Digital PCR (Polymerase Chain Reaction) kit for detecting six pathogenic microorganisms in water body
By designing a digital PCR kit for water body detection, primer probe compositions for E. coli, Salmonella, Shigella, Vibrio cholerae, Campylobacter jejuni and enterovirus EV71, the problems of low sensitivity and complex sample processing in the existing detection methods are solved, and rapid and accurate detection of pathogenic microorganisms is achieved, and the accuracy and sensitivity of detection are improved.
Patent Information
- Application Number
- CN202411959531.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-30
- Publication Date
- 2025-03-21
AI Technical Summary
The existing methods for detecting pathogens in water bodies have problems such as low sensitivity, high false positive rate, complex sample pretreatment, and high nucleic acid loss rate, making it difficult to quickly and accurately detect key pathogens in environmental water bodies or wastewater.
A digital PCR kit was designed, which contains primer probe compositions for E. coli, Salmonella, Shigella, Vibrio cholerae, Campylobacter jejuni and enterovirus EV71, and is equipped with nucleic acid extraction reagents and detection reagents. The detection is carried out using digital PCR technology to achieve efficient extraction, purification and enrichment of microorganisms and free nucleic acids in the sample.
It has achieved rapid and accurate detection of 6 key pathogenic microorganisms in water bodies, improved nucleic acid recovery, reduced the complexity of sample treatment, enhanced the anti-interference ability of detection, and was able to efficiently detect trace pathogens in environmental water bodies and wastewater to assess potential health risks.
Smart Images
Figure CN119662868A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of pathogenic microorganism detection in water bodies, and in particular to a digital PCR kit for detecting six kinds of pathogenic microorganisms in water bodies. Background Art
[0002] Diseases caused by waterborne pathogens are a major public health issue worldwide. There are a variety of bacteria, viruses and protozoa in environmental water or sewage. Diseases such as diarrhea, dysentery, typhoid and cholera may be caused by waterborne pathogens. Among them, pathogens that can cause intestinal diseases have aroused great concern about the ecological safety of the water environment and human health. Excessive levels of E. coli can cause digestive and urinary system diseases, and in severe cases can cause meningitis and septicemia; Salmonella is a common foodborne pathogen. Among bacterial food poisoning, food poisoning caused by Salmonella often ranks first. Salmonella can cause typhoid fever, septicemia, acute gastroenteritis and other diseases; Shigella is the main pathogen of bacterial dysentery in humans. After infection, gastrointestinal symptoms such as diarrhea and fever may occur. Shigella is also one of the causes of reactive arthritis. After infection, the toxins and antigenic components of Shigella can induce immune response and lead to arthritis; Vibrio cholerae can cause severe intestinal infectious diseases. In severe cases, it can cause circulatory failure and acute renal failure, with the characteristics of rapid onset, strong infectivity and high mortality rate; Campylobacter jejuni is a zoonotic pathogen and a foodborne pathogen, which is considered to be the main cause of bacterial diarrhea in humans; Enterovirus EV71 is a type of human enterovirus and an important pathogen that causes severe hand, foot and mouth disease and death in infants and young children.
[0003] The current detection of pathogens mainly relies on ELISA technology and fluorescent quantitative PCR (qPCR). For ELISA technology, although ELISA detection has good specificity, its sensitivity is low, and false positive results may still occur due to cross-reactions or non-specific binding. In addition, ELISA sample preparation is difficult, and complex pretreatment of samples is required for ELISA detection. The precision of the experimental results is insufficient, low-concentration samples cannot be detected, and absolute quantification cannot be achieved. For qPCR technology, qPCR detection relies on a standard curve. By comparing the Ct values of samples of unknown concentration with a series of standards, the relative amount of template DNA in the unknown reaction is determined, and absolute quantification cannot be performed. Although qPCR detection has a high sensitivity, it still cannot detect samples with low microbial content.
[0004] With the acceleration of urbanization and the increase in population density, obtaining test results as early as possible can effectively prevent and control the spread of bacteria and viruses in the early stage and avoid large-scale spread. However, the existing methods for extracting and purifying nucleic acids from environmental water bodies or sewage and wastewater mostly use centrifugation or filtration of samples to enrich nucleic acids, and the nucleic acid loss rate is high, especially for smaller viral nucleic acids or free nucleic acids, which are more likely to be lost during the extraction process. At present, there are still no rapid detection methods and detection reagents for pathogenic microorganisms in environmental water bodies or sewage and wastewater, especially key pathogens such as Escherichia coli, Salmonella, Shigella, Vibrio cholerae, Campylobacter jejuni, and enterovirus EV71. Therefore, rapid and accurate detection of pathogens in urban sewage and wastewater is of great significance for timely grasping the positive rate and viral load changes of sewage and wastewater samples, effectively evaluating the epidemic intensity and changing trends of key infectious diseases in the coverage area, tracking the composition of viral mutations, and rapidly responding to epidemic assessment and prevention and control work. Summary of the invention
[0005] In view of the above-mentioned prior art, the purpose of the present invention is to provide a digital PCR kit for detecting 6 kinds of pathogenic microorganisms in water.
[0006] To achieve the above object, the present invention adopts the following technical solution:
[0007] In a first aspect of the present invention, a primer-probe composition is provided for simultaneously detecting six pathogenic microorganisms, wherein the six pathogenic microorganisms are Escherichia coli, Salmonella, Shigella, Vibrio cholerae, Campylobacter jejuni and enterovirus EV71; the primer-probe composition comprises a primer pair and a probe, wherein the primer pair and the probe are:
[0008] (1) a primer pair with nucleotide sequences as shown in SEQ ID NO: 1-SEQ ID NO: 2 designed for the Salmonella invA nucleic acid sequence, a probe with a nucleotide sequence as shown in SEQ ID NO: 3, and an ATTO fluorescent group connected to the 5' end of the probe;
[0009] (2) a primer pair with nucleotide sequences as shown in SEQ ID NO:4-SEQ ID NO:5 designed for the Shigella ipaH nucleic acid sequence, a probe with a nucleotide sequence as shown in SEQ ID NO:6, and a HEX fluorescent group connected to the 5' end of the probe;
[0010] (3) a primer pair having a nucleotide sequence of SEQ ID NO:7-SEQ ID NO:8 designed for the cadF nucleic acid sequence of Campylobacter jejuni, a nucleotide sequence of the probe as shown in SEQ ID NO:9, and a CY5 fluorescent group connected to the 5' end of the probe;
[0011] (4) a primer pair with nucleotide sequences as shown in SEQ ID NO: 10-SEQ ID NO: 11 designed for the Escherichia coli fimH nucleic acid sequence, a probe with a nucleotide sequence as shown in SEQ ID NO: 12, and a CY5.5 fluorescent group connected to the 5' end of the probe;
[0012] (5) a primer pair with nucleotide sequences as shown in SEQ ID NO: 13-SEQ ID NO: 14 designed for the nucleic acid sequence of Vibrio cholerae hlyA, a nucleotide sequence of the probe as shown in SEQ ID NO: 15, and a ROX fluorescent group connected to the 5' end of the probe;
[0013] (6) The nucleotide sequence of the primer pair designed for enterovirus EV71 is shown in SEQ ID NO: 16-SEQ ID NO: 17, the nucleotide sequence of the probe is shown in SEQ ID NO: 18, and the 5' end of the probe is connected to a FAM fluorescent group.
[0014] The second aspect of the present invention provides a digital PCR kit of the primer-probe combination, wherein the digital PCR kit comprises a nucleic acid extraction reagent and a detection reagent.
[0015] Furthermore, the nucleic acid extraction reagent includes pretreatment solution A, pretreatment solution B, lysis solution, cleaning solution A, cleaning solution B, elution solution, and super-smooth nanomagnetic beads; the detection reagent includes a primer probe combination, a reaction solution, and a quality control solution.
[0016] Furthermore, the pretreatment solution A contains lysozyme, Tris-HCl, EDTA, Triton X-100, pH=8.0; the lysozyme concentration is 20mg / mL-50mg / mL, the enzyme activity is 20000u / mg, the Tris-HCl concentration is 20-50mM, the EDTA concentration is 1-3mM, and the Triton X-100 concentration is 1%-3%.
[0017] Furthermore, the pretreatment solution B contains proteinase K, Tris-HCl, SDS, CaCl 2 , pH = 7.5;
[0018] The proteinase K concentration is 10mg / mL-30mg / mL, the Tris-HCl concentration is 20-50mM, the SDS concentration is 0.2-1%, and the CaCl 2 The concentration is 5mM-30mM.
[0019] Furthermore, the lysate contains guanidine salt, anionic surfactant, nonionic surfactant, pH buffer, metal ion chelating agent, nucleic acid precipitation adsorbent, pH = 7-9;
[0020] The guanidine salt is one or more of guanidine thiocyanate, guanidine hydrochloride, guanidine nitrate, guanidine carbonate, and guanidine phosphate, with a concentration of 3 mol / L-5 mol / L;
[0021] The anionic surfactant is one or more of SDS, STS, LAS, AES, and AEP, with a concentration of 0.5%-2%;
[0022] The nonionic surfactant is one or more of Tween-20, NP-40, Triton-100, Brij 35, and AEO, with a concentration of 0.5%-5%;
[0023] The pH buffer is one or more of Tris-HCl, PBS, HEPES, and borax-HCl; the concentration is 10-50 mM;
[0024] The metal ion chelating agent is one or more of EDTA, citric acid, and nitrilotriacetic acid, with a concentration of 5-20 mM;
[0025] The nucleic acid precipitation adsorbent is one or more of isopropanol, PEG 6000, and PEG 8000 anhydrous ethanol, with a concentration of 10%-20%.
[0026] Furthermore, the guanidine salt is guanidine thiocyanate; the anionic surfactant is SDS; the nonionic surfactant includes Tween-20, NP-40, and Triton-100; the pH buffer is Tris-HCl; the metal ion chelator is EDTA; and the nucleic acid precipitation adsorbent is PEG 6000.
[0027] Furthermore, the cleaning solution A is a 70% ethanol solution; the cleaning solution B is anhydrous ethanol; the elution solution is sterile enzyme-free water; and the super-smooth nano-magnetic beads are hydroxyl magnetic beads with a particle size of 200-800nm and a concentration of 50-200mg / mL.
[0028] Furthermore, the reaction solution includes Master Mix and sterile enzyme-free water; the quality control solution includes a negative quality control product and a positive quality control product, the negative quality control product is sterile enzyme-free water, and the positive quality control product is a DNA solution of Escherichia coli, Salmonella, Shigella, Vibrio cholerae, Campylobacter jejuni, and enterovirus EV71.
[0029] Furthermore, the method for using the digital PCR kit specifically includes the following steps:
[0030] (1) Sample collection: (2) Sample pretreatment: (3) Nucleic acid extraction, purification and enrichment; (4) Preparation of digital PCR reaction system: The total volume of the digital PCR system reaction system is 20 μL, including 10 μL 2.0dPCR Mix, 0.5 μL each of 12 forward and reverse primers, 0.25 μL each of 6 probes, 2 μL template DNA, and sterile water quantified to 20 μL; (5) Digital PCR amplification: pre-denaturation at 95°C for 10 min; 95°C for 30 s, 60°C for 60 s, for a total of 41 cycles.
[0031] Beneficial effects of the present invention:
[0032] Digital PCR is a new generation of nucleic acid detection technology. Based on digital PCR technology, the present invention first designs primer pairs and probes that can simultaneously detect 6 key pathogenic microorganisms, including Escherichia coli, Salmonella, Shigella, Vibrio cholerae, Campylobacter jejuni, and enterovirus EV71; secondly, the present invention equips the kit with nucleic acid extraction reagents and detection reagents; the nucleic acid extraction reagents include pretreatment solution A, pretreatment solution B, lysis solution, cleaning solution A, cleaning solution B, elution solution, and super-smooth nanomagnetic beads; the detection reagents include primer-probe combinations, reaction solutions, and quality control solutions; and are pre-installed in the components.
[0033] The kit of the present invention can extract, purify and enrich microorganisms and free nucleic acids in various liquid samples at the same time. The samples do not need to be centrifuged or filtered for enrichment. The nucleic acids in the samples are enriched 1000 times, which can improve the nucleic acid recovery rate. The operation is convenient and rapid detection can be achieved. The kit of the present invention does not need to rely on a standard curve, has strong anti-interference ability, is not interfered by other common pathogenic microorganisms in the water body, can detect trace pathogens in environmental samples, and evaluate potential health risks in environmental water bodies and sewage and wastewater. The present invention is not limited to environmental water bodies and sewage and wastewater detection, and samples such as drinking water and solid waste leachate can be detected. The kit of the present invention has high precision and sensitivity, and is of great significance for reducing diseases caused by biological pollution in the water environment. BRIEF DESCRIPTION OF THE DRAWINGS
[0034] Figure 1 These are the front view and top view of component I.
[0035] Figure 2 These are the front view and top view of component II. DETAILED DESCRIPTION
[0036] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.
[0037] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments.
[0038] The experimental materials used in the examples of the present invention but not specifically described are all conventional experimental materials in the art and can be purchased through commercial channels.
[0039] Example 1: Nucleic acid extraction reagents for digital PCR kit
[0040] The digital PCR kit of the present invention has the functions of extracting, purifying and enriching nucleic acids in samples. The digital PCR kit comprises: a nucleic acid extraction reagent and a detection reagent; the nucleic acid extraction reagent consists of a pretreatment solution A, a pretreatment solution B, a lysis solution, a cleaning solution A, a cleaning solution B, an eluent, and super-smooth nano-magnetic beads; the detection reagent comprises a primer-probe combination, a reaction solution and a quality control solution.
[0041] The nucleic acid extraction reagents are composed as follows:
[0042] Pretreatment solution A composition:
[0043] Solution of lysozyme, Tris-HCl, EDTA, and Triton X-100, pH = 8.0;
[0044] The concentration of lysozyme was 20 mg / mL (enzyme activity 20000 u / mg), the concentration of Tris-HCl was 20 mM, the concentration of EDTA was 1 mM, and the concentration of Triton X-100 was 1%.
[0045] Pretreatment liquid B composition:
[0046] Proteinase K, Tris-HCl, SDS, CaCl 2 Solution, pH = 7.5;
[0047] The proteinase K concentration was 10 mg / mL, the Tris-HCl concentration was 20, the SDS concentration was 0.2%, and the CaCl 2 The concentration is 5mM.
[0048] Lysis buffer composition:
[0049] A solution of guanidine salt, anionic surfactant, nonionic surfactant, pH buffer, metal ion chelating agent, and nucleic acid precipitation adsorbent, pH = 7.5;
[0050] The guanidine salt was guanidine thiocyanate, with a concentration of 3 mol / L;
[0051] The anionic surfactant was SDS, with a concentration of 0.5%;
[0052] The nonionic surfactants were Tween-20, NP-40, and Triton-100, all at a concentration of 0.5%;
[0053] The pH buffer was Tris-HCl at a concentration of 30 mM;
[0054] The metal ion chelating agent is EDTA with a concentration of 5-20 mM; the nucleic acid precipitation adsorbent is PEG 6000 with a concentration of 10%.
[0055] Cleaning solution A: 70% ethanol solution.
[0056] Cleaning solution B: anhydrous ethanol.
[0057] Elution buffer: Sterile enzyme-free water.
[0058] The super-smooth nanomagnetic beads are hydroxy magnetic beads with a particle size of 200nm and a concentration of 100mg / mL.
[0059] Example 2: Nucleic acid extraction reagents for digital PCR kit
[0060] The digital PCR kit of the present invention has the functions of extracting, purifying and enriching nucleic acids in samples. The digital PCR kit comprises: a nucleic acid extraction reagent and a detection reagent; the nucleic acid extraction reagent consists of a pretreatment solution A, a pretreatment solution B, a lysis solution, a cleaning solution A, a cleaning solution B, an eluent, and super-smooth nano-magnetic beads; the detection reagent comprises a primer-probe combination, a reaction solution and a quality control solution.
[0061] The nucleic acid extraction reagents are composed as follows:
[0062] Pretreatment solution A composition:
[0063] Solution of lysozyme, Tris-HCl, EDTA, and Triton X-100, pH = 8.0;
[0064] The concentration of lysozyme was 50 mg / mL (enzyme activity 20000 u / mg), the concentration of Tris-HCl was 50 mM, the concentration of EDTA was 3 mM, and the concentration of Triton X-100 was 3%.
[0065] Pretreatment liquid B composition:
[0066] Proteinase K, Tris-HCl, SDS, CaCl 2 Solution, pH = 7.5;
[0067] The proteinase K concentration was 30 mg / mL, the Tris-HCl concentration was 50 mM, the SDS concentration was 1%, and the CaCl 2 The concentration is 30mM.
[0068] Lysis buffer composition:
[0069] A solution of guanidine salt, anionic surfactant, nonionic surfactant, pH buffer, metal ion chelating agent, and nucleic acid precipitation adsorbent, pH = 7.5;
[0070] The guanidine salt was guanidine thiocyanate, with a concentration of 5 mol / L;
[0071] The anionic surfactant was SDS, with a concentration of 2%;
[0072] The nonionic surfactants were Tween-20, NP-40, and Triton-100, all used at a concentration of 5%;
[0073] The pH buffer was Tris-HCl at a concentration of 30 mM;
[0074] The metal ion chelating agent is EDTA with a concentration of 20 mM; the nucleic acid precipitation adsorbent is PEG 6000 with a concentration of 20%.
[0075] Cleaning solution A: 70% ethanol solution.
[0076] Cleaning solution B: anhydrous ethanol.
[0077] Elution buffer: Sterile enzyme-free water.
[0078] The super-smooth nano-magnetic beads are hydroxy magnetic beads with a particle size of 800nm and a concentration of 100mg / mL.
[0079] Example 3: Detection reagents of digital PCR kit
[0080] The detection reagents of the digital PCR kit of the present invention include primers and probes, reaction solution, and quality control solution. The primers and probes of the digital PCR kit are as follows:
[0081] 1) Forward primer sequence designed for Salmonella invA nucleic acid sequence:
[0082] ACCGTGGTCCAGTTTATCGT, reverse primer sequence: GACCATCACCAATGGTCAGC, probe sequence (fluorescent group linked to the 5′ end): ATTO-TACGCTTCGCCGTTCGCGCG;
[0083] 2) Forward primer sequence designed for the Shigella ipaH nucleic acid sequence:
[0084] TGCGCACAACCATCTTACTG, reverse primer sequence: GGGAATTCTCCTCGGTGGAA, probe sequence (fluorescent group linked to the 5' end): HEX-CCCGAAACTGTGGCAGCCTGGT;
[0085] 3) Forward primer sequence designed for Campylobacter jejuni cadF nucleic acid sequence:
[0086] GCACCAGGGATTAGACTTGG, reverse primer sequence: GCCAAAGAATCACTAAGACGGA, probe sequence (fluorescent group linked to the 5' end): CY5-CGCGCCATAATGTCCAAATCCACCGC;
[0087] 4) Forward primer sequence designed for Escherichia coli fimH nucleic acid sequence:
[0088] GGTATTACCTCTCCGGCACA, reverse primer sequence: ATTGCACATTCCCTGCAGTC, probe sequence (fluorescent group linked to the 5' end): CY5.5-CACCTGCACAGGGCGTCGGC;
[0089] 5) Forward primer sequence designed for the Vibrio cholerae hlyA nucleic acid sequence:
[0090] GGCAATGGTGGTAGCTTGAG, reverse primer sequence: CGTTTGCTGACGTCCATCTT, probe sequence (fluorescent group linked to the 5' end): ROX-CGCCACCAACTGCTGACCGCC;
[0091] 6) The forward primer sequence designed for EV71 is: CCAAGTACCCTTTAGTGGTTAGGATTTAC, the reverse primer sequence is: GCATAATTTGGGTTGGCTTTGA, and the probe sequence (fluorescent group linked to the 5' end): FAM-ATGAAGCACGTCAGGGCGTGGATACCT.
[0092] Reaction solution of digital PCR kit: Master Mix, sterile enzyme-free water;
[0093] Quality control solution of the digital PCR kit: The quality control products include negative quality control products and positive quality control products. The negative quality control product is sterile enzyme-free water, and the positive quality control product is a DNA solution of Escherichia coli, Salmonella, Shigella, Vibrio cholerae, Campylobacter jejuni, and enterovirus EV71.
[0094] Example 4: Detection method of digital PCR kit
[0095] The detection method of the digital PCR kit of the present invention is specifically implemented as follows:
[0096] 4.1 Sample collection: Collect 100 mL of target water sample.
[0097] 4.2 Sample preprocessing:
[0098] Add 2 mL of pretreatment solution A to 100 mL of sample, mix well, and incubate at 37°C for 25 min;
[0099] Add 1 mL of pretreatment solution B to the above sample, mix well, and incubate at 58°C for 15 min;
[0100] The lysate, cleaning solution A, cleaning solution B and elution solution of the digital PCR kit of the present invention are pre-packed in nucleic acid extraction reagent component I ( Figure 1 ) and Nucleic Acid Extraction Reagent Component II( Figure 2 )middle.
[0101] Component I, columns 1-5 are pre-filled with 10 mL / well of lysis buffer, column 6 is pre-filled with 5 mL / well of cleaning buffer A, and column 7 is pre-filled with 1 mL / well of elution buffer.
[0102] Component II, 2 mL / well of cleaning solution B is pre-dispensed in columns 1-4, 1 mL / well of cleaning solution A is pre-dispensed in column 5, and 100 μL / well of elution solution is pre-dispensed in column 6.
[0103] 4.3 Nucleic acid extraction, purification and enrichment. Take an automated nucleic acid extraction device based on the principle of transferring magnetic beads using a magnetic rod as an example:
[0104] (1) 100 mL of the pretreated sample was evenly distributed to the A / B / D wells of columns 1-5 of the nucleic acid extraction reagent assembly I, and 10 μL / well of super-smooth nanomagnetic beads were added, and the sample was shaken and lysed for 5 minutes;
[0105] (2) Transfer the magnetic beads to the 6 columns of wells using a magnetic rod and shake to mix for 1 min. This process cleans the nucleic acid and removes impurities.
[0106] (3) Transfer the magnetic beads to the 7th column of wells using a magnetic rod and shake to mix for 1 min. This process will elute the nucleic acid and release it into the elution solution.
[0107] (4) Transfer the magnetic beads to well 2 and shake to mix for 1 min. During this process, the magnetic beads adsorb the nucleic acid and repeat steps (2) and (3).
[0108] (5) Following the operations of steps (2) to (4) above, extract samples from 3 to 5 empty positions, and then transfer the magnetic beads to other wells. The nucleic acid in the eluate has been enriched 25 times;
[0109] (6) Transfer the liquid in wells A7-D7 of column 7 to wells 1-4 of component II and add 10uL / well of super-smooth nano-magnetic beads.
[0110] The magnetic rod cover is respectively operated in the 1-4 wells for magnetic absorption, and the magnetic beads are released to the 5 wells for 1 min of shaking and mixing for the 3rd nucleic acid washing, and then magnetic absorption;
[0111] (7) The magnetic beads were released into the elution solution of the 6-well position, and the mixture was shaken and mixed for 3 minutes for nuclear elution. The magnetic beads were then transferred to other wells. During this process, the nucleic acids were released into the elution solution, and 40-fold nucleic acid enrichment was performed again. After 25-fold enrichment and 40-fold nucleic acid enrichment, 25*40=1000-fold nucleic acid enrichment was finally achieved. Therefore, the concentration of the target microorganism in the original sample = digital PCR detection concentration / 1000.
[0112] 4.4. Preparation of digital PCR reaction system:
[0113] The total reaction volume of the digital PCR system is 20 μL, including 10 μL 2.0dPCR Mix, 0.5 μL each of 12 forward and reverse primers, 0.25 μL each of 6 probes, 2 μL template DNA, and sterile water quantified to 20 μL.
[0114] 4.5. Digital PCR amplification:
[0115] Pre-denaturation at 95°C for 10 min; 95°C for 30 s, 60°C for 60 s, for a total of 41 cycles.
[0116] 4.6.Results analysis:
[0117] Target microorganism concentration in the original sample = digital PCR detection concentration / 1000
[0118] Example 5: Methodological Validation of Digital PCR Kit
[0119] The components of Example 1 and Example 3 were used to verify the relevant indicators using the method described in Example 4.
[0120] 5.1 Validation of nucleic acid extraction recovery rate
[0121] 100 μL of a nucleic acid solution with a known concentration of 998 ng / μL was added to 100 mL of purified water, mixed, and then the method of the present invention was used to extract, purify and enrich the nucleic acid. The concentration of the eluate after extraction was measured with a microspectrophotometer, and the concentration was 966 ng / μL. The nucleic acid recovery rate was 96.8%, and the amount of extracted nucleic acid could truly reflect the amount of nucleic acid in the original sample.
[0122] 5.2 Sensitivity Verification
[0123] Based on the multiplex digital PCR technology kit and method, six pathogens including Escherichia coli, Salmonella, Shigella, Vibrio cholerae, Campylobacter jejuni, and enterovirus EV71 were detected.
[0124] The main steps include:
[0125] (1) Dilution of sample DNA
[0126] The template DNA of Escherichia coli, Salmonella, Shigella, Vibrio cholerae, Campylobacter jejuni, and enterovirus EV71 were diluted to 6.0*10 4 The samples were diluted 10, 100, 1000, 2000, 5000, and 10000 times in sequence. The sensitivity of the kit was verified by the samples in this step.
[0127] (2) System configuration
[0128] The total volume of the digital PCR system reaction system is 20 μL, including 10 μL 2.0dPCR Mix, 0.5 μL each of 12 forward and reverse primers, 0.25 μL each of 6 probes, 2 μL template DNA, and sterile water quantified to 20 μL. Specifically, the sequences of primers and probes are shown in Table 1 below:
[0129] Table 1 Sequences of primers and probes
[0130]
[0131] (3) Digital PCR amplification procedure
[0132] Pre-denaturation at 95°C for 10 min; 95°C for 30 s, 60°C for 60 s, for a total of 41 cycles.
[0133] (4) The results are shown in Table 2:
[0134] Table 2 Sensitivity verification
[0135]
[0136] The results in Table 2 show that digital PCR can simultaneously detect and quantify nucleic acid fragments of Escherichia coli, Salmonella, Shigella, Vibrio cholerae, Campylobacter jejuni and enterovirus EV71. Quantification is possible when the sample concentration is 2 copies / μL, indicating that the kit has high sensitivity.
[0137] 5.3 Specificity Verification
[0138] Negative quality control products, positive quality control products, and DNA samples extracted from microorganisms other than those required by the test kit were tested. Digital PCR detection was performed on Staphylococcus aureus, Pseudomonas aeruginosa, Streptococcus pneumoniae, Mycobacterium tuberculosis, and Enterococcus faecalis. The results are shown in Table 3:
[0139] Table 3 Specificity verification
[0140]
[0141]
[0142] The results in Table 3 show that this kit can only perform quantitative detection on Escherichia coli, Salmonella, Shigella, Vibrio cholerae, Campylobacter jejuni and enterovirus EV71 specified in the kit, and cannot detect Staphylococcus aureus, Pseudomonas aeruginosa, Streptococcus pneumoniae, Mycobacterium tuberculosis and Enterococcus faecalis, indicating that the kit has good specificity and has no cross reaction with Staphylococcus aureus, Pseudomonas aeruginosa, Streptococcus pneumoniae, Mycobacterium tuberculosis and Enterococcus faecalis.
[0143] Example 6: Environmental Sampling Verification
[0144] Water samples flowing through a city were collected, and digital PCR detection was performed using the components of Example 1 and Example 3 and the method described in Example 4 to detect the contents of Escherichia coli, Salmonella, Shigella, Vibrio cholerae, Campylobacter jejuni, and enterovirus EV71 in the water samples. The results are shown in Table 4:
[0145] Table 4 Environmental sampling verification
[0146]
[0147] The results in Table 4 show that the kit can simultaneously detect the presence of multiple pathogens in water and can be quantified. According to the data analysis formula: digital PCR detection concentration / 1000 = target microorganism concentration in the original sample, the content of each pathogen in the actual water sample was calculated, including 36.25 copies / μL for Salmonella, 8.67 copies / μL for Shigella, 0.02 copies / μL for Campylobacter jejuni, 7.53 copies / μL for Escherichia coli, 0.02 copies / μL for Vibrio cholerae, and 0.02 copies / μL for enterovirus EV71.
[0148] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. A primer-probe combination capable of simultaneously detecting six pathogenic microorganisms, characterized in that: The primer-probe composition comprises a primer pair and a probe, wherein the primer pair and the probe are as follows: the nucleotide sequences of the primer pair and the probe designed for Salmonella are shown in SEQ ID NO:1-SEQ ID NO:3, and the 5' end of the probe is connected to the ATTO fluorescent group; the nucleotide sequences of the primer pair and the probe designed for Shigella are shown in SEQ ID NO:4-SEQ ID NO:6, and the 5' end of the probe is connected to the HEX fluorescent group; the nucleotide sequences of the primer pair and the probe designed for Campylobacter jejuni are shown in SEQ ID NO:7-SEQ ID NO:9, and the 5' end of the probe is connected to the CY5 fluorescent group; the nucleotide sequences of the primer pair and the probe designed for Escherichia coli are shown in SEQ ID NO:10-SEQ ID NO:12, and the 5' end of the probe is connected to the CY5.5 fluorescent group; the nucleotide sequences of the primer pair and the probe designed for Vibrio cholerae are shown in SEQ ID NO:13-SEQ ID NO:15, and the 5' end of the probe is connected to the ROX fluorescent group; the nucleotide sequences of the primer pair and the probe designed for enterovirus are shown in SEQ ID NO: As shown in NO:16-SEQ ID NO:18, the 5' end of the probe is connected to a FAM fluorescent group.
2. A digital PCR kit comprising the primer-probe combination according to claim 1, characterized in that: The digital PCR kit includes a nucleic acid extraction reagent and a detection reagent.
3. The digital PCR kit according to claim 2, characterized in that: The nucleic acid extraction reagent comprises a pretreatment solution A, a pretreatment solution B, a lysis solution, a cleaning solution A, a cleaning solution B, an elution solution, and super-smooth nano-magnetic beads; the detection reagent comprises a primer-probe combination, a reaction solution, and a quality control solution.
4. The digital PCR kit according to claim 3, characterized in that: The pretreatment solution A contains lysozyme, Tris-HCl, EDTA, Triton X-100, pH=8.0; the lysozyme concentration is 20mg / mL-50mg / mL, the enzyme activity is 20000u / mg, the Tris-HCl concentration is 20-50mM, the EDTA concentration is 1-3mM, and the Triton X-100 concentration is 1%-3%.
5. The digital PCR kit according to claim 3, characterized in that: The pretreatment solution B contains proteinase K, Tris-HCl, SDS, CaCl2, pH=7.5; The concentration of proteinase K is 10 mg / mL-30 mg / mL, the concentration of Tris-HCl is 20-50 mM, the concentration of SDS is 0.2-1%, and the concentration of CaCl2 is 5 mM-30 mM.
6. The digital PCR kit according to claim 3, characterized in that: The lysate contains guanidine salt, anionic surfactant, nonionic surfactant, pH buffer, metal ion chelating agent, and nucleic acid precipitation adsorbent. pH = 7-9; The guanidine salt is one or more of guanidine thiocyanate, guanidine hydrochloride, guanidine nitrate, guanidine carbonate, and guanidine phosphate, with a concentration of 3 mol / L-5 mol / L; The anionic surfactant is one or more of SDS, STS, LAS, AES, and AEP, with a concentration of 0.5%-2%; The nonionic surfactant is one or more of Tween-20, NP-40, Triton-100, Brij 35, and AEO, with a concentration of 0.5%-5%; The pH buffer is one or more of Tris-HCl, PBS, HEPES, and borax-HCl; the concentration is 10-50 mM; The metal ion chelating agent is one or more of EDTA, citric acid, and nitrilotriacetic acid, with a concentration of 5-20 mM; The nucleic acid precipitation adsorbent is one or more of isopropanol, PEG 6000, and PEG 8000 anhydrous ethanol, with a concentration of 10%-20%.
7. The digital PCR kit according to claim 6, characterized in that: The guanidine salt is guanidine thiocyanate; the anionic surfactant is SDS; the nonionic surfactant includes Tween-20, NP-40, and Triton-100; the pH buffer is Tris-HCl; the metal ion chelator is EDTA; and the nucleic acid precipitation adsorbent is PEG 6000.
8. The digital PCR kit according to claim 3, characterized in that: The cleaning solution A is a 70% ethanol solution; the cleaning solution B is anhydrous ethanol; the eluting solution is sterile enzyme-free water; the super-smooth nano-magnetic beads are hydroxyl magnetic beads with a particle size of 200-800nm and a concentration of 50-200mg / mL.
9. The digital PCR kit according to claim 3, characterized in that: The reaction solution includes Master Mix and sterile enzyme-free water; the quality control solution includes a negative quality control product and a positive quality control product, the negative quality control product is sterile enzyme-free water, and the positive quality control product is a DNA solution of Escherichia coli, Salmonella, Shigella, Vibrio cholerae, Campylobacter jejuni, and enterovirus EV71.
10. The digital PCR kit according to any one of claims 2 to 9, characterized in that: The method of using the digital PCR kit specifically includes the following steps: (1) Sample collection: (2) Sample pretreatment: (3) Nucleic acid extraction, purification and enrichment; (4) Preparation of digital PCR reaction system: The total volume of the digital PCR system reaction system is 20 μL, including 10 μL 2.0dPCR Mix, 0.5 μL each of 12 forward and reverse primers, 0.25 μL each of 6 probes, 2 μL template DNA, and sterile water quantified to 20 μL; (5) Digital PCR amplification: pre-denaturation at 95°C for 10 min; 95°C for 30 s, 60°C for 60 s, for a total of 41 cycles.