Kit for detecting HLA-B27 and detection method

Abstract

The invention discloses a kit for detecting HLA-B27 and a detection method. The kit for detecting HLA-B27 comprises a PCR (Polymerase Chain Reaction) solution, a primer probe mixed solution, a positive reference substance and a negative reference substance, the primer probe mixed solution comprises an upstream primer 1F, a downstream primer 1R and a probe 1P for detecting the HLA-B27, and an upstream primer 2F, a downstream primer 2R and a probe 2P for detecting a reference gene. A fluorescent PCR-melting curve method is adopted, sequence alignment is carried out according to an NCBI database, primers and probes which are high in specificity and capable of simultaneously detecting main subtypes (HLA-B27: 02, HLA-B27: 04, HLA-B27: 05, HLA-B27: 06, HLA-B27: 07 and HLA-B27: 24) of the HLA-B27 are selected, and compatibility detection of different subtypes of the HLA-B27 can be achieved through a pair of primers and a probe. The Tm value in the melting curve instead of the Ct value of the amplification curve is adopted for result judgment, qualitative accuracy is achieved, and the result is visual and easy to interpret.

Description

Technical Field

[0001] The present invention relates to the technical field of kits, and in particular to a kit and a detection method for detecting HLA-B27. Background Art

[0002] Ankylosing spondylitis (AS) is the most common spondyloarthritis (SpA). It is an autoimmune disease that affects the sacroiliac joints, spinal apophysis, paraspinal soft tissues and peripheral joints. Currently, the cause of AS is still unclear. The main group of AS patients is young and middle-aged people, with more males than females. In the early stage of the disease, most patients have no obvious clinical symptoms, so it is easy to be ignored.

[0003] Studies have found that human leukocyte antigen-B27 (HLA-B27 for short) is closely related to the onset of AS. More than 90% of AS patients test positive for HLA-B27 genes, while the HLA-B27 positive rate of the normal population is about 5%, and the probability of such people suffering from AS is about 6%. Therefore, HLA-B27 plays an important role in the early diagnosis of ankylosing spondylitis.

[0004] HLA-B27 belongs to the human leukocyte antigen class I molecule, which is expressed in all nucleated cells. Its coding gene is composed of 8 exons and 6 introns and is located on the short arm of human chromosome 6. The HLA-B27 molecule is composed of a 44kD transmembrane heavy chain and a 12kD β2-microglobulin (β2-M) light chain. The heavy chain is encoded by the MHC gene located on the sixth pair of chromosomes, including 3 extracellular structures (α1, α2, α3 regions), a transmembrane region and a cytoplasmic tail. The α3 region is non-covalently bound to β2-M.

[0005] Human leukocyte antigen-B27 (HLA-B27) has a high specificity for ankylosing spondylitis, with a positive rate of over 90%. It is mostly used in clinical practice for auxiliary diagnosis and differential diagnosis of ankylosing spondylitis. Uveitis is an extra-articular organ lesion of ankylosing spondylitis. The positive rate of HLA-B27 is 85% to 95%. For patients whose eye disease symptoms appear before the symptoms of spinal joint lesions, HLA-B27 can be used as a screening indicator to exclude ankylosing spondylitis, so that ankylosing spondylitis can be detected early and patients can be treated in a targeted manner, which has great clinical significance. In addition, it also has an auxiliary diagnostic role for rheumatoid arthritis, Reiter's syndrome in children, etc.

[0006] Currently, more than 280 HLA-B27 subtypes have been discovered worldwide, numbered from HLA-B27:01 to HLA-B27:283. The common subtypes in the Chinese population are HLA-B27:02, HLA-B27:04, HLA-B27:05, HLA-B27:06, HLA-B27:07 and HLA-B27:24.

[0007] The current genetic detection methods for HLA-B27 mainly include first-generation sequencing, PCR-agarose gel electrophoresis (PCR-SSP) and fluorescent PCR. Among them, fluorescent PCR has the advantages of lower cost, shorter detection time and simpler operation steps compared with first-generation sequencing and PCR-agarose gel electrophoresis. It is currently the main method for detecting HLA-B27.

[0008] For example, the patent 200910093927.3 of Biobio uses the fluorescent dye method + high-resolution melting curve method, which has high requirements for detection equipment and is easily interfered by the sample matrix effect, resulting in false positive and false negative erroneous results; the patent 201310100257.X of Xiupeng Bio uses PCR-agarose gel electrophoresis method, which targets HLA-B*2702, HLA-B*2704, HLA-B*2705 / 07, HLA-B*2706 / 04, HLA-B*2706 and control Gene design primer pairs, agarose gel electrophoresis detection of PCR products, the entire experimental operation steps are cumbersome, prone to aerosol contamination, resulting in false positive results, the overall detection accuracy is low, and the labor cost and fixed equipment investment cost are high; Debi Bio's 202110601113.7 patent uses a fluorescent probe method. Although it has higher detection specificity than the fluorescent dye method, the kit uses 8 primers and 3 fluorescent probes to complete the detection of the HLA-B27 gene. The cost of primers and probes is high, and the production and preparation process is cumbersome. At the same time, this patent requires 9 PCR reactions for each sample tested, the overall detection cost is high, and the experimental operation and result analysis are cumbersome. The 202410093733.8 patent of Nantong First People's Hospital uses a fluorescent probe method. Although it has higher detection specificity than the fluorescent dye method, the kit uses 5 primers and 3 fluorescent probes to complete the detection of the HLA-B27 gene. The cost of primers and probes is high, and there are high requirements for the preparation ratio of primers, and the production and preparation process is cumbersome.

[0009] In view of this, the present invention is proposed. Summary of the invention

[0010] The purpose of the present invention is to provide a kit and a detection method for detecting HLA-B27. The kit adopts the fluorescent PCR-melting curve method. Compared with the existing detection kits, it has the advantages of low reagent cost, simple production process, simple operation, and compatibility with multiple HLA-B27 types and subtypes.

[0011] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are particularly adopted:

[0012] The first aspect of the present invention provides a kit for detecting HLA-B27, wherein the kit for detecting HLA-B27 comprises:

[0013] PCR reaction solution, primer-probe mixture, positive control and negative control;

[0014] The primer-probe mixture includes an upstream primer 1F, a downstream primer 1R and a probe 1P for detecting HLA-B27, and an upstream primer 2F, a downstream primer 2R and a probe 2P for an internal reference gene;

[0015] The nucleotide sequence of the upstream primer 1F is shown in SEQ ID NO: 1, the nucleotide sequence of the downstream primer 1R is shown in SEQ ID NO: 2, and the nucleotide sequence of the probe 1P is shown in SEQ ID NO: 3;

[0016] The nucleotide sequence of the upstream primer 2F is shown in SEQ ID NO: 4, the nucleotide sequence of the downstream primer 2R is shown in SEQ ID NO: 5, and the nucleotide sequence of the probe 2P is shown in SEQ ID NO: 6.

[0017] Preferably, the nucleotide sequence of the upstream primer 1F is the sequence shown in SEQ ID NO: 1 or the complementary sequence with 1 to 5 bases added, deleted or replaced;

[0018] The nucleotide sequence of the upstream primer 1R is the sequence shown in SEQ ID NO: 2 or the complementary sequence with 1 to 5 bases added, deleted or replaced;

[0019] The nucleotide sequence of the upstream primer 2F is the sequence shown in SEQ ID NO: 4 or the complementary sequence with 1 to 5 bases added, deleted or replaced;

[0020] The nucleotide sequence of the upstream primer 2R is the sequence shown in SEQ ID NO: 5 or the complementary sequence with 1 to 5 bases added, deleted or replaced;

[0021] The nucleotide sequence of the probe 1p is the sequence shown in SEQ ID NO: 3 or the complementary sequence with 1 to 5 bases added, deleted or replaced;

[0022] The nucleotide sequence of the probe 2p is obtained by adding, deleting or replacing 1 to 5 bases on the sequence shown in SEQ ID NO: 6 or its complementary sequence.

[0023] Preferably, the molar ratio of the upstream primer 1F, the downstream primer 1R, the probe 1P, the upstream primer 2F, the downstream primer 2R and the probe 2P is 1:(5-12):(2-6):1:(5-12):(2-6).

[0024] Preferably, the positive control substance is a genomic DNA solution of an HLA-B27-positive cell line, and the concentration of the HLA-B27 solution is 4 to 6 ng / μl.

[0025] Preferably, the negative control substance is double distilled water.

[0026] Preferably, the PCR reaction solution is 2xTaq enzyme mix.

[0027] Preferably, the 5' ends of the probe 1P and the probe 2P are respectively modified with a fluorescent group, and the 3' ends are respectively modified with a quenching group.

[0028] Preferably, the fluorescent group includes FAM, VIC, Pacific Blue, Atto 425, Bodipy FL, AlexaFluor488, TET, JOE, HEX, NED, Cy3, Quasar 570, TAMRA, Texas Red, ROX, AquaPhluor593, Cy5, Quasar 570 and Quasar 670.

[0029] Preferably, the quenching group includes TAMRA, BHQ1, BHQ2, BHQ3, ECLIPS, MGB and Dabcyl.

[0030] A second aspect of the present invention provides a method for detecting HLA-B27 for non-diagnostic purposes, the method comprising detecting HLA-B27 using the kit for detecting HLA-B27.

[0031] Compared with the prior art, the beneficial effects of the present invention include at least:

[0032] The present invention adopts the fluorescent PCR-melting curve method, performs sequence comparison according to the NCBI database, selects primers and probes that are highly specific and can simultaneously detect the main subtypes of HLA-B27 (HLA-B27:02, HLA-B27:04, HLA-B27:05, HLA-B27:06, HLA-B27:07 and HLA-B27:24), and finally develops an HLA-B27 kit with low reagent cost, simple production process, simple operation, and compatibility with multiple HLA-B27 types and subtypes through repeated tests and system optimization; in addition, the kit of the present invention can detect the compatibility of different subtypes of HLA-B27 through a pair of primers and a probe, and the result is judged by using the Tm value in the melting curve instead of the Ct value of the amplification curve, so the qualitative analysis is accurate, and the result is intuitive and easy to interpret.

[0033] The reagent composition of the kit of the present invention is simple, the production operation is simple, the reagent cost is low, and the accuracy is high. It has high detection sensitivity for different subtypes of HLA-B27 and high detection specificity for other types of HLA-B. In addition, it has strong compatibility with sample types and nucleic acid extraction methods, simple detection operation steps, and intuitive and clear result interpretation. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following is a brief introduction to the drawings required for the specific embodiments or the description of the prior art. In all the drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, the elements or parts are not necessarily drawn according to the actual scale.

[0035] Figure 1 This is a melting curve diagram of four samples in Example 2 of the present invention. DETAILED DESCRIPTION

[0036] The following embodiments of the technical solution of the present invention are described in detail in conjunction with the embodiments. The following embodiments are only used to more clearly illustrate the technical solution of the present invention, and are therefore only used as examples, and cannot be used to limit the protection scope of the present invention.

[0037] It should be noted that, unless otherwise specified, the technical terms or scientific terms used in this application should have the common meanings understood by those skilled in the art to which the present invention belongs.

[0038] An embodiment of the present invention provides a kit for detecting HLA-B27, wherein the kit for detecting HLA-B27 comprises:

[0039] PCR reaction solution, primer-probe mixture, positive control and negative control;

[0040] The primer-probe mixture includes an upstream primer 1F, a downstream primer 1R and a probe 1P for detecting HLA-B27, and an upstream primer 2F, a downstream primer 2R and a probe 2P for an internal reference gene;

[0041] The nucleotide sequence of the upstream primer 1F is shown in SEQ ID NO: 1, specifically GAGTCCGAGAGAGGAGCCG, the nucleotide sequence of the downstream primer 1R is shown in SEQ ID NO: 2, specifically CTCTCGGTCAGTCTGTGCC, and the nucleotide sequence of the probe 1P is shown in SEQ ID NO: 3, specifically CCGGGAGACACAGATCTGCAAG;

[0042] The nucleotide sequence of the upstream primer 2F is shown in SEQ ID NO: 4, specifically GGCTCTTAAAAAGTGCAGGGTC, the nucleotide sequence of the downstream primer 2R is shown in SEQ ID NO: 5, specifically GCTGTAGCCAAATTCGTTGTCA, and the nucleotide sequence of the probe 2P is shown in SEQ ID NO: 6, specifically CGCCCTCTGGTGGCTGGCT.

[0043] The present invention adopts the fluorescent PCR-melting curve method, performs sequence comparison according to the NCBI database, selects primers and probes that are highly specific and can simultaneously detect the main subtypes of HLA-B27 (HLA-B27:02, HLA-B27:04, HLA-B27:05, HLA-B27:06, HLA-B27:07 and HLA-B27:24), and finally develops an HLA-B27 kit with low reagent cost, simple production process, simple operation, and compatibility with multiple HLA-B27 types and subtypes through repeated tests and system optimization; in addition, the kit of the present invention can detect the compatibility of different subtypes of HLA-B27 through a pair of primers and a probe, and the result is judged by using the Tm value in the melting curve instead of the Ct value of the amplification curve, so the qualitative analysis is accurate, and the result is intuitive and easy to interpret.

[0044] The reagent composition of the kit of the present invention is simple, the production operation is simple, the reagent cost is low, and the accuracy is high. It has high detection sensitivity for different subtypes of HLA-B27 and high detection specificity for other types of HLA-B. In addition, it has strong compatibility with sample types and nucleic acid extraction methods, simple detection operation steps, and intuitive and clear result interpretation.

[0045] In some embodiments, the nucleotide sequence of the upstream primer 1F is the sequence shown in SEQ ID NO: 1 or the complementary sequence with 1 to 5 bases added, deleted or replaced;

[0046] The nucleotide sequence of the upstream primer 1R is the sequence shown in SEQ ID NO: 2 or the complementary sequence with 1 to 5 bases added, deleted or replaced;

[0047] The nucleotide sequence of the upstream primer 2F is the sequence shown in SEQ ID NO: 4 or the complementary sequence with 1 to 5 bases added, deleted or replaced;

[0048] The nucleotide sequence of the upstream primer 2R is the sequence shown in SEQ ID NO: 5 or the complementary sequence with 1 to 5 bases added, deleted or replaced;

[0049] The nucleotide sequence of the probe 1p is the sequence shown in SEQ ID NO: 3 or the complementary sequence with 1 to 5 bases added, deleted or replaced;

[0050] The nucleotide sequence of the probe 2p is obtained by adding, deleting or replacing 1 to 5 bases on the sequence shown in SEQ ID NO: 6 or its complementary sequence.

[0051] In some embodiments, the molar ratio of the upstream primer 1F, the downstream primer 1R, the probe 1P, the upstream primer 2F, the downstream primer 2R and the probe 2P is 1:(5-12):(2-6):1:(5-12):(2-6).

[0052] In some embodiments, the positive control is a genomic DNA solution of an HLA-B27-positive cell line, and the concentration of the HLA-B27 solution is 4 to 6 ng / μl.

[0053] In some embodiments, the negative control is double distilled water.

[0054] In some embodiments, the PCR reaction solution is Hieff Universal gPCR mastermix.

[0055] In some embodiments, the 5' ends of the probe 1P and the probe 2P are respectively modified with a fluorescent group, and the 3' ends are respectively modified with a quenching group.

[0056] In some embodiments, the fluorescent group is selected from at least one of FAM, VIC, Pacific Blue, Atto 425, BodipyFL, Alexa Fluor488, TET, JOE, HEX, NED, Cy3, Quasar 570, TAMRA, Texas Red, ROX, AquaPhluor593, Cy5, Quasar 570 and Quasar 670.

[0057] In some embodiments, the quenching group is selected from at least one of TAMRA, BHQ1, BHQ2, BHQ3, ECLIPS, MGB and Dabcyl.

[0058] Another embodiment of the present invention provides a method for detecting HLA-B27 for non-diagnostic purposes, the method comprising detecting HLA-B27 using the kit for detecting HLA-B27.

[0059] The technical solution of the present invention is further described in detail below through specific embodiments.

[0060] Example 1

[0061] This embodiment is a kit for detecting HLA-B27, and the kit for detecting HLA-B27 comprises:

[0062] PCR reaction solution, primer-probe mixture, positive control and negative control;

[0063] The primer-probe mixture includes an upstream primer 1F, a downstream primer 1R and a probe 1P for detecting HLA-B27, and an upstream primer 2F, a downstream primer 2R and a probe 2P for an internal reference gene;

[0064] The nucleotide sequence of the upstream primer 1F is shown in SEQ ID NO: 1, specifically GAGTCCGAGAGAGGAGCCG, the nucleotide sequence of the downstream primer 1R is shown in SEQ ID NO: 2, specifically CTCTCGGTCAGTCTGTGCC, and the nucleotide sequence of the probe 1P is shown in SEQ ID NO: 3, specifically CCGGGAGACACAGATCTGCAAG;

[0065] The nucleotide sequence of the upstream primer 2F is shown in SEQ ID NO: 4, specifically GGCTCTTAAAAAGTGCAGGGTC, the nucleotide sequence of the downstream primer 2R is shown in SEQ ID NO: 5, specifically GCTGTAGCCAAATTCGTTGTCA, and the nucleotide sequence of the probe 2P is shown in SEQ ID NO: 6, specifically CGCCCTCTGGTGGCTGGCT;

[0066] The molar ratio of the upstream primer 1F, the downstream primer 1R, the probe 1P, the upstream primer 2F, the downstream primer 2R and the probe 2P is 1:10:5:1:10:5;

[0067] The positive control substance is a HLA-B27 positive cell line genomic DNA solution with a concentration of 5 ng / μl;

[0068] The negative control substance is double distilled water;

[0069] The PCR reaction solution is Hieff Universal gPCR master mix, catalog number is 11211E.

[0070] The 5' end of the probe 1P is modified with HEX, and the 3' end is modified with BHQ1;

[0071] The 5' end of the probe 2P is modified with CY5, and the 3' end is modified with BHQ3.

[0072] The preparation method of the kit for detecting HLA-B27 comprises the following steps:

[0073] (a) Preparation of PCR reaction solution:

[0074] Will Hieff Universal gPCR master mix (from Yisheng Biotechnology, catalog number 11211E) was packaged and labeled at 270 μL / tube to obtain PCR reaction solution;

[0075] (b) Preparation of primer-probe mixture:

[0076] Upstream primer 1F, downstream primer 1R, probe 1P, upstream primer 2F, downstream primer 2R and probe 2P (primers and probes were synthesized by Shanghai Shenggong Biological) were diluted to 10 μM respectively with 10 Mm Tris buffer, and then mixed according to the molar ratio, and 110 μL was dispensed into each tube to obtain a primer-probe mixture;

[0077] (c) Preparation of positive control:

[0078] Nucleic acid was extracted from the cultured HLA-B27 positive cell line, and the extracted DNA was quantified using the qubit method, and then diluted to 5 ng / μL with double distilled water and packaged in 20 μL per tube to obtain the positive control;

[0079] (d) Preparation of negative control:

[0080] Divide the double distilled water into 250 μL portions per tube and label them to obtain the negative control.

[0081] Example 2

[0082] This embodiment is a method for detecting HLA-B27 using the kit of Example 1, and the method comprises the following steps:

[0083] Using the kit of Example 1, one positive sample and one negative sample with known HLA-B27 results, and a positive and negative control substance, a PCR reaction system was prepared according to Table 1;

[0084] Table 1

[0085] Reagents Single reaction (μL) 2xPCR reaction solution 10 Primer probe mixture 4 Template DNA 2 NF Water 4 total 20

[0086] After mixing by oscillation and instant centrifugation, amplification and detection were performed using the Shanghai Hongshi Fluorescence Quantitative PCR Instrument SLAN-96. The PCR reaction procedure was as follows:

[0087] 95℃10min; (95℃15s, 59℃15s to collect HEX and CY5 channel fluorescence, 72℃20s)x50; 95℃1min, 40℃1min, 40-95℃ with a heating rate of 0.04℃ / s to collect HEX and CY5 channel fluorescence.

[0088] Test results such as Figure 1 As shown, Figure 1 In the figure, A, B, C, and D are the melting curves of the HEX and CY5 (red) channels of the positive sample, negative sample, positive control, and negative control, respectively. When the red curve has a peak between 58 and 62°C, it indicates that the internal reference gene is amplified normally, otherwise it indicates amplification failure; when the green curve has a peak between 67 and 71°C, it indicates that HLA-B27 is positive, otherwise it indicates that HLA-B27 is negative;

[0089] Depend on Figure 1 It can be seen that both samples and the positive control have amplification curves and melting curves, while the negative control has no amplification curve or melting curve. The CY5 channel (red) is the internal reference gene detection channel. When the melting curve of the CY5 channel has a peak between 58-62°C, it indicates that the reaction is normal and the HLA-B27 result can be interpreted. Otherwise, it indicates that the reaction is abnormal and needs to be redone or redone after troubleshooting the cause.

[0090] When the reference gene result of the CY5 channel is normal, if the melting curve of the HEX channel has a peak between 67-71°C, it means that the sample to be tested is HLA-B27 positive and contains at least one subtype of HLA-B27. Otherwise, it means that the sample to be tested is HLA-B27 negative.

[0091] Example 3

[0092] This example is a study on the accuracy of the detection method of Example 2;

[0093] 50 different blood samples were used. After nucleic acid extraction, the samples were respectively tested using the detection method of Example 2 of the present invention and sent to Shenzhen BGI Medical Laboratory for testing using a first-generation sequencing method. The test results of the 50 samples were statistically analyzed, as shown in Table 2.

[0094] Table 2

[0095]

[0096]

[0097] From Table 2, we can see that:

[0098] The samples with HLA-B27 positive results from first-generation sequencing were all positive when detected by the method of the present invention. Among these positive samples, HLA-B27 subtypes included not only subtypes with high incidence in China, such as HLA-B27:02, HLA-B27:04, HLA-B27:05, HLA-B27:06, HLA-B27:07 and HLA-B27:24, but also a rare type containing HLA-B27:125, which fully demonstrated the compatibility of the detection method of the present invention with different HLA-B27 subtypes and its extremely high sensitivity.

[0099] At the same time, the samples tested this time also involved 32 other types, and this detection method did not produce a single false positive result, which fully proved that this detection method has extremely high specificity. Finally, after comparison, the results of the 50 samples tested by this method were completely consistent with the results of the first-generation sequencing, proving that the accuracy of this detection method is 100%.

[0100] Example 4

[0101] This example is a compatibility test of the detection method of the present invention with different sample types and nucleic acid extraction methods;

[0102] Saliva samples and whole blood samples were collected from 5 volunteers. After verification by first-generation sequencing, 2 of the 5 volunteers were HLA-B27 positive and 3 were negative. A portion of DNA was extracted from each sample using the magnetic bead extraction method (Guangzhou Meiji Biological Extraction Kit) and the boiling crude extraction method (self-prepared reagents). The above 20 DNAs were tested using the detection method of Example 2. The results are shown in Table 3;

[0103] Table 3

[0104]

[0105] From Table 3, we can see that:

[0106] The detection results of the DNA samples obtained by the two sample types and two extraction methods using the kit of the present invention are consistent with the first-generation sequencing results, indicating that the kit of the present invention has high compatibility with sample types and nucleic acid extraction methods.

[0107] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. These modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention, and they should all be included in the scope of the claims and specification of the present invention.

Claims

1. A kit for detecting HLA-B27, characterized in that: The kit for detecting HLA-B27 comprises: PCR reaction solution, primer-probe mixture, positive control and negative control; The primer-probe mixture includes an upstream primer 1F, a downstream primer 1R and a probe 1P for detecting HLA-B27, and an upstream primer 2F, a downstream primer 2R and a probe 2P for an internal reference gene; The nucleotide sequence of the upstream primer 1F is shown in SEQ ID NO: 1, the nucleotide sequence of the downstream primer 1R is shown in SEQ ID NO: 2, and the nucleotide sequence of the probe 1P is shown in SEQ ID NO: 3; The nucleotide sequence of the upstream primer 2F is shown in SEQ ID NO: 4, the nucleotide sequence of the downstream primer 2R is shown in SEQ ID NO: 5, and the nucleotide sequence of the probe 2P is shown in SEQ ID NO:

6.

2. The kit for detecting HLA-B27 according to claim 1, characterized in that: The nucleotide sequence of the upstream primer 1F is the sequence shown in SEQ ID NO: 1 or the complementary sequence with 1 to 5 bases added, deleted or replaced; The nucleotide sequence of the upstream primer 1R is the sequence shown in SEQ ID NO: 2 or the complementary sequence with 1 to 5 bases added, deleted or replaced; The nucleotide sequence of the upstream primer 2F is the sequence shown in SEQ ID NO: 4 or the complementary sequence with 1 to 5 bases added, deleted or replaced; The nucleotide sequence of the upstream primer 2R is the sequence shown in SEQ ID NO: 5 or the complementary sequence with 1 to 5 bases added, deleted or replaced; The nucleotide sequence of the probe 1p is the sequence shown in SEQ ID NO: 3 or the complementary sequence with 1 to 5 bases added, deleted or replaced; The nucleotide sequence of the probe 2p is obtained by adding, deleting or replacing 1 to 5 bases on the sequence shown in SEQ ID NO: 6 or its complementary sequence.

3. The kit for detecting HLA-B27 according to claim 1, characterized in that: The molar ratio of the upstream primer 1F, the downstream primer 1R, the probe 1P, the upstream primer 2F, the downstream primer 2R and the probe 2P is 1:(5-12):(2-6):1:(5-12):(2-6).

4. The kit for detecting HLA-B27 according to claim 1, characterized in that: The positive control substance is a genomic DNA solution of an HLA-B27-positive cell line, and the concentration of the HLA-B27 solution is 4-6 ng / μl.

5. The kit for detecting HLA-B27 according to claim 1, characterized in that: The negative control substance was double distilled water.

6. The kit for detecting HLA-B27 according to claim 1, characterized in that: The PCR reaction solution is 2xTaq enzyme mix.

7. The kit for detecting HLA-B27 according to claim 1, characterized in that: The 5' ends of the probe 1P and the probe 2P are respectively modified with fluorescent groups, and the 3' ends are respectively modified with quenching groups.

8. The kit for detecting HLA-B27 according to claim 7, characterized in that: The fluorescent groups include FAM, VIC, Pacific Blue, Atto 425, Bodipy FL, Alexa Fluor488, TET, JOE, HEX, NED, Cy3, Quasar 570, TAMRA, Texas Red, ROX, AquaPhluor593, Cy5, Quasar 570 and Quasar 670.

9. The kit for detecting HLA-B27 according to claim 7, characterized in that: The quenching groups include TAMRA, BHQ1, BHQ2, BHQ3, ECLIPS, MGB and Dabcyl.

10. A method for detecting HLA-B27 for non-diagnostic purposes, characterized in that: The detection method comprises detecting HLA-B27 using the kit for detecting HLA-B27 described in any one of claims 1 to 9.

Images