Lycium barbarum protein for regulating oxidative stress caused by exercise fatigue and preparation method of lycium barbarum protein

Abstract

The invention discloses a medlar protein for regulating oxidative stress caused by exercise fatigue and a preparation method thereof, and belongs to the technical field of processing of food / agricultural products and byproducts thereof. According to the method, fresh Chinese wolfberry fruits are pulped and then subjected to slit-shaped ultrasonic strengthening treatment to obtain raw pulp, and the prepared Chinese wolfberry fruit protein exhausts swimming exercise fatigue oxidative stress model mice through oral administration and intragastric administration, so that the exercise fatigue can be recovered by effectively adjusting oxidative stress caused by the exercise fatigue. The lycium barbarum protein, subunit composition and amino acid composition prepared by the method are clear, the amino acid composition is reasonable, and the lycium barbarum protein can be applied to various recovery products for different types of exercise fatigue oxidative stress, such as various sports drinks, snacks and other supplementary foods in any processing form.

Description

Technical Field

[0001] The invention belongs to the technical field of processing food / agricultural products and their by-products, and relates to a wolfberry protein for regulating sports fatigue oxidative stress through Nrf2 pathway and a preparation method thereof. Background Art

[0002] Exercise-induced fatigue is a common physiological phenomenon, which is mainly manifested as a decrease in muscle performance caused by excessive physical activity. This fatigue can seriously affect an individual's daily life, especially athletes, military personnel, and people who engage in physical labor. The three main theories of exercise-related fatigue are energy consumption, metabolite accumulation, and oxidative stress. Exercise fatigue is closely related to oxidative reactions. Intense exercise can produce too many reactive oxygen free radicals, leading to the destruction of internal redox homeostasis, affecting the intracellular metabolic level and accelerating lipid peroxidation and mitochondrial energy supply, ultimately leading to tissue damage and muscle weakness.

[0003] Many literature reports show that nutritional supplements can enhance the accumulation of specific nutrients in skeletal muscle and liver, thus having advantages in promoting exercise recovery. Ning et al. used network pharmacology to determine that six active ingredients in wolfberry have multiple pathways to improve exercise fatigue. Cao Rongrong, Liu Haixia et al. have confirmed that wolfberry water extract can relieve exercise fatigue in mice, but the components of the water extract are complex, including polysaccharides, soluble proteins, pigments, polyphenol flavonoids, etc., and the relevant pathways of action for relieving fatigue are still unclear.

[0004] Based on the previous research of our research group that confirmed that wolfberry protein has strong antioxidant properties in vitro, we established an ICR mouse exercise fatigue oxidative stress model, and orally administered different doses of wolfberry protein to study its effects on serum fatigue markers (lactate and urea levels), oxidative stress markers (SOD activity and MDA levels), muscle glycogen and liver glycogen levels in the liver, oxidative stress markers (SOD activity and MDA levels), and transcription levels of genes related to the Nrf2 pathway in exercise fatigue mice. The results showed that wolfberry protein can have a positive regulatory effect on exercise fatigue oxidative stress mice through the Nrf2 / Keap-1 pathway, and thus proposed this patent. Provide new food resources for recovery of different types of exercise fatigue oxidative stress. Summary of the invention

[0005] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical scheme:

[0006] A method for preparing wolfberry protein for regulating sports fatigue oxidative stress is carried out according to the following steps:

[0007] (1) Preparation of wolfberry protein. Fresh wolfberries were pretreated and pulped in a pulper for 10 min. The pulp was subjected to slit-shaped ultrasonic intensification treatment, with the ultrasonic power controlled at 300 W, the dual-frequency ultrasonic frequency combination at 28 / 33 kHz, the flow rate at 0.5 m / s, the cumulative ultrasonic treatment at 30 min, and the intermittent ratio at 5 s / 2 s to obtain wolfberry pulp, which was centrifuged (10,000 r / min, 15 min), filtered, and the supernatant collected.

[0008] (2) The pH of the supernatant was adjusted to 3.5 with 1 mol / L HCl, allowed to settle for 12 h, and centrifuged (4000 r / min, 25 min) to collect the precipitate; the precipitate was washed and redissolved in distilled water, and the pH was adjusted to 7.0. The precipitate was placed in a dialysis bag, and the distilled water was replaced every 6 h. The dialysis was performed for 72 h to obtain a protein concentrate, which was freeze-dried to obtain wolfberry protein for subsequent experiments.

[0009] The experimental steps of the regulatory effect of wolfberry protein obtained by the above preparation method on exercise fatigue oxidative stress mice are as follows:

[0010] ① Experimental animals and groups: 50 SPF ICR male mice were fed for one week at 25℃, 60% relative humidity, 12h / 12h light-dark alternation, with free access to food and water. They were randomly divided into 5 groups, namely, quiet control group, swimming control group, wolfberry protein low-dose, medium-dose, and high-dose groups, with 10 mice in each group.

[0011] ② Oral gavage dose: The low, medium and high dose groups of wolfberry protein were gavaged with 60, 180 and 360 mg / kg BW of wolfberry protein per day, respectively; the quiet control group and the swimming control group were gavaged with an equal volume of normal saline. All samples were prepared immediately before use. The mice were gavaged continuously for 25 days, and the condition of the mice was observed regularly and the body weight was recorded. The gavage dose was adjusted according to the body weight of the mice during this period.

[0012] ③ Weight-bearing exhaustive swimming test for mice. 30 minutes after the end of gavage on the 25th day, the mice in the swimming control group and the wolfberry protein group were respectively loaded with lead sheets on the tails of the mice, with a weight of 7% of their body weight, and swam in a swimming box with a water temperature of about 25°C until exhaustion. Throughout the experiment, ensure that the limbs of each mouse remain active at all times. If the mouse floats on the water surface and stops moving, a glass rod can be used to gently stir around it to keep it active. The exhaustion standard is that the mouse's swimming limbs are uncoordinated, choking, the stroke frequency is extremely slow, it sinks continuously, and the head sinks to the water surface for 7s and still does not float up. Record the time from the start of swimming to exhaustion. After the experiment, rest for 10 minutes, collect blood from the eyeballs, centrifuge to obtain serum, and liver tissue for subsequent index determination. All the above experimental protocols have been reviewed by the Animal Care and Use Committee of Jiangsu University, with the ethics review number UJS-IACUC-2023103001, and all operations comply with relevant animal use and protection regulations.

[0013] (3) Lycium barbarum protein can be used to regulate oxidative stress caused by different types of sports fatigue and can be made into related supplementary products, such as sports drinks, snacks, and any other processed supplementary foods.

[0014] Beneficial effects of the present invention:

[0015] (1) The wolfberry protein prepared by the present invention has clear subunit composition and amino acid composition, and the amino acid composition is balanced.

[0016] (2) The wolfberry protein of the present invention is suitable for regulating oxidative stress caused by sports fatigue, removing excessive reactive oxygen free radicals, maintaining redox balance in the body, and quickly recovering from induced fatigue.

[0017] (3) The wolfberry protein of the present invention can be used in various types of sports fatigue oxidative stress recovery products, such as various sports drinks, snacks and any other processed supplementary foods to recover from sports fatigue. DETAILED DESCRIPTION

[0018] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below.

[0019] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0020] The technical scheme of the present invention is further described below in conjunction with specific embodiments. The wolfberry protein used in the present invention is prepared by separating fresh wolfberry from wolfberry after pulping and subjecting it to slit-shaped ultrasonic strengthening treatment. The slit-shaped ultrasonic treatment conditions are as follows: power 300W, dual-frequency ultrasonic frequency combination 28 / 33kHz, the flow rate of the slurry flowing through the slit cavity is 0.5m / s, the cumulative ultrasonic time is 30min, and the intermittent ratio is 5s / 2s.

[0021] The subunit composition of wolfberry protein was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The amino acid composition was determined by Jiang et al. (Jiang S, Liu L, Xu J, et al. Amino acid composition and digestibility of Pacific oyster (Crassostrea gigas) proteins isolated from different parts. LWT, 2019, 116: 108591) using an automatic amino acid analyzer. The superoxide dismutase SOD activity and MDA content in serum and liver were determined using the kit method (Nanjing Jiancheng Bioengineering Research Institute Co., Ltd.). The amount of gene mRNA in the liver was determined by fluorescence quantitative PCR, with the gene primers Nrf2 (AAGCACAGCCAGCACATTCTCC, TGACCAGGACTCACGGGAACTTC), Keap-1 (TGGTCGCCCTGTGCCTCTATG, CACGCTGCTGTGGTGGATGC), NQO-1 (ATCCTGCGTTTCTGTGGCTTCC, TCCTCCCAGACGGTTTCCAGAC), HO-1 (ACAGCCCCACCAAGTTCAAACAG, GTTGAGCAGGAAGGCGGTCTTAG), and β-actin (CAGCCTTCCTTCTTGGGTATGGGCATAGAGGTCTTTACGGATG).

[0022] The present invention provides a method for preparing wolfberry protein for regulating sports fatigue oxidative stress, which is carried out according to the following steps:

[0023] (1) 1 kg of pretreated fresh wolfberry was taken and pulped in a pulper for 10 min. The pulp was subjected to slot ultrasonic intensification treatment, with the ultrasonic power controlled at 300 W, the dual-frequency ultrasonic frequency combination at 28 / 33 kHz, and the flow rate at 0.5 m / s. The cumulative ultrasonic treatment lasted for 30 min, and the intermittent ratio was 5 s / 2 s to obtain wolfberry pulp. The pulp was centrifuged at 10,000 r / min for 15 min, filtered, and the supernatant was collected;

[0024] (2) The pH of the supernatant was adjusted to 3.5 with 1 mol / L HCl, and the solution was allowed to settle for 12 h. The solution was centrifuged at 4000 r / min for 25 min, and the precipitate was collected. The precipitate was washed and redissolved in distilled water, and the pH was adjusted to 7.0. The precipitate was placed in a dialysis bag, and the distilled water was replaced every 6 h. The solution was dialyzed for 72 h to obtain a protein concentrate, which was freeze-dried to obtain 24.1 g of wolfberry protein.

[0025] Example 1

[0026] Mice were gavaged with 60 mg / kg BW of wolfberry protein for 25 consecutive days. The condition of the mice was observed regularly and the body weight was recorded. The gavage dose was adjusted according to the body weight of the mice. On the 25th day, 30 minutes after the gavage, the mice were weighted with lead sheets on their tails, with a weight of 7% of their body weight, and they swam in a swimming box with a water temperature of about 25°C until exhaustion. Throughout the experiment, ensure that the limbs of each mouse remain active at all times. If the mouse floats on the water and stops moving, a glass rod can be used to gently stir it around to keep it active. The exhaustion standard is that the mouse's swimming limbs are uncoordinated, choking, the stroke frequency is extremely slow, it sinks continuously, and the head sinks to the water surface for 7s and still does not float up. Record the time from the start of swimming to exhaustion. After the experiment, rest for 10 minutes, collect blood from the eyeballs, centrifuge to obtain serum, and liver tissue for subsequent index determination.

[0027] Example 2

[0028] The mice were intragastrically administered with 180 mg / kg BW of wolfberry protein. The rest of the experimental methods and procedures were the same as those in Example 1.

[0029] Example 3

[0030] Mice were intragastrically administered with 360 mg / kg BW of wolfberry protein. The remaining experimental methods and procedures were the same as those in Example 1.

[0031] Comparative Example 1

[0032] In the swimming control group, mice were gavaged with an equal volume of normal saline, and the rest of the experimental methods and procedures were the same as in Example 1.

[0033] Comparative Example 2

[0034] In the quiet control group, mice were gavaged with an equal volume of normal saline. Except for not swimming, the rest of the methods and procedures were the same as those in Example 1.

[0035] Lycium barbarum protein is mainly composed of three subunits: 60-70 kDa, 35-40 kDa, and 15-20 kDa. The amino acid composition of Lycium barbarum protein is shown in Table 1. Lycium barbarum protein is rich in aromatic amino acids (Tyr, Phe), branched-chain amino acids (Val, Ile, Leu) and Pro, all of which have certain antioxidant properties.

[0036] Table 1 Effect of the amino acid composition of wolfberry protein

[0037] Amino Acids Content (g / 100g) Asp 11.26 Thr 5.04 Ser 5.29 Glu 14.42 Gly 5.22 Ala 5.99 Cys 1.24 Val 5.69 Met 1.22 Ile 5.43 Leu 8.30 Tyr 4.35 Phe 5.07 His 3.42 Lys 7.76 Arg 5.59 Pro 4.89 Total amino acids 78.54 Hydrophobic amino acids 41.82 Hydrophilic amino acids 15.93 Total essential amino acids 41.94 Branched Chain Amino Acids 25.54 Aromatic amino acids 9.42

[0038] The effects of wolfberry protein on relevant indicators of exercise fatigue and oxidative stress mice are shown in Table 2.

[0039] As can be seen from Table 2, after exhaustive swimming, the levels of lactic acid and urea, sports fatigue markers in the serum of mice in the comparative example 1 group were increased, the levels of lipid peroxidation products MDA in the serum and liver were increased, and the SOD activity decreased, and there were significant differences compared with the mice in the comparative example 2 group (p<0.05). This shows that sports fatigue induces oxidative stress damage. The mice in the groups gavaged with wolfberry protein in Examples 1-3 all increased SOD activity and reduced MDA content to varying degrees, and reduced lactic acid and urea nitrogen content, showing an effective regulatory effect on sports fatigue oxidative stress.

[0040] Table 2 Effects of wolfberry protein on related indicators of exercise fatigue and oxidative stress mice

[0041]

[0042] After exhaustive swimming, the relative mRNA expression of Nrf2 and NQO-1 in the liver of the mice in the comparative example 1 group was significantly reduced, and there was a significant difference compared with the normal mice in the comparative example 2 (p<0.05); the wolfberry protein treatment group significantly increased the expression levels of Nrf2 and NQO-1 mRNA in a dose-dependent manner (p<0.05). Compared with the comparative example 1 group, the expression level of Keap-1 mRNA in the wolfberry protein treatment group was significantly reduced (p<0.05), which was negatively correlated with the dose. HO-1 is the rate-limiting enzyme for heme degradation. In the state of stress of the body, it can prevent free heme from participating in oxidation reactions, and play an antioxidant role together with its enzymatic hydrolysis products CO and bilirubin. Compared with the comparative example 1 group, the wolfberry protein group increased the expression level of HO-1 mRNA in the liver of mice in a dose-dependent manner (p<0.05). It shows that wolfberry protein can reduce the level of Keap-1 and inhibit its formation of a complex with Nrf2, thereby activating Nrf2 and starting the endogenous antioxidant pathway to exert antioxidant activity, which helps to enhance the ability of the mouse antioxidant system to scavenge oxidative free radicals and thus restore exercise fatigue.

[0043] The present invention has been described by what are currently considered to be the most preferred and practical embodiments, and it should be understood that the present invention is not limited to the disclosed embodiments. On the contrary, its purpose is to cover various modifications and equivalent arrangements within the spirit and scope of the appended claims, and its scope is to be given the broadest interpretation to include all such modifications and equivalent structures permitted under the law.

Claims

1. A method for preparing wolfberry protein for regulating sports fatigue oxidative stress, characterized in that Follow these steps: (1) Preparation of wolfberry protein: fresh wolfberries were pulped and subjected to slit-shaped ultrasonic enhancement treatment to obtain wolfberry pulp, which was centrifuged (10,000 r / min, 15 min) and the supernatant was collected by filtration; (2) The pH of the supernatant was adjusted to 3.5 with 1 mol / L HCl, and the solution was allowed to settle for 12 h. The solution was centrifuged (4000 r / min, 25 min) and the precipitate was collected. The precipitate was washed and redissolved in distilled water. The pH was adjusted to 7.0 and the solution was placed in a dialysis bag. The distilled water was replaced every 6 h. The solution was dialyzed for 72 h to obtain a protein concentrate. The protein was then freeze-dried to obtain wolfberry protein.

2. A method for preparing wolfberry protein for regulating sports fatigue oxidative stress, characterized in that The parameters of the slit-shaped ultrasonic enhancement treatment in step (1) are: power 300 W, dual-frequency ultrasonic frequency combination 28 / 33 kHz, flow rate 0.5 m / s, cumulative ultrasonic treatment 30 min, and intermittent ratio 5 s / 2 s.

3. The wolfberry protein obtained according to the preparation method described in claim 1, characterized in that Lycium barbarum protein can increase the activity of SOD in the serum and liver of the body with exercise fatigue, reduce the content of lipid peroxidation product MDA, reduce the content of lactic acid and urea nitrogen, and activate the endogenous antioxidant pathway Nrf2 to play a regulatory role in oxidative stress caused by exercise fatigue.

4. The wolfberry protein obtained according to the preparation method described in claim 1, characterized in that It can be used to regulate oxidative stress caused by different types of sports fatigue, and can be made into related supplementary products, such as sports drinks, snacks, and any other processed supplementary foods.

Images