Method for rapidly identifying purity of Beijing pumpkin 36 hybrid and special SSR (Simple Sequence Repeat) primer pair thereof
By developing a method for PCR amplification of SSR primer pairs for Jinghu 36 hybrids, the problem of long and low accuracy of Jinghu 36 hybrids in the prior art was solved, and a rapid, accurate and low-cost hybrid purity identification was achieved, and the production and sales time of hybrids was improved.
Patent Information
- Application Number
- CN202311204767.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-09-18
- Publication Date
- 2025-03-18
AI Technical Summary
The prior art is difficult to quickly and accurately identify the purity of the Jinghu 36 hybrid species. The traditional methods have problems such as high planting costs, long identification time and low accuracy. The molecular identification technology requires growth to the seedling stage and use of toxic reagents.
A method for PCR amplification using SSR primer pairs was developed to quickly identify the purity of the Jinghu 36 hybrid by analyzing the number, size, or nucleotide sequence of the DNA fragments in the amplified product. Specific steps include extracting DNA from the radiculogen of the zucchini to be tested, PCR amplification using specific upstream and downstream primers, and detecting the amplified product by non-denaturation polyacrylamide gel electrophoresis.
This method significantly shortens the purity identification time of Jinghu 36 hybrid hybrids, simplifies DNA extraction operations, reduces costs and labor, and achieves fast, accurate and low-cost hybrid purity identification, and improves the production and sales timeliness of hybrids.
Smart Images
Figure HDA0004455299030000011
Abstract
Description
Technical Field
[0001] The invention belongs to the field of molecular breeding, and particularly relates to a method for rapidly identifying the purity of Jinghu 36 hybrid and a special SSR primer pair thereof. Background Art
[0002] Variety identification is an important part of seed quality testing, and its main purpose is to determine the degree of conformity between the sample submitted for testing and the declared variety. Therefore, accurate, reliable, fast and simple variety identification methods have attracted much attention. SSR molecular marker technology is a genetic marker technology based on nucleotide sequence variation within genetic material between individuals, and is a direct reflection of genetic polymorphism at the DNA level. Compared with other genetic marker technologies, SSR molecular marker technology has the characteristics of rich information, fast and accurate detection, and easy standardized operation, making it very suitable for plant variety identification and analysis.
[0003] Zucchini (Cucurbita pepo L.) is a melon vegetable commonly grown in my country. my country's planting area, yield and consumption rank first in the world all year round. It is an important vegetable crop to increase the income of farmers and meet the people's living needs. Zucchini has obvious hybrid advantages. In production, hybrids are mainly planted. In order to reduce the problem of reduced yield caused by false hybrids, the purity of hybrids must meet national regulations before they can be sold. However, false hybrids produced by self-pollination of the female parent often lead to unqualified hybrid purity. Therefore, detecting and identifying the purity of hybrids is a necessary measure before seeds are sold. Traditional hybrid production companies often use the phenotype of plants after planting to identify the purity of hybrids, which has the disadvantages of high planting cost, long identification time and low accuracy. After the improvement of hybrid purity identification technology, most of the hybrids identified by molecular marker technology must also grow to the cotyledons of seedling plants to unfold, so as to extract cotyledon DNA for molecular identification. In addition, the traditional CTAB method for extracting cotyledon DNA has the disadvantages of low efficiency, large workload, high cost and toxic reagents.
[0004] Jinghu 36 is a new hybrid first-generation zucchini variety developed by the Vegetable Research Institute of Beijing Academy of Agricultural and Forestry Sciences. It is cold-resistant and suitable for long-season cultivation in greenhouses for wintering. Its female parent is the zucchini inbred line 0421 (recorded in the following documents: Li Haizhen, Zhang Fan, Zhang Guoyu, et al. Breeding of a new zucchini variety 'Jinghu 36' [J]. Chinese Vegetables, 2020, 33(01): 59-61. DOI: 10.16861 / j.cnki.zggc.2020.0012.), and its male parent is the zucchini inbred line 07754 (recorded in the following documents: Li Haizhen, Zhang Fan, Zhang Guoyu, et al. Breeding of a new zucchini variety 'Jinghu 36' [J]. Chinese Vegetables, 2020, 33(01): 59-61. DOI: 10.16861 / j.cnki.zggc.2020.0012.). Jinghu 36 has vigorous growth, long growth period, tolerance to low temperature and weak light, reasonable plant shape, good ventilation and light transmission; it has strong ability to produce fruits continuously under low temperature and weak light conditions, dense fruit density, high yield, and the fruit picking period can reach more than 200 days; the commercial fruit is 23-24cm long and 6-7cm thick, with long columnar fruit strips, uniform thickness, emerald green color, good gloss, good quality, outstanding commercial quality, and is suitable for winter greenhouses in the north and spring and autumn greenhouses. Jinghu 36 was approved by the Shanxi Provincial Crop Variety Approval Committee in May 2014 and obtained plant variety protection in 2017. Jinghu 36 has become the main winter greenhouse variety of zucchini in my country, with a large area of promotion and a large market demand for hybrid seeds. In order to prevent false hybrids from damaging planting benefits and ensure production, it is urgent to establish a method for rapid identification of the purity of Jinghu 36 hybrids to meet the production and sales needs of hybrids. Rapid detection methods for variety identification have been established for some major crops such as corn, soybeans, wheat, and barley, but there are currently no relevant reports on Jinghu 36. In view of the interspecies specificity of SSR primers, there is an urgent need to develop methods for identifying the purity of Jinghu 36 hybrids and their dedicated SSR primer pairs. Summary of the invention
[0005] The purpose of the present invention is to identify the purity of Jinghu 36 hybrid.
[0006] The present invention firstly protects an SSR primer pair, which may be composed of an upstream primer JH36F and a downstream primer JH36R;
[0007] The nucleotide sequence of the upstream primer JH36F is shown in SEQ ID NO: 1;
[0008] The nucleotide sequence of the downstream primer JH36R is shown in SEQ ID NO:2.
[0009] The present invention also protects a method for identifying the purity of the Jinghu 36 hybrid to be tested.
[0010] The method for identifying the purity of the hybrid Jinghu 36 to be tested protected by the present invention may be specifically method 1, which may include the following steps: using the genomic DNA of the hybrid Jinghu 36 to be tested as a template, using the SSR primer pair to perform PCR amplification to obtain an SSR amplification product; and making the following judgment based on the number of DNA fragments contained in the SSR amplification product:
[0011] If the SSR amplification product of the tested Jinghu 36 hybrid contains two DNA fragments, the tested Jinghu 36 hybrid is identified as Jinghu 36 hybrid (i.e., the purity is 100%);
[0012] If the SSR amplification product of the tested Jinghu 36 hybrid contains one DNA fragment, the tested Jinghu 36 hybrid is identified as a non-Jinghu 36 hybrid.
[0013] The method for identifying the purity of the hybrid Jinghu 36 to be tested protected by the present invention may be specifically method 2, which may include the following steps: using the genomic DNA of the hybrid Jinghu 36 to be tested as a template, using the SSR primer pair to perform PCR amplification to obtain an SSR amplification product; and making the following judgments based on the size of the DNA fragment contained in the SSR amplification product:
[0014] If the SSR amplification product of the tested Jinghu 36 hybrid contains two DNA fragments with sizes of 193 bp and 198 bp respectively, the tested Jinghu 36 hybrid is identified as Jinghu 36 hybrid, that is, the purity is 100%;
[0015] If the SSR amplification product of the tested Jinghu 36 hybrid contains a DNA fragment with a size of 198 bp or 193 bp, the tested Jinghu 36 hybrid is identified as a non-Jinghu 36 hybrid.
[0016] The method for identifying the purity of the hybrid of Jinghu 36 to be tested protected by the present invention may be specifically method three, which may include the following steps: using the genomic DNA of the hybrid of Jinghu 36 to be tested as a template, using the SSR primer pair to perform PCR amplification to obtain an SSR amplification product; and making the following judgments based on the nucleotide sequence of the DNA fragment contained in the SSR amplification product:
[0017] If the SSR amplification product of the tested Jinghu 36 hybrid contains two DNA fragments and the nucleotide sequences are respectively shown as SEQ ID NO: 3 and SEQ ID NO: 4, then the tested Jinghu 36 hybrid is identified as Jinghu 36 hybrid, that is, the purity is 100%;
[0018] If the SSR amplification product of the tested Jinghu 36 hybrid contains one DNA fragment and the nucleotide sequence is as shown in SEQ ID NO: 3 or SEQ ID NO: 4, the tested Jinghu 36 hybrid is identified as a non-Jinghu 36 hybrid.
[0019] The present invention also protects a method for identifying Jinghu 36, zucchini inbred line 0421 and zucchini inbred line 07754.
[0020] The method for identifying Jinghu 36, zucchini inbred line 0421 and zucchini inbred line 07754 protected by the present invention may be specifically method A, which may include the following steps: using the genomic DNA of the zucchini to be tested as a template, performing PCR amplification using the SSR primer pair to obtain an SSR amplification product; and making the following judgments based on the size of the DNA fragment contained in the SSR amplification product:
[0021] If the SSR amplification product of the zucchini to be tested contains two DNA fragments with sizes of 193 bp and 198 bp respectively, the zucchini to be tested is identified as Jinghu 36;
[0022] If the SSR amplification product of the zucchini to be tested contains a DNA fragment with a size of 198 bp, the zucchini to be tested is identified as zucchini inbred line 0421;
[0023] If the SSR amplification product of the zucchini to be tested contains a DNA fragment with a size of 193 bp, the zucchini to be tested is identified as zucchini inbred line 07754.
[0024] The method for identifying Jinghu 36, zucchini inbred line 0421 and zucchini inbred line 07754 protected by the present invention may be specifically method B, which may include the following steps: using the genomic DNA of the zucchini to be tested as a template, using the SSR primer pair to perform PCR amplification to obtain an SSR amplification product; and making the following judgments based on the nucleotide sequence of the DNA fragment contained in the SSR amplification product:
[0025] If the SSR amplification product of the zucchini to be tested contains two DNA fragments and the nucleotide sequences are shown as SEQ ID NO: 3 and SEQ ID NO: 4, respectively, the zucchini to be tested is identified as Jinghu 36;
[0026] If the SSR amplification product of the zucchini to be tested contains a DNA fragment and the nucleotide sequence is as shown in SEQ ID NO: 3, the zucchini to be tested is identified as zucchini inbred line 0421;
[0027] If the SSR amplification product of the zucchini to be tested contains one DNA fragment and the nucleotide sequence is as shown in SEQ ID NO: 4, the zucchini to be tested is identified as zucchini inbred line 07754.
[0028] In any of the above methods, the genomic DNA may be the genomic DNA of the radicle. That is, in the method A or the method B, the genomic DNA of the zucchini to be tested may be the genomic DNA of the radicle of the zucchini to be tested. That is, in the method I, the method II or the method III, the genomic DNA of the Jinghu 36 hybrid to be tested may be the genomic DNA of the radicle of the Jinghu 36 hybrid to be tested.
[0029] In any of the above methods, non-denaturing polyacrylamide gel electrophoresis is used to detect the SSR amplification product.
[0030] The non-denaturing polyacrylamide gel electrophoresis may be 8% non-denaturing polyacrylamide gel electrophoresis.
[0031] The present invention also protects the use of the SSR primer pair in identifying the purity of the Jinghu 36 hybrid to be tested.
[0032] The present invention also protects the use of the SSR primer pair in identifying Jinghu 36, zucchini inbred line 0421 and zucchini inbred line 07754.
[0033] In the above application, Jinghu 36 (or Jinghu 36 hybrid) has two electrophoresis bands with band sizes of 193 bp and 198 bp respectively; zucchini inbred line 0421 has one electrophoresis band with a band size of 198 bp; zucchini inbred line 07754 has one electrophoresis band with a band size of 193 bp; the nucleotide sequence of the band with a size of 198 bp is shown in SEQ ID NO: 3; the nucleotide sequence of the band with a size of 193 bp is shown in SEQ ID NO: 4.
[0034] Jinghu 36 has obvious hybrid advantages, but during hybrid seed production, the mother plant often self-pollinates due to incomplete emasculation of the mother plant zucchini inbred line 0421, resulting in false hybrids. Low seed purity seriously affects the yield and quality of Jinghu 36, causing economic losses. It is necessary to identify the seed purity of Jinghu 36 hybrids before they are sold. The traditional method of hybrid seed purity identification is to observe the phenotype after the plant is planted, which is costly, time-consuming and inaccurate. Some improved molecular identification technologies also have the problem of growing to the seedling stage and using toxic and harmful drugs during DNA extraction.
[0035] The present invention establishes a method for rapidly identifying the purity of Jinghu 36 hybrids, significantly shortens the time for identifying the purity of Jinghu 36 hybrids, simplifies the DNA extraction operation steps, and greatly saves the cost and labor of hybrid purity identification. That is, it has the advantages of being fast, accurate, low-cost, and easy to operate, and can perform Jinghu 36 hybrid purity analysis to improve the timeliness of hybrid production and sales. The present invention has high commercial application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0036] Figure 1 The results of non-denaturing polyacrylamide gel electrophoresis of SSR primer pairs amplifying Jinghu 36, zucchini inbred line 0421 and zucchini inbred line 07754. DETAILED DESCRIPTION
[0037] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.
[0038] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.
[0039] Example 1. Development of SSR primer pairs for identifying the purity of Jinghu 36 hybrids
[0040] 1. Take the seeds of Jinghu 36, soak them in clean water for 4 hours, place them in a constant temperature incubator at 32°C for germination for 24 hours, and then plant them in a mixture of nutrient soil and vermiculite (1:1), culture them at 25-30°C, collect leaves of 30 plants of equal mass and mix them after 14 days to obtain sample 1.
[0041] 2. According to the method of step 1, replace Jinghu 36 with zucchini inbred line 0421 and zucchini inbred line 07754 respectively, and keep other steps unchanged, to obtain samples 2 and 3 respectively.
[0042] 3. Extract genomic DNA from samples 1, 2, and 3, and then screen the 756 pairs of SSR molecular markers distributed on 20 chromosomes of zucchini for molecular markers that are polymorphic and have one amplified band between samples 2 and 3, and two amplified bands in sample 1 (one from sample 2 and the other from sample 3). Finally, a polymorphic, stable amplification, and easy statistical SSR primer pair was obtained for the purity identification of Jinghu 36.
[0043] The SSR primer pair obtained by screening consisted of an upstream primer JH36F: 5'-CGTTCTTACCTTTTTGCCTCG-3' (SEQ ID NO: 1) and a downstream primer JH36R: 5'-AAATGAACTCAAAACGTCAACAAAC-3' (SEQ ID NO: 2).
[0044] The upstream primer JH36F and the downstream primer JH36R were artificially synthesized.
[0045] Example 2: Establishment of a method for identifying the purity of Jinghu 36 hybrid using the SSR primers developed in Example 1. 1. Obtaining the genomic DNA of the radicle of zucchini to be tested
[0046] The zucchini to be tested was Jinghu 36, zucchini inbred line 0421 or zucchini inbred line 07754.
[0047] 1. Take 100 zucchini seeds to be tested, wrap them with gauze, soak them in clean water for 4 hours, and shake off the water.
[0048] 2. After completing step 1, place the zucchini seeds to be tested under constant temperature and moisture retention conditions at 32°C for germination until the radicle grows to about 1.0 cm (about 24 hours of germination).
[0049] 3. After completing step 2, cut the radicle with a length of about 0.6 cm and place it in a centrifuge tube (specification: 2.0 mL), then add 4 small steel balls (diameter: 2 mm) and 70 μL NaOH solution (concentration: 0.4 M, solvent: water), and place them together in a plant tissue disruptor (product of Shanghai Jingxin Industrial Development Co., Ltd., model: Tissue-prp-01) for oscillation and disruption for 1 min, and finally boil in water for 1 min to obtain tissue disruption solution.
[0050] 4. After completing step 3, 10 μL of tissue disruption solution and 190 μL of pH 8.0, 100 mM Tris-HCl buffer were shaken and mixed to obtain the genomic DNA of the zucchini radicle to be tested.
[0051] 2. PCR Amplification
[0052] Using 30 ng of genomic DNA of the radicle of zucchini to be tested as a template, PCR amplification was performed using the upstream primer JH36F and the downstream primer JH36R synthesized in Example 1 to obtain an SSR amplification product.
[0053] The reaction system was 15 μL, consisting of dNTPs (product of Tiangen Biochemical Technology (Beijing) Co., Ltd., catalog number CD111), 1.5 μL 10× buffer (component in Taq DNA polymerase), 0.2 μL Taq DNA polymerase (product of Beijing Quanshijin Biotechnology Co., Ltd., catalog number AP101-01), 0.3 μL upstream primer JH36F aqueous solution (concentration 10 μM), 0.3 μL downstream primer JH36R aqueous solution (concentration 10 μM) and ultrapure water. In the reaction system, the concentrations of dATP, dTTP, dCTP and dGTP were all 2.5 mM.
[0054] The reaction procedure was as follows: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 30 s, annealing at 54°C for 30 s, extension at 72°C for 25 s, 35 cycles; extension at 72°C for 5 min; and storage at 4°C.
[0055] 3. Non-denaturing polyacrylamide gel electrophoresis
[0056] The SSR amplification product obtained in step 2 was electrophoresed on 8% non-denaturing polyacrylamide gel at 160V for 70 min. The DNA molecular weight standard used was Trans DNA marker I (a product of Beijing Quanshijin Biotechnology Co., Ltd., product catalog number BM401-01). The electrophoresis bands were observed and photographed on a light box.
[0057] Some of the results of non-denaturing polyacrylamide gel electrophoresis are shown in Figure 1 (M is Trans DNA marker I, P1 is zucchini inbred line 0421, P2 is zucchini inbred line 07754, and F1 is Jinghu 36).
[0058] The above experiment was repeated 3 times, and the target specific bands of the SSR amplification products were sequenced. The statistical band results of the sequencing results are as follows:
[0059] (1) Using Jinghu 36 as template, two bands were obtained and the band sizes were 193 bp and 198 bp respectively;
[0060] (2) Using zucchini inbred line 0421 as template, amplification obtained a band with a size of 198 bp;
[0061] (3) Using zucchini inbred line 07754 as a template, amplification obtained a band with a size of 193 bp;
[0062] The nucleotide sequence of the 198 bp band is:
[0063] CGTTCTTACCTTTTTGCCTCGGTTTTGTCAAGATTCCATCCACCCCACATCCATATATCCACAAATGCTCTGTTTTTCTTTACAAATTTGGTCATTTTTAGAGTCTTGATCGCTAAATCTCTCTCTCTCTCTCGTGGGGTTTTTGCAAGGTTGTGCATTGGAGTGTTGCTGTTTGTTGACGTTTTGAGTTCATTT (SEQ ID NO: 3);
[0064] The nucleotide sequence of the 193 bp band is:
[0065] CGTTCTTACCTTTTTGCCTCGGTTTTGTCAAGATTCCGTCCACCCCACATCCATATATCCACAAATGCTCTGTTTTTCTTTACAAATTTGGTCATTTTTAGAGTCTTGATCGCTAAATCTCTCTCTCTTGTGGGGTTTTTGCAAGGTTGTGCATTGAGTGTTGCTGTTTGTTGACGTTTTGAGTTCATTT (SEQ ID NO: 4).
[0066] Jinghu 36 is a hybrid. The pseudo-hybrid produced by self-pollination of the female zucchini inbred line 0421 often results in the purity of the real Jinghu 36 hybrid being unqualified. Therefore, the above method can be used to identify the purity of the Jinghu 36 hybrid. The specific identification method is as follows:
[0067] Using the genomic DNA of the tested Jinghu 36 hybrid (such as the genomic DNA of the radicle of the tested Jinghu 36 hybrid) as a template, PCR amplification is performed using the upstream primer JH36F and the downstream primer JH36R to obtain the SSR amplification product; the SSR amplification product is electrophoresed on an 8% non-denaturing polyacrylamide gel, the electrophoresis bands are observed and the following judgment is made:
[0068] If the electrophoresis bands of the tested Jinghu 36 hybrid are two and the band sizes are 193 bp and 198 bp respectively, the tested Jinghu 36 hybrid is identified as Jinghu 36 hybrid (i.e., true hybrid);
[0069] If the electrophoresis band of the hybrid of Jinghu 36 to be tested is one and the band size is 198 bp, the hybrid of Jinghu 36 to be tested is identified as the inbred variety of zucchini inbred line 0421 (i.e., pseudo-hybrid) or zucchini inbred line 0421;
[0070] If the electrophoresis band of the tested Jinghu 36 hybrid is one and the band size is 193 bp, the tested Jinghu 36 hybrid is identified as zucchini inbred line 07754;
[0071] The nucleotide sequence of the band with a size of 198 bp is shown in SEQ ID NO:3; the nucleotide sequence of the band with a size of 193 bp is shown in SEQ ID NO:4.
[0072] Example 3, Accuracy test of the method for identifying the purity of Jinghu 36 hybrid established in Example 2
[0073] The zucchini to be tested is the zucchini inbred line 07754, the zucchini inbred line 0421, or the zucchini inbred line 07754.
[0074] 1. Detection of the purity of Jinghu 36 hybrids using the method established in Example 2
[0075] 1. Obtaining genomic DNA of zucchini radicle to be tested
[0076] The genomic DNA of the radicle of zucchini to be tested was obtained according to the method of step 1 in Example 2.
[0077] 2. PCR amplification
[0078] Using 30 ng of genomic DNA of the radicle of zucchini to be tested as a template, PCR amplification was performed using the upstream primer JH36F and the downstream primer JH36R synthesized in Example 1 to obtain an SSR amplification product.
[0079] The reaction system was 15 μL, consisting of dNTPs (product of Tiangen Biochemical Technology (Beijing) Co., Ltd., catalog number CD111), 1.5 μL 10× buffer (component in Taq DNA polymerase), 0.2 μL Taq DNA polymerase (product of Beijing Quanshijin Biotechnology Co., Ltd., catalog number AP101-01), 0.3 μL upstream primer JH36F aqueous solution (concentration 10 μM), 0.3 μL downstream primer JH36R aqueous solution (concentration 10 μM) and ultrapure water. In the reaction system, the concentrations of dATP, dTTP, dCTP and dGTP were all 2.5 mM.
[0080] The reaction procedure was as follows: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 30 s, annealing at 54°C for 30 s, extension at 72°C for 25 s, 35 cycles; extension at 72°C for 5 min; and storage at 4°C.
[0081] 3. Non-denaturing polyacrylamide gel electrophoresis
[0082] The SSR amplification product obtained in step 2 was electrophoresed on 8% non-denaturing polyacrylamide gel at 160V for 70 min. The DNA molecular weight standard used was Trans DNA marker I. The electrophoresis bands were observed and photographed on a light box.
[0083] The experimental results are as follows:
[0084] Using the to-be-tested Jinghu 36 as a template, PCR amplification was performed using the upstream primer JH36F and the downstream primer JH36R. The electrophoretic pattern obtained showed two electrophoretic bands with band sizes of 193 bp and 198 bp, respectively, indicating that the to-be-tested Jinghu 36 was Jinghu 36.
[0085] Using the zucchini inbred line 0421 to be tested as a template, PCR amplification was performed using the upstream primer JH36F and the downstream primer JH36R. The electrophoretic band in the obtained electrophoretic pattern was one and the band size was 198 bp, indicating that the zucchini inbred line 0421 to be tested was the zucchini inbred line 0421;
[0086] Using the zucchini inbred line 07754 to be tested as a template, PCR amplification was performed using the upstream primer JH36F and the downstream primer JH36R. The electrophoretic band in the obtained electrophoretic pattern was one and the band size was 193 bp, indicating that the zucchini inbred line 07754 to be tested was the zucchini inbred line 07754.
[0087] 2. Phenotypic Identification
[0088] The seeds of the zucchini to be tested were planted in the field, cultured conventionally and the phenotypes were counted. The phenotypic statistical results are as follows:
[0089] The variety to be tested, Jing Hu 36: has vigorous growth, pentagonal leaves with large notches and silvery-white spots, emerald green rind with delicate patterns, and long columnar melons.
[0090] The zucchini inbred line 0421 to be tested has strong growth, shallow notches on the leaves, light green rind, delicate patterns, and long stick-shaped melons.
[0091] The zucchini inbred line to be tested, 07754, had medium growth, deeply notched leaves, dark green rind with small patterns, and long stick-shaped melons.
[0092] The phenotypic identification results showed that the tested Jinghu 36 was indeed Jinghu 36, the tested zucchini inbred line 0421 was indeed zucchini inbred line 0421, and the tested zucchini inbred line 07754 was indeed zucchini inbred line 07754.
[0093] The above results show that the method established in Example 2 can accurately detect Jinghu 36, zucchini inbred line 0421 and zucchini inbred line 07754, thereby identifying the purity of Jinghu 36 hybrids.
[0094] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.
Claims
1. SSR primer pair, consisting of upstream primer JH36F and downstream primer JH36R; The nucleotide sequence of the upstream primer JH36F is shown in SEQ ID NO: 1; The nucleotide sequence of the downstream primer JH36R is shown in SEQ ID NO:
2.
2. A method for identifying the purity of a tested Jinghu 36 hybrid, comprising the following steps: using the genomic DNA of the tested Jinghu 36 hybrid as a template, performing PCR amplification using the SSR primer pair of claim 1 to obtain an SSR amplification product; and making the following judgment based on the number of DNA fragments contained in the SSR amplification product: If the SSR amplification product of the tested Jinghu 36 hybrid contains two DNA fragments, the tested Jinghu 36 hybrid is identified as Jinghu 36 hybrid, that is, the purity is 100%; If the SSR amplification product of the tested Jinghu 36 hybrid contains one DNA fragment, the tested Jinghu 36 hybrid is identified as a non-Jinghu 36 hybrid.
3. A method for identifying the purity of a tested Jinghu 36 hybrid, comprising the following steps: using the genomic DNA of the tested Jinghu 36 hybrid as a template, performing PCR amplification using the SSR primer pair of claim 1 to obtain an SSR amplification product; and making the following judgments based on the size of the DNA fragment contained in the SSR amplification product: If the SSR amplification product of the tested Jinghu 36 hybrid contains two DNA fragments with sizes of 193 bp and 198 bp respectively, the tested Jinghu 36 hybrid is identified as Jinghu 36 hybrid, that is, the purity is 100%; If the SSR amplification product of the tested Jinghu 36 hybrid contains a DNA fragment with a size of 198 bp or 193 bp, the tested Jinghu 36 hybrid is identified as a non-Jinghu 36 hybrid.
4. A method for identifying the purity of a tested Jinghu 36 hybrid, comprising the following steps: using the genomic DNA of the tested Jinghu 36 hybrid as a template, performing PCR amplification using the SSR primer pair of claim 1 to obtain an SSR amplification product; and making the following judgments based on the nucleotide sequence of the DNA fragment contained in the SSR amplification product: If the SSR amplification product of the tested Jinghu 36 hybrid contains two DNA fragments and the nucleotide sequences are respectively shown as SEQ ID NO: 3 and SEQ ID NO: 4, then the tested Jinghu 36 hybrid is identified as Jinghu 36 hybrid, that is, the purity is 100%; If the SSR amplification product of the Jinghu 36 hybrid to be tested contains one DNA fragment and the nucleotide sequence is as shown in SEQ ID NO: 3 or SEQ ID NO: 4, the Jinghu 36 hybrid to be tested is identified as a non-Jinghu 36 hybrid.
5. A method for identifying Jinghu 36, zucchini inbred line 0421 and zucchini inbred line 07754, comprising the following steps: using the genomic DNA of the zucchini to be tested as a template, performing PCR amplification using the SSR primer pair of claim 1 to obtain an SSR amplification product; and making the following judgments based on the size of the DNA fragment contained in the SSR amplification product: If the SSR amplification product of the zucchini to be tested contains two DNA fragments with sizes of 193 bp and 198 bp respectively, the zucchini to be tested is identified as Jinghu 36; If the SSR amplification product of the zucchini to be tested contains a DNA fragment with a size of 198 bp, the zucchini to be tested is identified as zucchini inbred line 0421; If the SSR amplification product of the zucchini to be tested contains a DNA fragment with a size of 193 bp, the zucchini to be tested is identified as zucchini inbred line 07754.
6. A method for identifying Jinghu 36, zucchini inbred line 0421 and zucchini inbred line 07754, comprising the following steps: using the genomic DNA of the zucchini to be tested as a template, performing PCR amplification using the SSR primer pair of claim 1 to obtain an SSR amplification product; and making the following judgments based on the nucleotide sequence of the DNA fragment contained in the SSR amplification product: If the SSR amplification product of the zucchini to be tested contains two DNA fragments and the nucleotide sequences are shown as SEQ ID NO: 3 and SEQ ID NO: 4, respectively, the zucchini to be tested is identified as Jinghu 36; If the SSR amplification product of the zucchini to be tested contains a DNA fragment and the nucleotide sequence is as shown in SEQ ID NO: 3, the zucchini to be tested is identified as zucchini inbred line 0421; If the SSR amplification product of the zucchini to be tested contains one DNA fragment and the nucleotide sequence is as shown in SEQ ID NO: 4, the zucchini to be tested is identified as zucchini inbred line 07754.
7. The method according to any one of claims 2 to 6, characterized in that: The genomic DNA is the genomic DNA of the radicle.
8. The method according to any one of claims 2 to 6, characterized in that: The SSR amplification products were detected by non-denaturing polyacrylamide gel electrophoresis.
9. Use of the SSR primer pair described in claim 1 in identifying the purity of the Jinghu 36 hybrid to be tested.
10. Use of the SSR primer pair according to claim 1 in identifying Jinghu 36, zucchini inbred line 0421 and zucchini inbred line 07754.