Virus RNAi inhibitor screening vector as well as construction method and application thereof

Abstract

The invention provides a virus RNAi inhibitor screening vector as well as a construction method and application thereof, and belongs to the technical field of viruses. The virus RNAi suppressor screening vector comprises a green fluorescent protein coding gene expression cassette and a shRNA expression cassette targeting a green fluorescent protein coding gene, the nucleotide sequence of the shRNA is as shown in SEQ ID NO: 2 or SEQ ID NO: 3. According to the invention, the green fluorescent protein coding gene and the shRNA are cloned into the same expression vector, so that the consistency of transfection efficiency is ensured. The invention further provides a screening method of the virus RNAi suppressor, the virus RNAi suppressor screening vector and the recombinant vector for expressing the virus RNAi suppressor to be screened are co-transfected into cells, and the screening result is judged according to the green fluorescence intensity. According to the technical scheme, operation is easy and convenient, the screening result is accurate and reliable, and wide application and popularization value is achieved.

Description

Technical Field

[0001] The invention belongs to the field of virus technology, and specifically relates to a virus RNAi inhibitor screening vector and a construction method and application thereof. Background Art

[0002] RNA interference (RNAi) is a natural antiviral immune mechanism that is stimulated by virus-specific double-stranded RNA (dsRNA) produced by plant viruses, insect viruses, and nematode viruses when infecting the host. In mammalian cells, it can also be stimulated by specific miRNA expressed by the host or virus. In order to resist this host antiviral mechanism, many plant viruses and insect viruses encode viral proteins or small non-coding nucleic acids that play the role of RNAi suppressors (VSRs). Recent studies have shown that some mammalian viruses also encode VSRs, such as NS1 encoded by influenza virus and Tat encoded by HIV. At present, the discovery of new VSRs and the study of their mechanisms of inhibiting RNAi have received increasing attention.

[0003] Releasing the inhibitory effect of VSR and releasing the host's RNAi antiviral potential is a new strategy for antiviral research. In order to give full play to the antiviral effect of RNAi immunity, small molecule compounds targeting VSR can be used to release the host's inherent RNAi antiviral efficacy. Therefore, how to identify VSR is the key to implementing this strategy.

[0004] VSR is not conservative in gene sequence and protein structure, and the action sites in the RNAi mechanism are also different. Although VSRs from different sources have no obvious similarities in protein sequences, they often have some conservative functional motifs, such as dsRNA binding motifs and GW motifs, which are the basis for VSR bioinformatics analysis and the structural basis for VSR cross-species action. Therefore, bioinformatics methods can be used as an auxiliary means for VSR identification, and the verification of its function ultimately depends on experimental methods. RNA interference systems based on green fluorescent protein and dual luciferase genes are currently commonly used VSR screening methods. By constructing pshRNA expression vectors of green fluorescent protein or dual luciferase genes or synthesizing siRNA, and then co-transfecting culturable cells (such as insect cells, mammalian cells, etc.) with green fluorescent protein or dual luciferase gene expression vectors and potential VSR protein expression vectors, it is judged whether the protein has RNAi inhibitory effect by the recovery of fluorescence. The main disadvantage of this method is that it is necessary to transform three plasmids at the same time, which is not only cumbersome in operation, but also difficult to ensure the stability of various plasmid transfection efficiencies, which will have a certain impact on the experimental results. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a viral RNAi inhibitor screening vector, which comprises a green fluorescent protein encoding gene and a shRNA expression cassette, thereby ensuring the consistency of transfection efficiency after transfection.

[0006] The present invention provides a viral RNAi inhibitor screening vector, which uses a vector for expressing heterologous genes in mammals as a backbone vector, and also includes a green fluorescent protein encoding gene expression cassette and an shRNA expression cassette targeting the green fluorescent protein encoding gene;

[0007] The nucleotide sequence of the shRNA in the shRNA expression cassette is shown in SEQ ID NO: 2 and / or SEQ ID NO: 3.

[0008] Preferably, the backbone vector comprises a pLKO.1puro vector;

[0009] The cloning site of the shRNA expression cassette includes between the AgeI restriction site and the EcoRI restriction site.

[0010] Preferably, the green fluorescent protein encoding gene expression cassette comprises the nucleotide sequence shown in SEQ ID NO:7.

[0011] The invention provides a virus RNAi inhibitor screening kit, comprising the virus RNAi inhibitor screening vector and a vector for expressing the virus RNAi inhibitor to be screened.

[0012] Preferably, the vector for expressing the viral RNAi inhibitor to be screened comprises an expression vector with a His tag;

[0013] The kit also includes a His tag detection card.

[0014] Preferably, a positive control is also included;

[0015] The positive control comprises a recombinant expression vector containing the viral RNAi inhibitor targeted by the shRNA.

[0016] Preferably, the shRNA-targeted viral RNAi inhibitor comprises a nucleotide sequence as shown in SEQ ID NO:8.

[0017] The present invention provides application of the viral RNAi inhibitor screening vector or the viral RNAi inhibitor screening kit in screening viral RNAi inhibitors.

[0018] The present invention provides a method for screening viral RNAi inhibitors, comprising the following steps:

[0019] Cloning the viral RNAi inhibitor to be screened into an expression vector to obtain a recombinant expression vector;

[0020] The recombinant expression vector and the viral RNAi inhibitor screening vector were co-transfected into mammalian cells for culture, and mammalian cells transfected with only the viral RNAi inhibitor screening vector were used as controls. The green fluorescence intensity in the cells was observed, and the results were judged according to the green fluorescence intensity:

[0021] When the green fluorescence intensity in the cells is significantly increased compared with the negative control group, it indicates that the viral RNAi inhibitor to be screened is a viral RNAi inhibitor with anti-host RNAi.

[0022] Preferably, the viral RNAi suppressor to be screened includes white spot syndrome virus RNAi suppressor;

[0023] The white spot syndrome virus RNAi inhibitor includes the nucleotide sequence shown in SEQ ID NO:9.

[0024] The present invention provides a viral RNAi inhibitor screening vector, which uses a vector for expressing heterologous genes in mammals as a backbone vector, and also includes a fluorescent protein encoding gene expression cassette and an shRNA expression cassette targeting the fluorescent protein encoding gene; the nucleotide sequence of the shRNA in the shRNA expression cassette is shown in SEQ ID NO:2 and / or SEQ ID NO:3. The present invention constructs a green fluorescent protein encoding gene and an shRNA targeting the fluorescent protein encoding gene into the same vector capable of expressing heterologous genes in mammals or cells, so that in the subsequent screening process, the green fluorescent protein encoding gene and the shRNA are converted to the same copy number in mammalian cells, ensuring the consistency of conversion efficiency, thereby ensuring reliable and accurate results when screening candidate VSRs. At the same time, the shRNA contained in the screening vector of the present invention has a good green fluorescent protein expression inhibition effect, thereby greatly improving the high sensitivity of the VSR screening results. In the embodiment of the present invention, the candidate VSR of white spot syndrome virus was used as an example for verification, and the results showed that compared with the negative control group, the green fluorescence intensity in the 293T cells in the screening group was significantly improved. This is because the candidate VSR of white spot syndrome virus relieved the inhibition of green fluorescent protein expression by RNAi pathway. When the candidate VSR of white spot syndrome virus was VSR, the expression of green fluorescent protein increased, indicating that the screening method was a positive result. It can be seen that the screening vector provided by the present invention has the characteristics of good detection repeatability and short detection cycle, and is suitable for the promotion and use of VSR screening. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Screening vector spectra for viral RNAi suppressors;

[0026] Figure 2 White light and corresponding fluorescence images (100×) of cell transfection experiments in each group;

[0027] Figure 3 is the spectrum of the VSR recombinant vector;

[0028] Figure 4 This is the expression detection result of VSR-6×His tag;

[0029] Figure 5 The results of VSR detection, including 1. VSR, 2. VSR negative control (T293 cells transfected with GFP-shRNA2), 3. VSR positive control (P19);

[0030] Figure 6 The results of yeast two-hybrid analysis of the interaction between VSR and AGO protein in the shrimp RNAi pathway. DETAILED DESCRIPTION

[0031] The present invention provides a viral RNAi inhibitor screening vector, which uses a vector for expressing heterologous genes in mammals as a backbone vector, and also includes a green fluorescent protein encoding gene expression cassette and an shRNA expression cassette targeting the green fluorescent protein encoding gene; the nucleotide sequence of the shRNA in the shRNA expression cassette is shown in SEQ ID NO: 2 and / or SEQ ID NO: 3.

[0032] In the embodiment of the present invention, the shRNA targeting the green fluorescent protein encoding gene was optimized, and the results showed that shRNA-2 (SEQ ID NO: 2) and shRNA-3 (SEQ ID NO: 3) can efficiently target the green fluorescent protein encoding gene and inhibit its expression, thereby reducing the fluorescence intensity in the cells, while shRNA-1 (SEQ ID NO: 1) cannot inhibit the expression of the green fluorescent protein encoding gene, which is manifested as the fluorescence intensity in the cells is not much different from that in the control group.

[0033] In the present invention, the backbone vector preferably includes a pLKO.1puro vector. The cloning site of the shRNA expression cassette includes between an AgeI restriction site and an EcoRI restriction site.

[0034] In the present invention, the green fluorescent protein encoding gene expression cassette preferably includes hPGK promoter-green fluorescent protein encoding gene, and the nucleotide sequence is as shown in SEQ ID NO:7 (TGGGGTTGCGCCTTTTCCAAGGCAGCCCTGGGTTTGCGCAGGGACGCG GCTGCTCTGGGCGTGGTTCCGGGAAACGCAGCGGCGCCGACCCTGGGTCTCGCACATTCTTCACGTCCGTTCGCAGCGTCACCCGGATCTTCGCCGCTACCCTTGTGGGCCCCCCGGCGACGCTTCCTGCTCCGCCCCTAAGTCGGGAAGGTTCCTTGCGGTTCGCGGCGTGCCGGACGTGACAAACGGAAGCCGCACGTCTCACTAGTACCCTCGCAGACGGACAGCGCCAGGGAGCAATGGCAGCGCG CCGACCGCGATGGGCTGTGGCCAATAGCGGCTGCTCAGCAGGGCGCCGAGAGCAGCGGCCGGGAAGGGGCGGTGCGGGAGGCGGGGTGTGGGGCGGTAGTGTGGGCCCTGTTCCTGCCCGCGC GGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCGACCTCTCTCCCCAGGGGGATCCACCGGAGCTTACCATGGAGAGCGACGAGAGCGGC CTGCCCGCCATGGAGATCGAGT GCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCAAGCAGGGCCG CATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTAC GGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACA CCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCG CGTGATCGGCGACTTCAAGGTGGTGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGC AGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGTGCTGGTGGGCAGCTTCGCCCGCACCTTCAGCC TGCGCGACGGCGGCTACTACAGCTTCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCT GCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGCTGCACAGCAACACCGAGCTGGGCATCGTGGAG TACCAGCACGCCTTCAAGACCCCCATTGCCTTCGCC AGATCCCGCGCTCAGTCGTCCAATTCTGCCGTGGACGGC, where the underlined portion is the GFP sequence).

[0035] The present invention has no special restrictions on the construction method of the viral RNAi inhibitor screening vector, and the construction method known in the art can be used. In the embodiment of the present invention, the viral RNAi inhibitor screening vector is commissioned to be synthesized by Suzhou Hongxun Biotechnology Co., Ltd.

[0036] The invention provides a virus RNAi inhibitor screening kit, comprising the virus RNAi inhibitor screening vector and a vector for expressing the virus RNAi inhibitor to be screened.

[0037] In the present invention, the vector for expressing the viral RNAi inhibitor to be screened preferably includes an expression vector with a His tag, which can be a pcDNA3.1(+) expression vector. The kit also includes a His tag detection card. The His tag detection card is used to detect the expression of the viral RNAi inhibitor to be screened. When the test is positive, it means that the recombinant vector expressing the viral RNAi inhibitor to be screened has successfully cloned the viral RNAi inhibitor encoding gene to be screened, which can be used in subsequent screening methods to prevent false positives.

[0038] In the present invention, the kit preferably further comprises a positive control. The positive control comprises a recombinant expression vector comprising the viral RNAi inhibitor targeted by the shRNA. In an embodiment of the present invention, the viral RNAi inhibitor targeted by the shRNA comprises P19, and the nucleotide sequence is preferably as shown in SEQ ID NO: 8 (ATGGAACGAGCTATACAAGGAAACGACGCTAGGGAACAAGCTAACAGT GAACGTTGGGATGGAGGATCAGGAGGTACCACTTCTCCCTTCAAACTTCCTGACGAAAGTCCGAGTTGGACTGAGTGGCGGCTACATAACGATGAGACGAATTCGAATCAAGATAATCCCCTTGGTTTCAAGGAAAGCTGGGGTTTCGGGAAAGTTGTATTTAAGAGATATCTCAGATACGACAGGACGGAAACTTCATTGCACAGAGTCCTTGGATCTTGGACGGGAGATTCGGTT AACTATGCAGCATCTCGATTTTTCGGTTTCAACCAGATCGGATGTACCTATAGTATTCGGTTTCGAGGAGTTAGTATCACCGTTTCTGGAGGGTCGAGAACTCTTCAGCATCTCTGTGAGATGGCAATTCGGTCTAAGCAAGAACTGCTACAGCTTGCCCCAATCGAAGTGGAAAGTAATGTATCAAGAGGATGCCCTGAAGGTACTGAAACCTTCGAAGAAGAAAGCGAGTAA). The P19 is a viral RNAi inhibitor reported in the prior art. The specific prior art is as follows: Qiu W, Park JW, Scholthof HB. Tombusvirus P19-mediated suppression of virus-induced gene silencing is controlled by genetic and dosage features that influence pathogenicity. Mol Plant Microbe Interact. 2002 Mar; 15(3): 269-80. doi: 10.1094 / MPMI.2002.15.3.269. PMID: 11952130.

[0039] In the present invention, the viral RNAi inhibitor screening kit also includes a transfection reagent. The transfection reagent is used for co-transfection of the viral RNAi inhibitor screening vector and a recombinant expression vector cloned with the viral RNAi inhibitor to be screened. The present invention does not specifically limit the type of the transfection reagent, and any type of transfection reagent known in the art can be used, such as Lipo2000, Lipofectamine 3000, Lipo Hanheng transfection reagent, etc.

[0040] The present invention provides application of the viral RNAi inhibitor screening vector or the viral RNAi inhibitor screening kit in screening viral RNAi inhibitors.

[0041] The present invention provides a method for screening viral RNAi inhibitors, comprising the following steps:

[0042] Cloning the viral RNAi inhibitor to be screened into an expression vector to obtain a recombinant expression vector;

[0043] The recombinant expression vector and the viral RNAi inhibitor screening vector were co-transfected into mammalian cells for culture, and mammalian cells transfected with only the viral RNAi inhibitor screening vector were used as controls to observe the green fluorescence in the mammalian cells, and the results were judged according to the green fluorescence intensity:

[0044] When the green fluorescence intensity in the cells is significantly increased compared with the negative control group, it indicates that the viral RNAi inhibitor to be screened is a viral RNAi inhibitor with anti-host RNAi.

[0045] The present invention has no particular limitation on the viral RNAi inhibitor to be screened, and a candidate viral RNAi inhibitor of interest in the art can be used. In an embodiment of the present invention, the viral RNAi inhibitor to be screened preferably includes a white spot syndrome virus RNAi inhibitor. The white spot syndrome virus RNAi inhibitor includes a nucleotide sequence as shown in SEQ ID NO:9.

[0046] The present invention has no particular limitation on the method of cloning the viral RNAi inhibitor to be screened into the expression vector, and any cloning method known in the art may be used, such as enzyme cutting, connection and verification of the viral RNAi inhibitor encoding gene with enzyme cutting sites and the expression vector.

[0047] In the present invention, the copy number ratio of the recombinant expression vector and the viral RNAi inhibitor screening vector during co-transfection is 0.8-1.2:0.8-1.2, and can be 1:1. The co-transfection method is preferably liposome transformation. The present invention does not impose any special restrictions on the type of mammalian cells, and any type of mammalian cells known in the art can be used, such as 293T cells. During the co-transfection, the concentration of the mammalian cells is preferably 4.5×10 4 Cells / well~5.5×10 4 cells / well, which can be 5×10 4 cells / well. The culture temperature is preferably 36.8-37.2° C., and may be 37° C. The culture time is preferably 24-72 hours, and may be 48 hours. The green fluorescence in mammalian cells is preferably observed using a fluorescence microscope.

[0048] In the present invention, when only the viral RNAi suppressor screening vector is transfected in mammalian cells, shRNA will only interfere with the expression of green fluorescent protein, so the fluorescence color development in mammalian cells is weak. When the viral RNAi suppressor screening vector and the recombinant expression vector cloned with the viral RNAi suppressor encoding gene to be screened are simultaneously transfected in mammalian cells, when the viral RNAi suppressor encoding gene product to be screened releases the inhibition of the RNAi pathway on the expression of green fluorescent protein, the interference degree of the fluorescent protein encoding gene is greatly weakened, and it is expressed in large quantities in mammalian cells, and the fluorescence color development intensity is greatly improved compared with the negative control group, thereby judging whether the viral RNAi suppressor to be screened belongs to the viral RNAi suppressor against host RNAi.

[0049] In the present invention, a positive control group is also included. The positive control group is a method in which a viral RNAi inhibitor screening vector and a recombinant expression vector cloned with a known viral RNAi inhibitor are co-transfected into mammalian cells, and green fluorescence in the mammalian cells is observed. The result is judged based on the green fluorescence intensity in the mammalian cells and the green fluorescence intensity of the positive control group as a standard. When the green fluorescence intensity of the experimental group is the same as or stronger than that of the positive control group, it indicates that the viral RNAi inhibitor to be screened belongs to a viral RNAi inhibitor against host RNAi.

[0050] The following is a detailed description of a viral RNAi inhibitor screening vector provided by the present invention, its construction method and application in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0051] Example 1

[0052] Design of shRNA targeting fluorescent protein and construction of screening vector

[0053] 1. Design of shRNA targeting fluorescent protein

[0054] Three shRNAs were designed according to the conventional method of fluorescent protein coding genes, and the corresponding sequences are as follows:

[0055] shRNA1:

[0056] GCCGCAUGACCAACAAGAUGACUCGAGUCAUCUUGUUGGUCAUGCGGCTTTTTT(SEQ ID NO:1);

[0057] shRNA2:

[0058] GCGUGAUCUUCACCGACAAGACUCGAGUCUUGUCGGUGAAGAUCACGCTTTTTT(SEQ ID NO:2);

[0059] shRNA3:

[0060] GCAUGACCAACAAGAUGAAGACUCGAGUCUUCAUCUUGUUGGUCAUGCTTTTTT (SEQ ID NO: 3).

[0061] DNA sequence corresponding to shRNA1:

[0062] GCCGCATGACCAACAAGATGACTCGAGTCATCTTGTTGGTCATGCGGCTTT TTT (SEQ ID NO: 4);

[0063] DNA sequence corresponding to shRNA2:

[0064] GCGTGATCTTCACCGACAAGACTCGAGTCTTGTCGGTGAAGATCACGCTTT TTT (SEQ ID NO: 5);

[0065] DNA sequence corresponding to shRNA3:

[0066] GCATGACCAACAAGATGAAGACTCGAGTCTTCATCTTGTTGGTCATGCTTT TTT (SEQ ID NO: 6).

[0067] 2. Construction of screening vector

[0068] AgeI restriction site (ACCGG) and EcoRI restriction site (GAATTC) were added to the two ends of the three shRNAs by gene synthesis.

[0069] The three synthesized shRNAs and plasmid plko.1-copGFP-puro were digested with AgeI and EcoRI respectively. The digestion reaction system was 50μl: 1μg plasmid, 1.15μl 10×NE Buffer, 1μl AgeI, and nuclease-free water was added to a total volume of 50μl. The digestion conditions were: 37℃ water bath for 1 hour, NaCl was added to the reaction system to a final concentration of 50mM, and then 1μl EcoRI was added, and 37℃ water bath for 10 minutes. After the digestion, the digested shRNA1~shRNA3 and linear plasmid plko.1-copGFP-puro were obtained respectively.

[0070] The shRNA1 to shRNA3 after enzyme digestion were connected to the linear plasmid plko.1-copGFP-puro respectively. The 20μl connection reaction system was:

[0071] Linear plasmid DNA about 20ng, shRNA fragment, about 10ng, 10×T4 Ligase Buffer 2μl, 50% PEG40002μl, T4 DNA Ligase 1μl (5U), add water to a total volume of 20μl. The connection conditions are incubation at 22℃ for 30 minutes and heat inactivation at 65℃ for 10 minutes. After the connection reaction is completed, three connection products are obtained.

[0072] The three ligation products were transformed into Escherichia coli respectively. Specifically, 5 μl of ligation product was mixed with 50 μl of Escherichia coli DH5α competent cells, ice-bathed for 30 minutes, 0.5 mL of LB medium was added, and incubated at 37 degrees for 45 minutes. Then, 100 μl was taken out and added to LB solid medium (100 μg / mL ampicillin) and cultured overnight at 37 degrees for transformant screening.

[0073] 2. Select transformants, culture in LB liquid medium (containing 100 μg / mL ampicillin), and culture overnight at 37°C on a shaker (speed 160 rpm) for expansion, extract plasmids, and sequence the vector sequence. The results showed that the screening vector containing three shRNAs was successfully obtained, which were recorded as GFP-shRNA1, GFP-shRNA2 (see spectrum 1), and GFP-shRNA3.

[0074] Example 2

[0075] Validation of a viral RNAi inhibitor screening vector

[0076] The shRNA expression vector constructed in Example 1 was transfected into 293T cells to construct an RNAi system, and the differences in transfection fluorescence intensity of 293T cells transfected with GFP-shRNA1, GFP-shRNA2, and GFP-shRNA3 plasmids were compared to detect whether shRNA has the effect of inhibiting GFP expression. The specific steps are as follows:

[0077] 1. Cell Recovery

[0078] (1) Preheat ddH2O to 37°C.

[0079] (2) Take out the cryovial containing the target cells (containing 1 mL of cell mixture) from the liquid nitrogen tank, immediately put it into 37°C ddH2O, and gently shake the cryovial to dissolve it quickly within 1 minute.

[0080] (3) In a clean bench, add 10 mL of freshly prepared culture medium to a 15 mL sterile centrifuge tube. Open the cryotube and add all the frozen-thawed cell suspension to the centrifuge tube. Centrifuge at 1000 rpm for 3 minutes at room temperature and remove the culture medium on the top.

[0081] (4) Resuspend the cell pellet in 1 mL of culture medium, gently pipette to mix, and then add to a T25 cell culture flask. Make up the volume to 5 mL of culture medium and place in a 37°C, 5% CO2 incubator for culture.

[0082] (5) Change the medium after 48 hours, and cell culture can be started when cell fusion reaches 80%.

[0083] 2 Cell culture

[0084] 293T cells were cultured in DMEM medium containing 10% fetal bovine serum and 1% double antibody in a 37°C saturated humidity incubator containing 5% CO2.

[0085] 3. Cell plating

[0086] (1) 293T cells in the logarithmic growth phase were digested with 0.25% trypsin and the cells were counted.

[0087] (2) Cells were seeded into 24-well plates at a density of 5×10 4 Cells were cultured continuously until they reached 50% to 60% confluence for transfection.

[0088] 4. Cell Transfection

[0089] (1) Preparation of plasmid and liposome:

[0090] 1) Incubate 0.8ug of shRNA expression vector or a control vector (plko.1-copGFP-pur) without shRNA and expressing only GFP with 50μL of serum-free culture medium; incubate 0.8 and 1.6μL of liposomes with 50μL of serum-free culture medium and let stand for 5min; mix the culture medium containing plasmid and liposomes, mix well and let stand at room temperature for 20min.

[0091] 2) Incubate 0.8ug of plasmid with 50μL of serum-free medium; incubate 1, 2μL of lipo2000 with 50μL of serum-free medium and let stand for 5min; mix the medium containing plasmid and liposome, mix well and let stand at room temperature for 20min.

[0092] (2) Discard the original culture medium in the plate, add 400 μL serum-free culture medium, and then add the mixed solution. After 6 hours, replace the culture medium with serum.

[0093] (3) Observe under a fluorescence microscope and take photos at 100×.

[0094] Results: Taking plko.1-copGFP-puro as the control, the fluorescence intensity of 293T cells in the GFP-shRNA2 and GFP-shRNA3 transfection groups was significantly reduced, while the fluorescence intensity of 293T cells in the GFP-shRNA1 transfection group was the same as that of the control ( Figure 2 ). This indicates that shRNA2 and shRNA3 have the effect of inhibiting GFP expression.

[0095] Example 3

[0096] Screening of candidate VSRs for white spot syndrome virus

[0097] 1) Construct a candidate VSR expression vector of white spot syndrome virus.

[0098] Specific sequence of the coding region of the candidate VSR:

[0099] (SEQ ID NO:9).

[0100] The NheI (CTAGCTAGCTAG, SEQ ID NO: 10) restriction site and the BamHI (CGGGATCCCG, SEQ ID NO: 11) restriction site were added to both ends of the coding region of the candidate VSR, and then commissioned to Suzhou Hongxun Company for synthesis. The coding region of the candidate VSR with restriction sites at both ends was cloned between the NheI and BamHI sites of the pcDNA3.1 (+) expression vector (with a His tag) to obtain the VSR recombinant expression vector (see the spectrum diagram) Figure 3 ).

[0101] 2) Cell transfection: 5×10 5 293T cells were seeded in a 6-well plate at a cell density of 100 cells / ml and Lipo293 TMThe plasmid (VR recombinant expression vector) was transfected with transfection reagent, and the cell status was observed. The culture medium was removed 48 hours after transfection, and PBS was washed once. 200 μl of cell lysis solution was added to each well to lyse the protein, and the expression was detected using ProXpress (His-Tag)-Competitive detection card (Suzhou Hongxun Bio, HX002324-5). The test results are as follows Figure 4 , it can be seen that the recombinantly expressed protein in the cells is positive, indicating that the candidate VSR is successfully recombinantly expressed.

[0102] 3) Co-transfect 293T cells with VSR recombinant expression plasmid and GFP-shRNA2 vector respectively, use single transfection of GFP-shRNA2 as negative control, and co-transfect P19 expression vector (the construction method is the same as that of VSR vector) and GFP-shRNA2 as VSR positive control. Observe by fluorescence microscopy, or compare the fluorescence intensity of the experimental group and the negative control group. If the green fluorescence intensity in 293T cells is significantly increased after GFP-shRNA2 is co-transfected with a VSR expression vector, it means that the candidate protein is VSR. (Co-transfection of P19 expression vector should significantly increase the green fluorescence intensity in 293T cells).

[0103] Results Figure 5 The results show that the fluorescence intensity of the VSR negative control group is weak, indicating that shRNA targets the fluorescent protein encoding gene, causing it to be low-expressed, while the VSR group has a significant fluorescence intensity, similar to that of the VSR positive control group. This shows that shRNA targets VSR, thereby ensuring the relatively high expression of fluorescent protein, and that the VSR protein can restore the fluorescence intensity of GFP.

[0104] Example 4

[0105] Yeast two-hybrid analysis of the interaction between VSR and AGO protein in the RNAi pathway of shrimp

[0106] Bioinformatics analysis found that VSR can bind to AGO protein. In order to further prove that VSR exerts its effect by binding to AGO protein and inhibiting RNAi pathway, yeast two-hybrid experiment was used to verify the interaction between the two.

[0107] 1. Steps

[0108] 1. Insert the VSR gene into the multiple cloning site of pGBKT7 plasmid to construct the bait plasmid.

[0109] The shrimp AGO gene was inserted into the multiple cloning site of pGADT7 plasmid to construct Prey plasmid.

[0110] 2. Toxicity and self-activation detection of bait recombinant plasmid

[0111] 1) Boil the carrier DNA in 100℃ water for 5 minutes, then immediately place on ice for 2 minutes, and repeat this process once;

[0112] 2) Prepare the transformation system according to Table 1:

[0113] Table 1 Transformation system

[0114] Self-activation and toxicity detection 4 μg PGBKT7-Bait bait plasmid 4 μg pGADT7 plasmid 50 μL Y2HGold yeast competent cells 5 μL carrier DNA DDO plate TDO plate QDO plate

[0115] 3) Slowly and gently add 500 μL PEG / LiAc (8 ml 50% PEG + 1 ml LiAc + 1 ml TE), mix thoroughly by inverting;

[0116] 4) Incubate in a 30°C water bath (or in a 30°C incubator) for 30 min, gently mixing every 10 min;

[0117] 5) Add 20 μL DMSO and mix gently;

[0118] 6) Incubate in a 42°C water bath for 15 min, gently mixing every 5 min;

[0119] 7) Centrifuge at 800 g for 1 min, remove the supernatant, add 800 μL YPDA to resuspend, and seal with sealing film;

[0120] 8) 30°C, 150 rpm, shaking culture for 1.5 h;

[0121] 9) Centrifuge at 800 g for 5 min, discard the supernatant, add 1 ml of 0.9% NaCl to resuspend, and apply to the plate;

[0122] 3. Co-transformation verification

[0123] 1) Boil the carrier DNA in 100℃ water for 5 minutes, then immediately place on ice for 2 minutes, and repeat this process once;

[0124] 2) Transform Y2H Gold yeast competent cells according to the combinations shown in Table 3 below:

[0125] Table 2 Three groups of combined transformation reagents

[0126]

[0127] 3) Slowly and gently add 500 μL PEG / LiAc (8 ml 50% PEG + 1 mL LiAc + 1 mL LTE), mix thoroughly by inverting;

[0128] 4) Incubate in a 30°C water bath (or in a 30°C incubator) for 30 min, gently mixing every 10 min;

[0129] 5) Add 20 μL DMSO and mix gently;

[0130] 6) Incubate in a 42°C water bath for 15 min, gently mixing every 5 min;

[0131] 7) Centrifuge at 800 g for 1 min, remove the supernatant, add 800 μL YPDA to resuspend, and seal with sealing film;

[0132] 8) 30°C, 150 rpm shaking culture for 1.5 h;

[0133] 9) Centrifuge at 800 g for 5 min, discard the supernatant, add 1 ml of 0.9% NaCl to resuspend, and apply to the plate;

[0134] 10) Incubate the culture at 30°C for 3 days and observe the diameter and color of the colonies.

[0135] 2. Results

[0136] Bait toxicity test and self-activation test showed that the recombinant bait plasmid was non-toxic to yeast cells and could not self-activate Y2H Gold yeast reporter genes HIS3 and ADE2. The prey plasmid and the bait plasmid were co-transformed into yeast cells: the experimental group could grow on the DDO plate, indicating that the bait and prey were successfully co-transformed, and the TDO plate could grow, and the QDO plate also grew ( Figure 6 ), indicating activation of the expression of the reporter gene HIS3, indicating an interaction between VSR and AGO.

[0137] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A viral RNAi inhibitor screening vector, characterized in that: A vector for expressing heterologous genes in mammals is used as a backbone vector, and further includes an expression cassette for a green fluorescent protein encoding gene and an expression cassette for shRNA targeting the green fluorescent protein encoding gene; The nucleotide sequence of the shRNA in the shRNA expression cassette is shown in SEQ ID NO: 2 and / or SEQ ID NO:

3.

2. The viral RNAi inhibitor screening vector according to claim 1, characterized in that: The backbone vector includes a pLKO.1puro vector; The cloning site of the shRNA expression cassette includes between the AgeI restriction site and the EcoRI restriction site.

3. The viral RNAi inhibitor screening vector according to claim 1 or 2, characterized in that: The green fluorescent protein encoding gene expression cassette comprises the nucleotide sequence shown in SEQ ID NO:

7.

4. A viral RNAi inhibitor screening kit, characterized in that: The invention comprises the viral RNAi inhibitor screening vector according to any one of claims 1 to 3 and a vector for expressing the viral RNAi inhibitor to be screened.

5. The viral RNAi inhibitor screening kit according to claim 4, characterized in that: The vector for expressing the viral RNAi inhibitor to be screened includes an expression vector with a His tag; The kit also includes a His tag detection card.

6. The viral RNAi inhibitor screening kit according to claim 4, characterized in that: Positive controls are also included; The positive control comprises a recombinant expression vector containing the viral RNAi inhibitor targeted by the shRNA.

7. The viral RNAi inhibitor screening kit according to claim 6, characterized in that: The shRNA-targeted viral RNAi inhibitor includes a nucleotide sequence as shown in SEQ ID NO:

8.

8. Use of the viral RNAi inhibitor screening vector according to any one of claims 1 to 3 or the viral RNAi inhibitor screening kit according to any one of claims 4 to 7 in screening viral RNAi inhibitors.

9. A method for screening viral RNAi inhibitors, characterized in that: The following steps are involved: Cloning the viral RNAi inhibitor to be screened into an expression vector to obtain a recombinant expression vector; The recombinant expression vector and the viral RNAi inhibitor screening vector according to any one of claims 1 to 3 are co-transfected into mammalian cells for culture, and mammalian cells transfected with only the viral RNAi inhibitor screening vector are used as controls, and the green fluorescence intensity in the cells is observed, and the result is judged according to the green fluorescence intensity: When the green fluorescence intensity in the cells is significantly increased compared with the negative control group, it indicates that the viral RNAi inhibitor to be screened is a viral RNAi inhibitor with anti-host RNAi.

10. The screening method according to claim 9, characterized in that: The viral RNAi suppressor to be screened includes white spot syndrome virus RNAi suppressor; The white spot syndrome virus RNAi inhibitor includes the nucleotide sequence shown in SEQ ID NO:9.

Images