Transplanting secondary pathogen infection special detection kit and test method and application thereof

Abstract

The invention discloses a special detection kit for transplantation secondary pathogen infection, which comprises a detection kit and is characterized in that a nested multiple PCR (Polymerase Chain Reaction) amplification primer group and a PCR reaction buffer solution are arranged in the detection kit. The invention also discloses a detection method of the special detection kit for transplanting secondary pathogen infection. The detection method comprises the following steps: S1, extracting nucleic acid of a sample of an infected part of a patient by adopting a paramagnetic particle method, and the like. Meanwhile, the invention also discloses application of the special detection kit for transplantation secondary pathogen infection in preparation and / or identification of a test product for common pathogenic bacteria of transplantation secondary infection. According to the present invention, with the single-tube nested multiplex PCR technology, the multiple microorganisms in the transplanted secondary infection sample can be detected through the one-time sample detection, the multi-joint detection property is provided, the low cost requirement is considered on the basis of meeting the clinical detection performance, and the good practicality and the good economic applicability are provided in the clinical practice.

Description

Technical Field

[0001] The present invention relates to the technical field of pathogen testing agent development, and in particular to a proprietary detection kit for transplantation secondary pathogen infection and a testing method and application thereof. Background Art

[0002] At present, the commonly used detection methods for laboratories to detect various transplant pathogen infections include real-time fluorescence quantitative (1) PCR (real time PCR, RT-qPCR) and (2) multiplex PCR (multiplex PCR, M-PCR). Among them, (1) PCR (real time PCR, RT-qPCR) has good sensitivity and specificity for detecting most clinical samples, but a single tube can only detect a few microbial targets; (2) multiplex PCR (multiplex PCR, M-PCR) can detect multiple pathogen targets at the same time, but it has the disadvantages of low detection sensitivity and easy cross-contamination.

[0003] In addition, due to the presence of multiple bacterial species, varying bacterial density, and low content in clinical specimens of transplant secondary infection, the above-mentioned existing (1) PCR (real time PCR, RT-qPCR) and (2) multiplex PCR (multiplex PCR, M-PCR) detection methods are difficult to resolve the contradiction between high throughput (i.e., simultaneous detection of multiple bacteria) and specificity and accuracy.

[0004] Therefore, we urgently need to develop a transplant pathogen detection kit and detection method that is not only fast but also can resolve the contradiction between high throughput (i.e., simultaneous detection of multiple bacteria) and specificity and accuracy. Summary of the invention

[0005] The purpose of the present invention is to solve the above-mentioned problems existing in the existing transplant pathogen detection, and to provide a proprietary detection kit for transplant secondary pathogen infection, and its testing method and application, which is not only fast, but also can solve the contradiction between high throughput (i.e., simultaneous detection of multiple bacteria) and specificity and accuracy.

[0006] The purpose of the invention is to provide a proprietary detection kit for secondary pathogen infection in transplantation, which is achieved by the following technical solution: comprising a detection kit, wherein the detection kit is provided with a nested multiplex PCR amplification primer set and a PCR reaction buffer.

[0007] The nested multiplex PCR amplification primer set includes a universal target gene for coagulase-negative Staphylococcus, a universal target gene for Enterococcus, a target gene for Klebsiella pneumoniae, a target gene for Escherichia coli, a target gene for Acinetobacter baumannii, a target gene for Staphylococcus aureus, a target gene for Stenotrophomonas maltophilia, and a target gene for Corynebacterium striatum.

[0008] As a preferred technical solution of the present invention, the PCR reaction buffer is one or a combination of 0.05U / μL DNA Polymerase, PCR Buffer, 4mM Mg2+, and 0.2mM dNTPs.

[0009] As a preferred technical solution of the present invention, the nucleotide sequences of the upstream primer and the downstream primer of the universal target gene outer primer of the coagulase-negative Staphylococcus are SEQ ID NOs: 1-2;

[0010] Among them, the nucleotide sequence SEQ ID NO: 1 is GGRCCTGGTGGWTTAACDCGTGAACGYGC, and the nucleotide sequence SEQ ID NO: 2 is CTTGTCCRATRTTCATACGWGAWGGHACACC.

[0011] As a preferred technical solution of the present invention, the nucleotide sequences of the upstream primer and the downstream primer of the coagulase-negative Staphylococcus target gene-specific internal primer are SEQ ID NOs: 3-4;

[0012] Among them, the nucleotide sequence SEQ ID NO: 3 is YTWGATGAAAATGGTCGTTTCYTAG, and the nucleotide sequence SEQ ID NO: 4 is GTTTWGGWGATACRTCCATGT.

[0013] As a preferred technical solution of the present invention, the nucleotide sequences of the upstream primer and the downstream primer of the Enterococcus universal target gene outer primer are SEQ ID NO: 5-6;

[0014] Among them, the nucleotide sequence SEQ ID NO:5 is ACCCATGTCCAGGTTGAAGGTGCG, and the nucleotide sequence SEQ ID NO:6 is AGCACCCCTTCTCCCGAAGTTACGG.

[0015] As a preferred technical solution of the present invention, the nucleotide sequences of the upstream primer and the downstream primer of the Enterococcus target gene-specific internal primer are SEQ ID NOs: 7-8;

[0016] Among them, the nucleotide sequence SEQ ID NO:7 is GGAGAAATTCCAAACGAACTTG, and the nucleotide sequence SEQ ID NO:8 is AGTGCTCTACCTCCATCATT.

[0017] As a preferred technical solution of the present invention, the nucleotide sequences of the upstream primer and the downstream primer of the target gene external primers of Klebsiella pneumoniae, Escherichia coli and Acinetobacter baumannii are SEQ ID NOs: 9 to 10;

[0018] Among them, the nucleotide sequence SEQ ID NO:9 is CRGTKCGTAARCGYCCGGGTATGTAT, and the nucleotide sequence SEQ ID NO:10 is CCRTCGACRTCMGCATCGGTCAT.

[0019] As a preferred technical solution of the present invention, the nucleotide sequences of the upstream primer and the downstream primer of the Klebsiella pneumoniae target gene-specific internal primer are SEQ ID NOs: 11-12;

[0020] Among them, the nucleotide sequence SEQ ID NO: 11 is AAAATGATTGGCCGCATGGA, and the nucleotide sequence SEQ ID NO: 12 is GCAGTTCTTTGTTCTCGTGG.

[0021] As a preferred technical solution of the present invention, the nucleotide sequences of the upstream primer and the downstream primer of the Escherichia coli target gene specific internal primer are SEQ ID NO: 13-14;

[0022] Among them, the nucleotide sequence SEQ ID NO: 13 is GCGTTATCACAGCATCATCATCAT, and the nucleotide sequence SEQ ID NO: 14 is AACGACGTCCATACGATTGAT.

[0023] As a preferred technical solution of the present invention, the nucleotide sequences of the upstream primer and the downstream primer of the Acinetobacter baumannii target gene-specific internal primer are SEQ ID NOs: 15-16;

[0024] Among them, the nucleotide sequence of SEQ ID NO: 15 is GCATTATTGGCCGCGTGTAAC, and the nucleotide sequence of SEQ ID NO: 16 is CGACTTGAATACGACGATCACCTT.

[0025] As a preferred technical solution of the present invention, the nucleotide sequences of the upstream primer and the downstream primer of the Staphylococcus aureus target gene specific internal primer are SEQ ID NO: 17-18;

[0026] Among them, the nucleotide sequence SEQ ID NO: 17 is AATAACGAGGTCATTGCAGCTTG, and the nucleotide sequence SEQ ID NO: 18 is CCAATCATTACCAGCATTACCTGT.

[0027] As a preferred technical solution of the present invention, the nucleotide sequences of the upstream primer and the downstream primer of the Stenotrophomonas maltophilia target gene-specific internal primer are SEQ ID NOs: 19-20;

[0028] Among them, the nucleotide sequence of SEQ ID NO: 19 is GCCTCGAAACCGCTTGTGT, and the nucleotide sequence of SEQ ID NO: 20 is TGGAGGTGGGCGGAATTGAA.

[0029] As a preferred technical solution of the present invention, the nucleotide sequences of the upstream primer and the downstream primer of the Corynebacterium striatum target gene specific internal primer are SEQ ID NO: 21-22;

[0030] Among them, the nucleotide sequence SEQ ID NO:21 is CGAAGGTCTTGAAGCAGCCAT, and the nucleotide sequence SEQ ID NO:22 is CATCCACAGCAGCATGTAGGT.

[0031] The concentration of the PCR reaction buffer is 1×.

[0032] The detection kit is also provided with a human DNA internal reference amplification primer pair, the nucleotide sequences of the upstream primer and the downstream primer of the GAPDH gene of the DNA internal reference amplification primer pair are SEQ ID NOs: 23-24; wherein the nucleotide sequence SEQ ID NO: 23 is AATGGAAGAAATGTGCTTTGGGT, and the nucleotide sequence SEQ ID NO: 24 is TGAGGGACACAAGGTTACCA.

[0033] The detection kit is also provided with a positive control and / or a negative control, wherein the positive control includes synthetic plasmid DNA of a universal target gene of coagulase-negative Staphylococcus, a universal target gene of Enterococcus, a target gene of Klebsiella pneumoniae, a target gene of Escherichia coli, a target gene of Acinetobacter baumannii, a target gene of Staphylococcus aureus, a target gene of Stenotrophomonas maltophilia and a target gene of Corynebacterium striatum; and the negative control is nuclease-free water without genomic DNA.

[0034] The present invention also provides the use of the above-mentioned proprietary detection kit for transplantation secondary pathogen infection in the preparation and / or identification of a test product for common pathogens of transplantation secondary infection.

[0035] In addition, the detection method of the transplant pathogen detection kit is characterized by comprising the following steps:

[0036] S1. Use magnetic bead method to extract nucleic acid from samples of infected areas of patients.

[0037] S2, aspirating the obtained sample nucleic acid and the positive control and negative control in the transplant pathogen detection kit, adding them into a single-tube nested multiplex PCR reaction system containing a nested multiplex PCR amplification primer set and a PCR reaction buffer, and performing a single-tube nested multiplex PCR amplification reaction to obtain a target gene fragment;

[0038] S3. The obtained target gene fragments are detected by a fully automatic capillary electrophoresis instrument to determine the length of each reaction product fragment. The sample detection result is obtained by comparing the detection reaction product fragment length with the theoretical fragment length, and the detection is completed.

[0039] In step S2, the single-tube nested multiplex PCR amplification reaction comprises the following steps:

[0040] (1) Transfer the PCR tube to a PCR amplifier and perform pre-denaturation at 95°C for 5 min;

[0041] (2) After the preliminary denaturation, multiple external primer touchdown amplification is performed. The multiple external primer touchdown amplification method is as follows: denaturation at 98°C for 10 seconds, annealing at 65°C to 60.5°C for 10 seconds, and then extension at 72°C for 90 seconds after annealing. This is repeated for 10 cycles to complete the multiple external primer touchdown amplification.

[0042] (3) After completing the multiple outer primer touchdown amplification, the multiple specific inner primer touchdown amplification is performed. The multiple specific inner primer touchdown amplification method is as follows: denaturation at 98°C for 10 seconds, annealing at 60°C to 55.5°C for 10 seconds, and then extension at 72°C for 30 seconds after annealing. This is repeated for 10 cycles to complete the multiple specific inner primer touchdown amplification.

[0043] (4) After completing the multiple specific inner primer touchdown amplification, further exponential amplification of the inner primer was performed by denaturation at 98°C for 10 s, annealing at 55°C for 10 s, and extension at 72°C for 30 s. This was repeated for 25 cycles to complete further exponential amplification of the inner primer.

[0044] (5) After further exponential amplification of the inner primers, the reaction was extended at 72°C for 5 min to obtain the target gene fragment.

[0045] Wherein, in the steps (2) and (3), the denaturation, annealing and extension temperatures are respectively reduced by 0.5°C on the basis of the previous cycle for each cycle.

[0046] In addition, the reaction product fragments obtained in step S3 include coagulase-negative Staphylococcus fragments, Enterococcus fragments, Klebsiella pneumoniae fragments, Escherichia coli fragments, Acinetobacter baumannii fragments, Staphylococcus aureus fragments, Stenotrophomonas maltophilia fragments, Corynebacterium striatum fragments, and human internal reference fragments.

[0047] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0048] The single-tube nested multiplex PCR technology adopted in the present invention can detect multiple microorganisms in transplant secondary infection samples through a single sample test, and has the capability of multiple joint detection; at the same time, since the nested amplification has an enrichment amplification link, it can well detect trace microorganisms in the sample, and has high sensitivity and high specificity; in addition, the entire amplification process of the present invention can be completed in a single tube without the need for product dilution in the intermediate step, which can also greatly shorten the entire detection cycle and reduce cross contamination, and is more suitable for clinical pathogenic microorganism detection applications in transplant secondary infection, especially low-content microorganism detection; therefore, the present invention not only meets clinical detection performance but also takes into account low-cost requirements, and has better practicality and economic applicability in clinical practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 This is a specific test analysis diagram of the proprietary detection kit for secondary pathogen infection in transplantation of the present invention. DETAILED DESCRIPTION

[0050] The present invention is further described in detail below in conjunction with examples, but the embodiments of the present invention are not limited thereto.

[0051] Example 1

[0052] The invention discloses a proprietary detection kit for secondary pathogen infection in transplantation, comprising a detection kit, wherein a nested multiplex PCR amplification primer set and a PCR reaction buffer are arranged in the detection kit.

[0053] Specifically, the nested multiplex PCR amplification primer set includes a universal target gene for coagulase-negative Staphylococcus, a universal target gene for Enterococcus, a target gene for Klebsiella pneumoniae, a target gene for Escherichia coli, a target gene for Acinetobacter baumannii, a target gene for Staphylococcus aureus, a target gene for Stenotrophomonas maltophilia, and a target gene for Corynebacterium striatum. In actual application, the nested multiplex PCR amplification primer set can also be increased or decreased accordingly according to actual needs.

[0054] The nucleotide sequences of the nested multiplex PCR amplification primers are shown in Table 1:

[0055]

[0056]

[0057] Table 1

[0058] According to the contents recorded in Table 1, the nucleotide sequences of the upstream primer and the downstream primer of the universal target gene outer primer of the coagulase-negative Staphylococcus are SEQ ID NOs: 1 to 2. The nucleotide sequences of the upstream primer and the downstream primer of the target gene specific inner primer of the coagulase-negative Staphylococcus are SEQ ID NOs: 3 to 4. The nucleotide sequences of the upstream primer and the downstream primer of the universal target gene outer primer of the Enterococcus are SEQ ID NOs: 5 to 6. The nucleotide sequences of the upstream primer and the downstream primer of the target gene specific inner primer of the Enterococcus are SEQ ID NOs: 7 to 8. The nucleotide sequences of the upstream primer and the downstream primer of the target gene outer primer of Klebsiella pneumoniae, Escherichia coli and Acinetobacter baumannii are SEQ ID NOs: 9 to 10. The nucleotide sequences of the upstream primer and the downstream primer of the target gene specific inner primer of Klebsiella pneumoniae are SEQ ID NOs: 11 to 12. The nucleotide sequences of the upstream primer and the downstream primer of the target gene specific inner primer of Escherichia coli are SEQ ID NOs: 13 to 14. The nucleotide sequences of the upstream primer and downstream primer of the target gene specific internal primer of Acinetobacter baumannii are SEQ ID NOs: 15 to 16. The nucleotide sequences of the upstream primer and downstream primer of the target gene specific internal primer of Staphylococcus aureus are SEQ ID NOs: 17 to 18. The nucleotide sequences of the upstream primer and downstream primer of the target gene specific internal primer of Stenotrophomonas maltophilia are SEQ ID NOs: 19 to 20. The nucleotide sequences of the upstream primer and downstream primer of the target gene specific internal primer of Corynebacterium striatum are SEQ ID NOs: 21 to 22.

[0059] Meanwhile, the concentration of the PCR reaction buffer is 1×. The PCR reaction buffer is one or more of a combination of 0.05U / μL DNA Polymerase, PCR Buffer, 4mM Mg2+, and 0.2mM dNTPs. In this embodiment, a combination of DNA Polymerase, PCR Buffer, Mg2+, and dNTPs is preferably used to achieve the above.

[0060] Furthermore, the detection kit is also provided with a human DNA internal reference amplification primer pair, and the nucleotide sequences of the upstream primer and the downstream primer of the GAPDH gene of the DNA internal reference amplification primer pair are SEQ ID NO: 23 to 24. At the same time, a positive control and / or a negative control are also provided in the detection kit, and the positive control includes synthetic plasmid DNA of a universal target gene of coagulase-negative Staphylococcus, a universal target gene of Enterococcus, a target gene of Klebsiella pneumoniae, a target gene of Escherichia coli, a target gene of Acinetobacter baumannii, a target gene of Staphylococcus aureus, a target gene of Stenotrophomonas maltophilia, and a target gene of Corynebacterium striatum; the negative control is nuclease-free water without genomic DNA, that is, the negative control is nuclease-free water without any genomic DNA.

[0061] The invention discloses an application of a proprietary detection kit for transplantation secondary pathogen infection in the preparation and / or identification of a test product for common pathogens of transplantation secondary infection.

[0062] Example 2

[0063] The detection method of the transplant pathogen detection kit in Example 1 comprises the following steps:

[0064] S1. Use the magnetic bead method to extract nucleic acid from samples of infected parts of patients. Specifically, after collecting clinical samples from patients with secondary infection after transplantation, transfer the samples to a grinding tube to fully lyse and release nucleic acid. Use the magnetic bead method (manual extraction or automated workstation) to extract sample nucleic acid.

[0065] S2. The sample nucleic acid obtained and the positive control and negative control in the transplant pathogen detection kit are added to a single-tube nested multiplex PCR reaction system containing a nested multiplex PCR amplification primer combination and a PCR reaction buffer, and the target gene fragment is obtained after a single-tube nested multiplex PCR amplification reaction.

[0066] Specifically, the number of reactions required for the experiment is calculated according to the detection requirements, and the number of reactions = number of samples + negative control + positive control. The corresponding amount of sample nucleic acid and the positive control and negative control in the transplant pathogen detection kit are added to the single-tube nested multiple PCR reaction system containing the nested multiple PCR amplification primer combination and PCR reaction buffer.

[0067] In addition, in step S2, the single-tube nested multiplex PCR amplification reaction includes the following steps:

[0068] (1) Transfer the PCR tube to a PCR amplifier and perform pre-denaturation at 95°C for 5 min.

[0069] (2) After the preliminary denaturation, multiple external primer touchdown amplification is performed. The multiple external primer touchdown amplification method is as follows: denaturation at 98°C for 10 seconds, annealing at 65°C to 60.5°C for 10 seconds, and then extension at 72°C for 90 seconds after annealing. This is repeated for 10 cycles to complete the multiple external primer touchdown amplification.

[0070] (3) After completing the multiple outer primer touchdown amplification, the multiple specific inner primer touchdown amplification is performed. The multiple specific inner primer touchdown amplification method is as follows: denaturation at 98°C for 10 seconds, annealing at 60°C to 55.5°C for 10 seconds, and then extension at 72°C for 30 seconds after annealing. This is repeated for 10 cycles to complete the multiple specific inner primer touchdown amplification.

[0071] (4) After completing the multiple specific inner primer touchdown amplification, further exponential amplification of the inner primer was performed by denaturation at 98°C for 10 s, annealing at 55°C for 10 s, and extension at 72°C for 30 s. This was repeated for 25 cycles to complete further exponential amplification of the inner primer.

[0072] (5) After further exponential amplification of the inner primers, the reaction was extended at 72°C for 5 min to obtain the target gene fragment.

[0073] In step (2) and step (3), the denaturation, annealing and extension temperatures are reduced by 0.5°C on the basis of the previous cycle for each cycle.

[0074] S3. The obtained target gene fragments are detected by a fully automatic capillary electrophoresis instrument to determine the length of each reaction product fragment. The sample detection result is obtained by comparing the detection reaction product fragment length with the theoretical fragment length, and the detection is completed.

[0075] Test Example 1

[0076] According to the technical solutions of Example 1 and Example 2 of the present invention, the sensitivity and specificity of the proprietary detection kit for secondary pathogen infection in transplantation of the present invention were tested.

[0077] (1) Testing the sensitivity of the proprietary detection kit for secondary pathogen infection in transplantation: According to the single-tube nested multiplex PCR detection system established in Example 2, the coagulase-negative Staphylococcus, Enterococcus, Klebsiella pneumoniae, Escherichia coli, Acinetobacter baumannii, Staphylococcus aureus, Stenotrophomonas maltophilia and Corynebacterium striatum described in the present invention were diluted to a concentration of 1×

[0078] 10 6 copies / μL, 1×10 5copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 The above-mentioned determination system was used to perform single-tube nested multiplex PCR amplification on the above pathogens, and each target bacterium was tested 20 times. The positive detection rate level of 90-95% was taken as the minimum detection limit (LOD) of the kit, which is the sensitivity. The detection sensitivity of the kit of the present invention is shown in Table 2 below:

[0079] Pathogenic strains Minimum detection limit (copies / μL) Enterococcus faecium 100 Staphylococcus epidermidis 10 Corynebacterium striatum 100 Acinetobacter baumannii 100 Klebsiella pneumoniae 10 Stenotrophomonas maltophilia 100 Staphylococcus aureus 10 Escherichia coli 10

[0080] Table 2

[0081] (2) Testing of the specificity of the proprietary detection kit for transplantation secondary pathogen infection: Pseudomonas aeruginosa, Streptococcus agalactiae, Proteus mirabilis, Haemophilus haemolyticus, Citrobacter freundii, Bacteroides fragilis and Serratia marcescens kept in the laboratory were selected. Nucleic acids of different pathogenic strains were extracted and tested at a concentration of 10 ng / μL. They were used as templates for single-tube nested multiplex PCR amplification by the kit of the present invention according to Example 2, and then fully automatic capillary electrophoresis was used for detection to verify the specificity of the primer design of the kit of the present invention.

[0082] The specificity verification results of the primer design of the kit of the present invention are as follows: Figure 1 As shown, no target peak amplification was observed for Pseudomonas aeruginosa, Streptococcus agalactiae, Proteus mirabilis, Haemophilus haemolyticus, Citrobacter freundii and Serratia marcescens after detection by the fully automatic capillary electrophoresis instrument, indicating that the primer combination in the nested multiplex PCR system designed in the present invention has strong specificity.

[0083] Test Example 2

[0084] In order to better illustrate the difference between the present invention and the prior art, the proprietary detection kit for secondary pathogen infection in transplantation of the present invention is used in clinical samples, and the detection is carried out according to Example 2, and the "consistency rate" of the detection results is compared with the detection results of the "gold standard" bacterial culture method of the prior art under the same detection conditions.

[0085] The test is specifically as follows: 80 samples were measured using the same amplification system and the "gold standard" bacterial culture method in Example 2 of the present invention, including 29 positive samples of Enterococcus, 19 positive samples of coagulase-negative Staphylococcus, 1 positive sample of Corynebacterium striata, 3 positive samples of Acinetobacter baumannii, 10 positive samples of Klebsiella pneumoniae, 3 positive samples of Stenotrophomonas maltophilia, 9 positive samples of Staphylococcus aureus and 6 positive samples of Escherichia coli. The test results of the two methods are shown in Table 3 below:

[0086]

[0087] Table 3

[0088] It can be concluded from Table 3 that the detection method of the proprietary detection kit for transplantation secondary pathogen infection of the present invention is compared with the existing "gold standard" bacterial culture method. The positive detection consistency rate of the kit of the present invention is 100%, and there is no missed detection. The result is statistically significant. Therefore, there is no significant difference between the detection of clinical samples by the patented kit of the present invention and the "gold standard" bacterial culture method, and it has the advantages of rapidity and high efficiency.

[0089] As described above, the present invention can be well implemented.

Claims

1. A proprietary detection kit for secondary pathogen infection in transplantation, including a detection kit, characterized in that: The detection kit is provided with a nested multiplex PCR amplification primer set and a PCR reaction buffer; The nested multiplex PCR amplification primer set includes a universal target gene for coagulase-negative Staphylococcus, a universal target gene for Enterococcus, a target gene for Klebsiella pneumoniae, a target gene for Escherichia coli, a target gene for Acinetobacter baumannii, a target gene for Staphylococcus aureus, a target gene for Stenotrophomonas maltophilia, and a target gene for Corynebacterium striatum. The PCR reaction buffer is one or a combination of 0.05U / μL DNA Polymerase, PCR Buffer, 4mM Mg2+, and 0.2mM dNTPs.

2. The proprietary detection kit for secondary pathogen infection in transplantation according to claim 1, characterized in that: The nucleotide sequences of the upstream primer and the downstream primer of the universal target gene outer primer of the coagulase-negative Staphylococcus are SEQ ID NOs: 1-2; The nucleotide sequences of the upstream primer and the downstream primer of the coagulase-negative Staphylococcus target gene-specific internal primer are SEQ ID NOs: 3-4; The nucleotide sequences of the upstream primer and the downstream primer of the Enterococcus universal target gene outer primer are SEQ ID NO: 5-6; The nucleotide sequences of the upstream primer and the downstream primer of the Enterococcus target gene-specific internal primer are SEQ ID NOs: 7-8; The nucleotide sequences of the upstream primer and the downstream primer of the target gene outer primers of Klebsiella pneumoniae, Escherichia coli and Acinetobacter baumannii are SEQ ID NOs: 9 to 10; The nucleotide sequences of the upstream primer and the downstream primer of the Klebsiella pneumoniae target gene specific internal primer are SEQ ID NOs: 11 to 12; The nucleotide sequences of the upstream primer and the downstream primer of the Escherichia coli target gene specific internal primer are SEQ ID NO: 13-14; The nucleotide sequences of the upstream primer and the downstream primer of the Acinetobacter baumannii target gene-specific internal primer are SEQ ID NOs: 15-16; The nucleotide sequences of the upstream primer and the downstream primer of the Staphylococcus aureus target gene specific internal primer are SEQ ID NOs: 17-18; The nucleotide sequences of the upstream primer and the downstream primer of the Stenotrophomonas maltophilia target gene-specific internal primer are SEQ ID NOs: 19 to 20; The nucleotide sequences of the upstream primer and the downstream primer of the specific internal primer of the target gene of Corynebacterium striatum are SEQ ID NOs: 21-22.

3. The proprietary detection kit for secondary pathogen infection in transplantation according to claim 1, characterized in that: The concentration of the PCR reaction buffer is 1×.

4. The proprietary detection kit for secondary pathogen infection in transplantation according to claim 1, characterized in that: The detection kit is also provided with a human DNA internal reference amplification primer pair, and the nucleotide sequences of the upstream primer and the downstream primer of the GAPDH gene of the DNA internal reference amplification primer pair are SEQ ID NOs: 23-24.

5. The proprietary detection kit for secondary pathogen infection in transplantation according to claim 1, characterized in that: The detection kit is also provided with a positive control and / or a negative control, wherein the positive control includes synthetic plasmid DNA of a universal target gene of coagulase-negative Staphylococcus, a universal target gene of Enterococcus, a target gene of Klebsiella pneumoniae, a target gene of Escherichia coli, a target gene of Acinetobacter baumannii, a target gene of Staphylococcus aureus, a target gene of Stenotrophomonas maltophilia and a target gene of Corynebacterium striatum; and the negative control is nuclease-free water without genomic DNA.

6. Use of the proprietary detection kit for secondary pathogen infection in transplantation according to any one of claims 1 to 5 in the preparation and / or identification of test products for common pathogens of secondary infection in transplantation.

7. The detection method of the proprietary detection kit for secondary pathogen infection in transplantation according to any one of claims 1 to 5, characterized in that: The following steps are involved: S1. Use magnetic beads to extract nucleic acid from samples of infected areas of patients; S2, aspirating the obtained sample nucleic acid and the positive control and negative control in the transplant pathogen detection kit, adding them into a single-tube nested multiplex PCR reaction system containing a nested multiplex PCR amplification primer set and a PCR reaction buffer, and performing a single-tube nested multiplex PCR amplification reaction to obtain a target gene fragment; S3. The obtained target gene fragments are detected by a fully automatic capillary electrophoresis instrument to determine the length of each reaction product fragment. The sample detection result is obtained by comparing the detection reaction product fragment length with the theoretical fragment length, and the detection is completed.

8. The detection method of the proprietary detection kit for secondary pathogen infection in transplantation according to claim 7, characterized in that: In step S2, the single-tube nested multiplex PCR amplification reaction comprises the following steps: (1) Transfer the PCR tube to a PCR amplifier and perform pre-denaturation at 95°C for 5 min; (2) After pre-denaturation, multiple external primer touchdown amplification is performed. The multiple external primer touchdown amplification method is as follows: denaturation at 98°C for 10 seconds, annealing at 65°C to 60.5°C for 10 seconds, and then extension at 72°C for 90 seconds after annealing. This is repeated for 10 cycles to complete the multiple external primer touchdown amplification. (3) After completing the multiple outer primer touchdown amplification, the multiple specific inner primer touchdown amplification is performed. The multiple specific inner primer touchdown amplification method is as follows: denaturation at 98°C for 10 seconds, annealing at 60°C to 55.5°C for 10 seconds, and then extension at 72°C for 30 seconds after annealing. This is repeated for 10 cycles to complete the multiple specific inner primer touchdown amplification. (4) After completing the multiple specific inner primer touchdown amplification, further exponential amplification of the inner primer was performed by denaturation at 98°C for 10 s, annealing at 55°C for 10 s, and extension at 72°C for 30 s. This was repeated for 25 cycles to complete further exponential amplification of the inner primer. (5) After further exponential amplification of the inner primers, the reaction was extended at 72°C for 5 min to obtain the target gene fragment.

9. The detection method of the proprietary detection kit for secondary pathogen infection in transplantation according to claim 8, characterized in that: In the steps (2) and (3), the denaturation, annealing and extension temperatures are reduced by 0.5° C. on the basis of the previous cycle for each cycle.

10. The detection method of the proprietary detection kit for secondary pathogen infection in transplantation according to claim 9, characterized in that: The reaction product fragments obtained in step S3 include coagulase-negative Staphylococcus fragments, Enterococcus fragments, Klebsiella pneumoniae fragments, Escherichia coli fragments, Acinetobacter baumannii fragments, Staphylococcus aureus fragments, Stenotrophomonas maltophilia fragments, Corynebacterium striatum fragments, and human internal reference fragments.

Images