of the mutation site and at the mutation site to form different primer combinations, as shown in the schematic diagram. Figure 3 shown.

[0080] Among them, in combination 1, the E2F1 and E3R2 primer combination can amplify the variant site and the sequences on both sides thereof, and the amplified product includes part of exon 2, all of intron 2, and part of exon 3 sequence;

[0081] In combination 2, SfCF7 specifically binds to "maize-type" DNA but not to "rice-type" DNA, and when combined with E3R2, only amplified bands for "maize-type" DNA were obtained;

[0082] In combination 3, SfRF7 specifically binds to "rice-type" DNA but not to "maize-type" DNA, and when combined with E3R2, only "rice-type" DNA has an amplified band;

[0083] The primer sequences are as follows:

[0084] Primer name Primer sequence 5'-3' serial number Remark E2F1 GGGATCGAGAAAGTGGAA SEQ ID NO.1 Positive FWf CTGGTACCAGGTTCACTT SEQ ID NO.2 Forward (maize type specific) SfX TGGTACCAGGTTCAGGG SEQ ID NO.3 Forward (rice type specific) E3R2 GATTGCGTTGTATTCTTTGGT SEQ ID NO.4 Reverse COX1F1 TTCGAGCTGAATTAGGGACTC SEQ ID NO.5 Positive COX1R1 GATGTAAAATATGCTCGTGT SEQ ID NO.6 Reverse

[0085] The above primer combination was used to perform PCR amplification detection on the "rice type", "corn type" and "Tpi specific type" fall armyworm samples. The experimental contents are as follows:

[0086] Materials and Methods

[0087] DNA samples: "Rice type", "Maize type", "Tpi specific type".

[0088] The reaction system for PCR amplification was as follows: 2 μL template DNA, 1 μL forward primer (10 μmol / L), 1 μL reverse primer (10 μmol / L), 12.5 μL 2×Taq Plus Master MixⅡ, and 8.5 μL ddH2O.

[0089] PCR amplification program: pre-denaturation: 94°C, 5 min; denaturation: 94°C, 30 s; annealing: 55°C, 30 s; extension: 72°C, 30 s, 35 cycles in total; extension: 72°C, 5 min.

[0090] The amplification results were then subjected to Sanger sequencing and gel electrophoresis.

[0091] Experimental results:

[0092] Combination 1 (E2F1 forward primer and E3R2 reverse primer) was used to perform PCR amplification on the DNA of "maize type", "rice type" and "Tpi specific type" samples, and the PCR products were sequenced by Sanger sequencing. The sequencing results showed that there were 3 base mutations between "rice type" and "maize type", and the "Tpi specific type" was consistent with the "maize type" ( Figure 4 ).

[0093] The COI primers were used to perform PCR amplification on the DNA of the "corn type", "rice type" and "Tpi specific type" samples, and amplified bands were obtained ( Figure 5 , lane number 1).

[0094] Combination 1 (E2F1 forward primer and E3R2 reverse primer) was used to perform PCR amplification on the DNA of "corn type", "rice type" and "Tpi specific type" samples, and amplified bands were obtained. The length of the amplified fragment was about 380 bp ( Figure 5 , lane number 2).

[0095] Combination 2 (SfCF7 forward primer and E3R2 reverse primer) was used to perform PCR amplification on the DNA of "maize type", "rice type" and "Tpi specific type" samples, respectively. Only amplified bands were found in "maize type" and "Tpi specific type", and the amplified fragment length was about 250 bp. No amplified band was found in "rice type" ( Figure 5 , lane number 3).

[0096] Combination 3 (SfRF7 forward primer and E3R2 reverse primer) was used to perform PCR amplification on the DNA of "maize type", "rice type" and "Tpi specific type" samples. Only the "rice type" sample had an amplified band with a length of about 250 bp. No amplified band was found in the "maize type" and "Tpi specific type" samples ( Figure 5 , lane number 4).

[0097] Based on the above results, three primer combinations can be used to achieve the purpose of rapid identification of "rice type" and "corn type", among which combination 1 is used to identify the fall armyworm, combination 2 and combination 3 specifically amplify "corn type" and "rice type", respectively. If it is heterozygous, all three combinations will have amplified bands.

[0098] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer combination for identifying biotypes of Fall Armyworm, characterized in that: Comprising primer combination 1, primer combination 2 and primer combination 3; The primer combination 1 includes an upstream primer E2F1 and a downstream primer E3R2; The primer combination 2 includes an upstream primer SfCF7 and a downstream primer E3R2; The primer combination 3 includes an upstream primer SfRF7 and a downstream primer E3R2; The upstream primer E2F1 has a nucleotide sequence as shown in SEQ ID NO.1; The upstream primer SfCF7 has a nucleotide sequence as shown in SEQ ID NO.2; The upstream primer SfRF7 has a nucleotide sequence as shown in SEQ ID NO.3; The downstream primer E3R2 has a nucleotide sequence as shown in SEQ ID NO.

4.

2. Use of the primer combination according to claim 1 in the preparation of a product for identifying biotypes of Spodoptera frugiperda.

3. The use according to claim 2, characterized in that: The fall armyworm biotypes include "corn type" fall armyworm and "rice type" fall armyworm.

4. A kit for identifying biotypes of fall armyworm, characterized in that: It comprises the primer combination as claimed in claim 1 and a PCR premix.

5. The kit according to claim 4, characterized in that The PCR premix includes Plus Master Mix II.

6. The kit according to claim 4, characterized in that The kit also includes a negative control and a positive control; The negative control includes water; The positive controls include "corn type" fall armyworm and "rice type" fall armyworm.

7. A method for identifying biotypes of fall armyworm, characterized in that: The method comprises the following steps: using the genomic DNA of the sample to be tested as a template, performing PCR amplification using the primer combination described in claim 1 or the kit described in any one of claims 4 to 6, and determining and identifying the biotype of the fall armyworm according to the amplification result.

8. The method according to claim 7, characterized in that If primer combination 1 has an amplification product, primer combination 2 has an amplification product, and primer combination 3 has no amplification product, then the sample to be tested is "corn type" fall armyworm; If primer combination 1 has an amplification product, primer combination 2 has no amplification product, and primer combination 3 has an amplification product, then the sample to be tested is "rice type" fall armyworm; If primer combination 1 has an amplification product, primer combination 2 has an amplification product, and primer combination 3 has an amplification product, the sample to be tested is a hybrid of "rice type" and "corn type".

9. The method according to claim 8, characterized in that The amplified products were detected by gel electrophoresis.

10. The method according to claim 7, characterized in that The PCR amplification program is: pre-denaturation: 94°C, 3-5min; denaturation: 94°C, 15-30s, annealing: 55°C, 15-30s, extension: 72°C, 30-45s, a total of 30-35 cycles; extension: 72°C, 5min.

Images