Specific DNA fragment, primer group, kit and detection reagent for identifying gender of bombyx mori and application of specific DNA fragment, primer group, kit and detection reagent

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a specific DNA fragment, a primer group, a kit and a detection reagent for identifying gender of bombyx mori and application of the specific DNA fragment, the primer group, the kit and the detection reagent. The specific DNA fragment is as shown in SEQ ID NO. 48. Primers are designed aiming at the specific fragment, and a pair of primers highly linked with a female individual are screened. By adopting the primer and a method of combining PCR with agarose gel electrophoresis, the male and female of the silkworm moth can be accurately and quickly identified, and the problems that the gender characteristics of the silkworm moth larva are not obvious and cannot be effectively distinguished are solved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and particularly relates to a specific DNA fragment, a primer set, a kit, a detection reagent and an application for identifying the sex of round-end silkworm moth. Background Art

[0002] Rotunda rotundapex is an insect of the genus Rotunda, tribe Bombycini, family Bombycidae. It is named because its front and rear wings are similar and nearly round. It is the species most closely related to the domestic silkworm (Bombyxmori) and the wild silkworm (Bombyx mandarina). The color and shape of their cocoons are very similar. Miyata and Kishida (1990) first collected and described this insect and classified it into the genus Bombyx based on the wing pattern elements and the characteristics of the male external genitalia. Wang Linyao (1998) reported the first discovery of "Bombyx" in China under the title "New Records in my country - Bombyx". The article mentioned that in the process of sorting out the specimens of the Bombyx moth family, he found that the specimens from Guanxian County, Sichuan and other places were obviously different from the silk moth, and identified these specimens as Lemonia taraci, which is distributed in Sichuan, Fujian and Hubei, and drew characteristic maps of male genitalia and wing veins. Since then, the taxonomic status of the round-ended silk moth has been controversial. Some academic opinions believe that this species is an insect of the family Lemonia, and that the round-ended silk moth does not exist in China.

[0003] Until 2015, Wang et al. established the genus Rotunda, which includes the species R.rotundapex, by distinguishing the genus through round wings, narrow and forked penis heads of male genitalia, and the absence of small horns on the eighth abdominal segment of mature larvae. The detailed description is as follows: The claw-shaped process of male external genitalia is bottleneck-shaped, slightly swollen at the top, forked, and the fork end is rounded and blunt; the dorsal vein is underdeveloped; the jaw-shaped process is weakly ossified; the clasperm is slender; the cyst-shaped process is thick and short, with a rounded end; the hymen is thick and short, with a horn-like protrusion at the end. The insect body is smooth, with no obvious protrusions on each segment; the apical angle and hip angle of the front and rear wings of the adult are rounded and blunt, and there are short transverse veins near the outer edge of the wing veins that are connected to each other, forming a serrated shape.

[0004] In 2017, Cui Le re-examined Wang Linyao's named specimens and found that the morphological characteristics of these specimens did not conform to the characteristics of the family of Cyprinidae, but were consistent with the characteristics of the genus Rotunda of the family Bombycidae. He corrected the wrong identification and re-described the morphological characteristics of the misidentified specimens. At the same time, he provided photos of adults, wing veins and external genitalia, and compared and analyzed the main characteristics of the round-end silkworm moth R.rotundapex and the dandelion clam moth L.taraci, canceling the distribution record of Cyprinidae in China.

[0005] The round-ended silk moth has important economic and ecological value and is an important part of my country's silkworm germplasm resources. Research on the round-ended silk moth is of great significance to the study of insect evolution, ecology and physiology, and it is one of the important species that should be protected. The morphological characteristics of the round-ended silk moth are similar to those of the domestic silkworm and the wild silkworm, so people have long ignored its species existence, and there are relatively few research reports on the germplasm diversity and population genetics of the round-ended silk moth. In order to rationally develop and sustainably utilize the resources of this species, it is necessary to study the genetic diversity of its wild population.

[0006] The sex chromosomes of Lepidoptera insects are unique in the insect world. Their sex chromosomes are mainly in the ZZ / ZW system, with males being ZZ and females being ZW. In 1916, Japanese scholars first discovered the W chromosome in the silkworm. However, the chromosome sequence has not been deciphered. The silkworm genome research has gone through more than 20 years, completing the germplasm resources "Thousand Silkworm Genome Project", publishing the world's first "Silkworm Super Pan-Genome Map", and taking the lead in creating the "Digital Silkworm" gene bank. However, the sequence of the W chromosome, which plays a decisive role in sex, has never been released. It was not deciphered until 2024, which shows the difficulty of the research. In addition to being useful for sex identification, the marker of the W chromosome is also of great significance for the sequencing of the W chromosome. It can be used to design a specific probe for the W chromosome of the round-end silkworm moth and mark the chromosome. Moreover, the homologous fragment of this fragment is located on chromosome 2 in the silkworm, which shows that the composition of the W chromosome is very complex, which is also of great use for studying the evolution of the W chromosome.

[0007] As a newly discovered insect, the round-ended silkworm moth has only been studied in terms of morphology and feeding. There are only 20 genome data in NCBI, and no nuclear gene information. Sex identification of insects (agricultural pests and beneficial insects) is of great significance for the effective prevention and control of pests and the effective protection of beneficial insects. Although the round-ended silkworm moth is a Lepidoptera insect, the different sexes of the insect body have differences in pupal and adult morphology, but the existing manual differentiation method has the defects of being time-consuming and labor-intensive and cannot be implemented on a large scale. In addition, the morphology of the round-ended silkworm moth larvae is often similar, making it more difficult to distinguish the sex. Summary of the invention

[0008] Based on the above technical problems, the present invention uses the difference between male and female adults to identify male and female, performs NGS sequencing on individuals of different sexes of round-ended silkworm moths, designs primers using fragments that only exist in the female sequencing data, performs PCR screening, and obtains a female-specific fragment. Further, primers for the fragment are designed, and the male and female of round-ended silkworm moths can be accurately identified by PCR combined with agarose gel electrophoresis.

[0009] The specific technical solutions provided by the present invention are as follows:

[0010] In a first aspect, the present invention provides a specific DNA fragment for identifying the sex of the round-end silkworm moth, wherein the nucleotide sequence of the specific DNA fragment is shown in SEQ ID NO.48.

[0011] In a second aspect, the present invention provides a primer set for amplifying the specific DNA fragment, the primer set comprising an upstream primer and a downstream primer;

[0012] Upstream primer W20f: 5′-TCACACTATAGCAGACTGTTGAC-3′;

[0013] Downstream primer W20r: 5′-TTTGGGTAGGGAGGGTTACGA-3′.

[0014] The third aspect of the present invention provides a kit comprising the primer set.

[0015] In a fourth aspect, the present invention provides a detection reagent comprising the primer set.

[0016] The fifth aspect of the present invention provides a use of the specific DNA fragment, the primer set, the kit or the detection reagent in identifying the sex of the round-end silk moth.

[0017] In a sixth aspect, the present invention provides a method for identifying the sex of round-end silkworm moth, comprising the following steps:

[0018] Extracting whole genome DNA of the sample to be tested;

[0019] Using the whole genome DNA as a template, and using the primer set to perform PCR amplification;

[0020] The amplified product was detected by gel electrophoresis. If a specific band appeared at 870 bp, it was determined to be a female individual; if no specific band appeared at 870 bp, it was determined to be a male individual.

[0021] As a preferred embodiment of the present invention, the PCR amplification reaction procedure is: 94°C pre-denaturation for 3-5 min; 94°C denaturation for 30-45 s, 52-56°C annealing for 30-60 s, 72°C extension for 60 s, 35 cycles; 72°C final extension for 7-10 min.

[0022] More preferably, the PCR amplification reaction program is: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 55°C for 35 s, extension at 72°C for 60 s, 35 cycles; final extension at 72°C for 7 min.

[0023] As a preferred embodiment of the present invention, the PCR amplification reaction system is: 1 μl DNA template, 0.5 μl 10 nmol / L W20f primer, 0.5 μl 10 nmol / L W20r primer, 12.5 ul 2×EasyTaq PCR SuperMix and 10.5 μl H2O.

[0024] In a seventh aspect, the present invention provides a use of the specific DNA fragment, the primer set, the kit or the detection reagent in the breeding of round-end silk moth.

[0025] Compared with the prior art, the beneficial effects of the present invention are:

[0026] The present invention performs NGS (Next Generation Sequencing) sequencing on round-end silkworm moth individuals of different sexes, designs primers using fragments that are only found in females, performs PCR screening, and obtains a female-specific fragment. Primers for the specific fragment located on chromosome W are further designed, and the male and female of round-end silkworm moths can be accurately identified by PCR combined with agarose gel electrophoresis, solving the problem that the sex characteristics of round-end silkworm moth larvae are not obvious and cannot be effectively distinguished. This provides help for the development of sex-controlled breeding, wild resource protection, and aquaculture industry of round-end silkworm moths.

[0027] The identification method provided by the present invention includes a pair of sex-specific molecular marker primers (W chromosome specific) and a pair of internal reference gene primers (control region of mitochondrial genome). The method is low-cost, easy to operate, can be used for large-scale rapid identification, and the results are intuitive and accurate.

[0028] Unlike the traditional housekeeping genes (such as actin, etc.), the present invention uses mitochondrial genes as the detection internal reference because mitochondrial genes are conservative, stable, and generally have multiple copies in the cell, which is easy to amplify. The present invention uses the designed internal reference gene amplification primers F14605 and R95 to amplify different individuals of the round-end silkworm moth and finds that 258 individuals are amplified, 256 of which are successful at one time, with a success rate of 99.22%. The secondary amplification of the unsuccessful individuals is successful, indicating that the PCR identification method established using the amplification primers provided by the present invention is very stable. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 For the amplification of female-specific target fragments, M is the molecular weight standard, C is the female individual, and X is the male individual.

[0030] Figure 2 For the verification of the internal primers of the female-specific fragment, M is the molecular weight standard, C1~C2 are different female individuals, and X1~X2 are different male individuals.

[0031] Figure 3 Homology analysis of female-specific target fragments.

[0032] Figure 4 It is the amplification of 16 round-end silkworm moths of known sex, M is the molecular weight standard, C is the female individual, and X is the male individual.

[0033] Figure 5 It is used to identify the sex of larvae of unknown sex. M is the molecular weight standard, and 1 to 16 represent 16 different individuals. DETAILED DESCRIPTION

[0034] The technical scheme of the present invention and the technical effects produced by it are further described below in conjunction with specific test methods and drawings. The following description is only for the purpose of explaining the present invention, but does not limit the present invention in any way. Any changes or substitutions made based on the teachings of the present invention belong to the protection scope of the present invention.

[0035] Unless otherwise specified, the methods used in the present invention are all conventional methods in the art. The test materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0036] Rotunda rotundapex is an insect of the genus Rotunda, tribe Bombycini, family Bombycidae. It is named because its front and back wings are similar and nearly round. It is the species most closely related to the mulberry silkworm (Bombyx mori) and wild silkworm (Bombyx mandarina), and their cocoons are very similar in color and shape.

[0037] At present, the research on the round-end silkworm moth is limited to the description of morphology and feeding. There are only 20 genome data in NCBI, and there is no information on nuclear genes. Sex identification of insects (agricultural pests and beneficial insects) is of great significance for the effective prevention and control of pests and the effective protection of beneficial insects. Insects of different sexes in Lepidoptera often have differences in the morphology of the pupal stage and the adult stage, but manual distinction is time-consuming and laborious, and the larvae are often similar in morphology, making it difficult to identify.

[0038] Based on this, the present invention provides a specific DNA fragment for identifying the sex of the round-end silkworm moth, and the specific DNA fragment is shown as SEQ ID NO.48.

[0039] By further designing the primers of this fragment, the male and female of the round-ended silkworm moth can be accurately identified through PCR combined with agarose gel electrophoresis, solving the problem that the gender characteristics of the round-ended silkworm moth larvae are not obvious and cannot be effectively distinguished.

[0040] When collecting tissue samples of round-end silkworm moth in the present invention, the larvae can take the individual, blood, silk gland and other tissues that are not in contact with the outside world. For female adults, only the chest can be taken, and for males, the chest or the whole body can be taken, because the abdomen of the female individual will interfere with the test results due to fertilization. For eggs and pupae, any part except the shell can be taken.

[0041] Although individuals in the pupal and adult (moth) stages can be manually identified based on morphology, molecular identification reduces the tediousness of manual identification and can be implemented on a large scale.

[0042] Example 1

[0043] Establishment of PCR identification method

[0044] 1. Sequencing

[0045] 1.1 RNA samples

[0046] Two male adult moths of the round-ended silkworm were taken, and appropriate amounts of samples were cut with dissecting scissors (thorax for females and whole moth for males), placed in cryovials containing RNAhold preservation solution, and sent to Sangon Biotech (Shanghai) Co., Ltd. for cDNA library construction and transcriptome sequencing based on the Illumina HiSeqTM2000 high-throughput sequencing platform.

[0047] 1.2 DNA samples

[0048] The total genomic DNA of Bombyx mori was extracted using a rapid DNA extraction kit (DP304, Tiangen Biochemical Technology (Beijing) Co., Ltd.). The specific steps are as follows:

[0049] Take one male and one female adult of the round-ended silkworm moth (the female takes the thorax and the male takes the whole), and use a high-speed oscillating grinder to break them into suspensions; the suspension is centrifuged at 10000rpm for 1min, the supernatant is removed, 200μL buffer GA is added to the precipitate, and after oscillation and suspension, 20μL Proteinase K is added, and the tissue is placed in a 56℃ constant temperature water bath to dissolve, 200μL GB buffer is added, and the water bath is continued at 70℃ for 10min; 200μL anhydrous ethanol is added, and after oscillation and mixing, the resulting solution and flocculent precipitate are transferred to the adsorption column CB3 embedded in the collection tube, centrifuged at 12000rpm for 60s, and the waste liquid in the collection tube is discarded; 500μL is added to the adsorption column CB3 GD buffer, centrifuge at 12000rpm for 30s to remove waste liquid; add 600μLPW buffer, centrifuge at 12000rpm for 30s to discard waste liquid, repeat once; finally centrifuge at 12000rpm for 2min to remove waste liquid, and let the adsorption column stand at room temperature for several minutes to dry; transfer the adsorption column to a new centrifuge tube, add 100μL ddH2O for elution, let stand at room temperature for 2-5min, centrifuge at 12000rpm for 2min, and the result in the centrifuge tube is the extracted genomic DNA.

[0050] The qualified genomic DNA was sent to Bio-Tech (Shanghai) Co., Ltd. for sequencing on the MGISEQ-200RS high-throughput sequencing platform. Fastp software was used to perform quality control on the raw data of the transcriptome and genome of the high-throughput sequencing to remove the adapters and low-quality sequences. Specifically:

[0051] First, the adapter sequence and the sequence containing N bases were removed, and then the low-quality bases (bases with a Q value less than 20) were removed from the 3' to 5' direction, and the sliding window method was used to remove the bases with a quality of less than 20 at the end of the sequence. The data after quality control are shown in Table 1.

[0052] Table 1 Data of each sample after sequencing quality control

[0053]

[0054] 2. Assembly

[0055] 2.1. Use spades v3.15 software to assemble the clean data of DNA sequence No. 4 (male individual) with default parameters. The fasta format sequence obtained after assembly is named male4.fasta.

[0056] The same method was used to treat RNA-1 and RNA-2 to obtain male1.fasta and male2.fasta.

[0057] 2.2. Use male4.fasta as the reference genome and use bowtie2-build to build a standard library. Then use bowtie2 command in very-sensitive mode to screen the obtained DNA-3 and output the sequence that cannot be matched with male4.fasta, named fem3.fq.gz(1 / 2).

[0058] 2.3. Use male2.fasta as the reference genome and the same parameters as in step 2.2. Filter the sequences of fem3.fq.gz(1 / 2) that cannot match male2.fasta and name them fem3_2.fq.gz(1 / 2).

[0059] 2.4. Using male1.fasta as the reference genome, use the same parameters as in step 2.2 and select fem3_2.fq.gz(1 / 2). The sequence that does not match male1.fasta is named fem3_2_1.fq.gz(1 / 2).

[0060] 2.5. Use spades v3.15 software to assemble fem3_2_1.fq.gz(1 / 2) and name it fem.fasta.

[0061] 3. Randomly select the sequence of fem.fasta file to design primers. Since high-throughput sequencing is definitely not unbiased, affected by sequencing technology, genome repetitive sequences, and assembly technology, female specificity cannot be obtained by simple differences, and a large number of PCRs must be performed for verification. In this experiment, 21 pairs of primers were designed, and 1 pair was successful. The 21 pairs of primers are shown in Table 2.

[0062] Table 2 Primer sequences

[0063]

[0064]

[0065] 4. PCR amplification

[0066] One female and one male individual were used to screen the 21 primer pairs in Table 2.

[0067] PCR reaction program: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 55°C for 35 s, extension at 72°C for 60 s, 35 cycles; final extension at 72°C for 7 min.

[0068] It should be noted that the PCR reaction program can vary within the following range: pre-denaturation at 94°C for 3 to 5 min; denaturation at 94°C for 30 to 45 s, annealing at 52 to 56°C for 30 to 60 s, extension at 72°C for 60 s, 35 cycles; final extension at 72°C for 7 to 10 min.

[0069] The reaction system was: 1 μl DNA template, 0.5 μl 10 nmol / L W20f primer, 0.5 μl 10 nmol / L W20r primer, 12.5 ul 2×EasyTaq PCR SuperMix and 10.5 μl H2O.

[0070] The sequence of the upstream primer of the internal reference gene primer used in the detection process is F14605: 5'-CCTCTAAATAAACTAAAATACCgCC-3', SEQ ID NO.42;

[0071] The sequence of the downstream primer of the internal reference gene primer, R95: 5'-TTCTTTATATTTgAggTATgAgCCC-3', SEQ ID NO.43.

[0072] The results showed that only the W20f / W20r primer pair could amplify in female individuals, but not in male individuals ( Figure 1 ). Other primer pairs can amplify both male and female individuals. The target band is between 1000bp and 750bp, and the actual sequencing is 870bp. Only female individuals can be amplified, but not male individuals. The control internal reference is between 1000bp and 750bp, and the actual size is 847bp after sequencing. Both males and females can be amplified.

[0073] 5. Sequencing verification:

[0074] For the internal reference gene, since it is only necessary to prove that the amplified band is the target band, the present invention uses direct sequencing of PCR products. For the target female-specific band, since the W chromosome is derived from the Z chromosome, there is homology, so accuracy is required, and the present invention uses the TA cloning sequencing method for verification.

[0075] Homologous comparison was performed using online blast (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). The results showed that the sequencing sequence of the amplified fragment of the internal reference gene was the mitochondrial gene of the round-end silk moth, which was consistent with SEQ ID NO.49; and the female-specific target fragment was also consistent with the sequence of SEQ ID NO.48, proving that the F14605 / R95 primer pair and the W20f / r primer pair could be successfully amplified and were not false positives.

[0076] The sequence of the female-specific target fragment is shown in SEQ ID NO.48:

[0077] TCACACTATAGCAGACTGTTGACCCGCACATCAGTTTATTTAAACTTAAGTT

[0078] ACATTAACTAAGGTGCAAAAATCTTTAATAAAATGAAAATTTTGGGTCACCA

[0079] CTTTTAGTGGTAATGTGTAAGGAACCACCACCACCGCTGGTCTGCCTTTTTG

[0080] TGAATGGTATCGTACTAAGTTAATCATATTTCAGCAATCACAGTAAGCCACC

[0081] ACCAATCGCAGTAAGCCACCACTAATCGCAGTATTGCGTTATAATTTGAGAG

[0082] ACCTTATTCGTTCCAGTGTACGAATCTATCTAAACGGAAGGGGGGGGGGGG

[0083] GGTGACGCTTCGCGTTTTCCTAGGTTTAACCAGTTACCCCTATGTGGTGCAG

[0084] CAAAACGGGGGCCGTAAACATAATCGGTGGTAGGACTTTGTCCGACTGGCT

[0085] GGCGACCACCCGCCAACCAAAGTCCGCCGCCAAACAGCCCTACTGTGTTC

[0086] AGGCATGCGGATTGGAGAGCCAGTTCTATTTCTCCCCATTCCTCTTCCTTATT

[0087] ATGAATGAGCCTTGGTGATGCTTGAAACATGCGAAGCAGATGTGTGTGCGA

[0088] GTCCCCGCTACCGCCCGCCGGTCAGTAGGGGATCTGAACCCTGGTGTCACC

[0089] ACATAACTCCGCCCCGAGAAGATGTCCCACTAACCGGTGTAAAATCCTATAG

[0090] TGCCGTCGTCGTGCCAGAGTTGGAGACTGGAGTGGATCGCGGCGACCATAC

[0091] GCAGGGTGGGACTGGGAACCCTTCCGTGCTCCTCGATAGCTTTTTAACACAA

[0092] CCCGCGGTCTAGCAGTTCTAGCACTCACTGTGACCCGCGCTTTTGTTTGAGT

[0093] TTGACCTTGATCTCACCTATAGCATCGTAACCCTCCCTACCCAAA

[0094] SEQ ID NO.49:

[0095] CCTCTAAATAAACTAAAATACCGCCAAATTATTTAAGTTTTTATAAATAATTAT

[0096] ATACTATTTTAGTATTATTAATTTAAATTTTTTATAATAGGGTATCTAATCCTAG

[0097] TTTTTAATAAAATTTTTTAACCTCATAATTTAATATAAAATTTTAATTAATTAAA

[0098] ATTTCACCTAATAATTTAAAATTTAATTTTATATTTTAATTAATTATTCATTAATC

[0099] CCTAAAAAAATTTAATTTAATTTTTGTATAACCGCAACTGCTGGCACAAAATT

[0100] AGTTATTAATTAAAATATTACTAAATCTTAATTCCTTAAATTTTTAATTTTAATT

[0101] ACTACCTTAATCAAAATAAAATATTATTTAAATAAAGTAAATATAACACTAAA

[0102] ATTTATATGTAAAATAAACCTATAATAAATTTTTAAACCATAAAAAATTTTATT

[0103] TTATTTAATGTAACTTTTTTTGCATAGATCTTTTTTTTTTTTTTTTTTATAATAA

[0104] AATATTTAATATAAGTTATTAAACTTTTAATATTATCTCTCTCTTATTTTCATAAT

[0105] ATTCTAGTTTAAATAAAAAATCAATATTGAAATTTCAATATTCTTTAAAATTAA

[0106] AAAATAATAATATAATTAATCTTAATTTTTTAATAATTTATTGTATATATATATAT

[0107] ATTAATATAATAAATAATTTAATTTATATATATATATATTAATTAATTAAAAATTT

[0108] AATATGTATATATATAAATTGAATAAAAATTATTTAAATATAACCATAAACCGT

[0109] AGGTAATTTTTTTCATTAAATAAAAAAAATTAAAAATAAGCTAATATAAGCT

[0110] TTTGGGCTCATACCTCAAATATAAAGAA

[0111] 6. Further verification:

[0112] Two pairs of primers were redesigned within the scope of sequencing, and the primer sequences are shown in SEQ ID NOs. 44, 45 and SEQ ID NOs. 46, 47. Two female round-end silkworm moths and two male round-end silkworm moths were taken and PCR identification was performed using the two pairs of primers respectively. The PCR conditions were the same as those in Example 1.

[0113] FemF1: 5'-TGGTAATGTGTAAGGAACCACCA-3', SEQ ID NO.44;

[0114] FemR1: 5'-GAAATAGAACTGGCTCTCCAATCC-3', SEQ ID NO. 45.

[0115] FemF2: 5'-CAGCAATCACAGTAAGCCACCAC-3', SEQ ID NO.46;

[0116] FemR2: 5'-GGCTCATTCATAATAAGGAAGAGGA-3', SEQ ID NO. 47.

[0117] The results are as follows Figure 2 As shown in the figure, it was found that these two pairs of primers can amplify in female individuals, but not in male individuals. The target band is between 500bp and 250bp. The size of the amplification product of the primers shown in SEQ ID NO.44 and 45 was 385bp after sequencing, and the size of the amplification product of the primers shown in SEQ ID NO.46 and 47 was 341bp after sequencing. They can only amplify in female individuals, but not in male individuals. The size of the amplification band of the control internal reference is the same as that of the control internal reference. Figure 1 .

[0118] 7. Homologous comparison of PCR amplified fragments:

[0119] NCBI online (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi), the parameter is Somewhatsimilar sequences (due to the low homology with the nr library, this parameter is used, and no homology can be found with other parameters). This fragment, that is, the female-specific target fragment, has low homology with all NCBI known fragments. 55% of the region (340-787) is less than 75%, and 45% of the other positions have no homologous fragments at all. 55% of the region (340-787) is annotated as the eggshell gene locus sequence, but the similarity is very low, and a sequence is missing in the middle, see Figure 3 , Figure 3 The one most similar to the NCBI database is shown. 55% of the regions (340-787) are below 75%, and the other 45% have no homologous fragments at all. Figure 3 The Description at the top is an overview, and it can be seen that the similarity between coverage and coverage area is 73.75%. Figure 3 The lower end is the difference in specific bases. In Bombyx mori, the homologous fragment of this fragment is located on chromosome 2, not on chromosome W, so it is not foreseeable that this fragment can be used for sex identification of round-end silkworm moths.

[0120] Example 2

[0121] Application of amplification primers in sex identification of Bombyx mori

[0122] Take 8 female round-ended silk moths and 8 male round-ended silk moths (the sex of 16 adult individuals is known), use W20f and W20r as amplification primers, and use SEQ ID NO.42 and SEQ ID NO.43 as internal reference gene primers. Verify according to the PCR conditions in Example 1. The sex identification of round-ended silk moths is easy. Female individuals have eggs on their abdomens and no paired claspers (commonly known as tail hooks). Male individuals have no eggs on their abdomens and have paired claspers (commonly known as tail hooks). Take the chest of female individuals and the whole individual of male individuals, and the subsequent steps such as DNA extraction are the same as in Example 1.

[0123] PCR products were detected using 2% agarose gel electrophoresis.

[0124] Gender determination method: All samples can amplify bands using internal reference primers. If the internal reference primers show a single bright band around 750bp, the experiment is successful. Then a pair of gender-specific molecular marker primers W20f and W20r are used to perform electrophoresis on the PCR product. If a single bright band (i.e., female-specific fragment) is shown around 870bp, it is determined to be female; if no specific band appears at 870bp, it is determined to be male.

[0125] turn out( Figure 4 ), all samples can be amplified using the internal reference primer pair F14605 / R95, indicating that there is no problem with the experimental operation. W20f and W20r can be amplified in female individuals, but not in male individuals, indicating that the method provided by the present invention can be used for large-scale sex identification of round-end silkworm moths.

[0126] Example 3

[0127] Sex Identification and Sex Ratio Survey of the Larvae of the Bombyx mori

[0128] Take unknown round-end silkworm larvae for sex ratio analysis (16 individuals of unknown sex). Select 16 newly hatched, live silkworms that have not eaten. Perform DNA extraction on all of them. The steps are the same as in Example 1. Use W20f and W20r as amplification primers, and use SEQ ID NO.42 and SEQ ID NO.43 as reference gene primers. Verify according to the PCR conditions in Example 1.

[0129] Gender determination method: All samples can amplify bands using internal reference primers. If the internal reference primers show a single bright band around 750bp, the experiment is successful. All internal reference primers can be amplified, indicating that there is no problem with the experimental operation. Then a pair of gender-specific molecular marker primers are used to perform electrophoresis detection on the PCR products of W20f and W20r. If a single bright band is shown around 870bp, it is determined to be female; if no specific band appears at 870bp, it is determined to be male.

[0130] The results show that Figure 5 ), 16 samples of unknown sex were tested, and all of them were detected using the control internal reference primer, indicating that there was no problem with the experimental operation. 9 of the 16 individuals were amplified, indicating that there were 9 female individuals and 7 male individuals in the 16 samples.

[0131] The chi-square test was further used to determine whether the gender ratio was 1:1. The chi-square test found that P = 0.61 was much greater than P = 0.05, indicating that the difference was not significant and did not deviate from the gender ratio of 1:1.

[0132] The method provided by the invention can not only identify the sex of each individual, but also can be used to investigate the sex ratio of larvae and determine the sex ratio change of male and female individuals, which is of great significance to the prevention and control of pests.

[0133] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A specific DNA fragment for identifying the sex of round-end silkworm moth, characterized in that: The nucleotide sequence of the specific DNA fragment is shown in SEQ ID NO.

48.

2. A primer set for amplifying the specific DNA fragment, characterized in that: The primer set includes an upstream primer and a downstream primer; Upstream primer W20f: 5′-TCACACTATAGCAGACTGTTGAC-3′; Downstream primer W20r: 5′-TTTGGGTAGGGAGGGTTACGA-3′.

3. A kit, characterized in that: It comprises the primer set according to claim 2.

4. A detection reagent, characterized in that: It comprises the primer set according to claim 2.

5. Use of the specific DNA fragment according to claim 1, the primer set according to claim 2, the kit according to claim 3, or the detection reagent according to claim 4 in identifying the sex of the round-end silk moth.

6. A method for identifying the sex of round-ended silkworm moth, characterized in that: The steps include: Extracting whole genome DNA of the sample to be tested; Using the whole genome DNA as a template, PCR amplification is performed using the primer set of claim 2; The amplified product was detected by gel electrophoresis. If a specific band appeared at 870 bp, it was determined to be a female individual; if no specific band appeared at 870 bp, it was determined to be a male individual.

7. The method for identifying the sex of round-end silkworm moth according to claim 6, characterized in that: The PCR amplification reaction program was as follows: pre-denaturation at 94°C for 3-5 min; denaturation at 94°C for 30-45 s, annealing at 52-56°C for 30-60 s, extension at 72°C for 60 s, 35 cycles; final extension at 72°C for 7-10 min.

8. The method for identifying the sex of round-end silkworm moth according to claim 6, characterized in that: The PCR amplification reaction system was: 1 μl DNA template, 0.5 μl 10 nmol / L W20f primer, 0.5 μl 10 nmol / L W20r primer, 12.5 ul 2×EasyTaqPCR SuperMix and 10.5 μl ddH2O.

9. Use of the specific DNA fragment according to claim 1, the primer set according to claim 2, the kit according to claim 3, or the detection reagent according to claim 4 in breeding of round-end silk moth.

Images