Soybean PISTILLATAd (PId) gene and its knockout methods and applications

Abstract

This invention belongs to the field of plant genetic engineering technology, specifically relating to the soybean PISTILLATAd (PId) gene and its knockout method and applications. To discover new genes regulating the number of main stem nodes in soybean, this invention utilizes CRISPR / Cas9 technology to target and edit the soybean PId gene, successfully constructing a homozygous PId mutant. This mutant was then transformed into Agrobacterium, stably transforming soybean to obtain PId homozygous mutant soybean plants. Verification of whether the soybean PId gene participates in regulating the number of main stem nodes revealed that it does indeed participate in regulating the number of main stem nodes, and it holds promise for application in creating soybean germplasm resources with a higher number of main stem nodes. Furthermore, this invention is also significant for creating germplasm resources using CRISPR / Cas9 technology to alter the plant architecture of soybean varieties and increase soybean yield.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the soybean PISTILLATAd (PId) gene and its knockout method and application. Background Technology

[0002] The number of nodes on the main stem of soybean is an important agronomic trait and a crucial factor directly affecting the yield of a single soybean plant. The development process of the soybean main stem can be divided into two stages: (1) the vegetative growth stage, in which leaf primordia are produced on both sides of the apical meristem (SAM) and axillary meristems are produced in the leaf axils; (2) the reproductive growth stage, in which the apical / axillary meristems transform into inflorescence meristems (IM), and the inflorescence meristems differentiate into lateral floral meristems (FM), producing flower buds (Benlloch R, Berbel A, Serrano-Mislata A, et al. (2007) Floral Initiation and inflorescence architecture: a comparative view. Annals of Botany 100:659-676.). Plant morphogenesis is determined by the properties and differentiation of meristems (Coen ES, Nugent J M. (1994) Evolution of flowers and inflorescences. Development Supplement 107-116.), and is jointly regulated and interacts with genes from trophic apical meristems, inflorescence meristems, and flowering meristems (Sussmilch FC, Berbel A, Hecht V, et al. (2015) Pea VEGETATIVE2 is an FD homolog that is essential for flowering and compound inflorescence development. Plant Cell 27:1046-1060.). The Terminal Flower 1 (TFL1) gene regulates the properties and differentiation of apical meristems and is an inhibitor of developmental stage transitions (Benlloch et al., 2007). In Arabidopsis tfl1 mutant plants, the apical meristem prematurely transforms into a flowering meristem, and the indeterminate inflorescence transforms into a determinate inflorescence (Shannon S and Meeks-Wagner D. (1991) A mutation in Arabidopsis TFL1 gene affects inflorescence meristem development. The Plant Cell 3:877-892.).LEAFY (LFY) and APETALA1 (AP1) are attribute genes of floral meristems, determining their differentiation. AP1 is also a regulatory gene for floral organ development, determining the differentiation of calyx and corolla (Bowman, JL, Alvarez, J., Weigel, D., et al. (1993) Control of flower development in Arabidopsis thalianaby APETALA1 and interacting genes. Development 119:721-743.). In floral meristems, AP1 and LFY directly inhibit the expression of the TFL1 gene, maintaining the limited growth habit of the stem (Wagner D, Sablowski RWM, and Meyerowitz E M. (1999) Transcriptional activation of APETALA1 by LEAFY. Science 285:582-584.; Kaufmann K, Wellmer F.). JM, et al. (2010) Orchestration of floral initiation by APETALA1. Science 328:85–89. AP1 and LFY induce the expression of floral organ development genes AP2, PISTILLATA (PI), and AGAMOUS (AG), promoting floral development (Ratcliffe, OJ, Amaya, I., Vincent, CA, et al. (1998). A common mechanism controls the life cycle and architecture of plants. Development 125:1609–1615.). It has been reported that soybean homologs TFL1 and AP1 are involved in regulating primary stem development and yield formation (Yue L., Li X., Fang C., et al. (2021) FT5ainterferes with the Dt1-AP1feedback loop to control flowering time and shoot determination in soybean. Journal of Integrative Plant Biology 00:1-19.; Chen L., Nan H., Kong L., et al. (2020) Soybean AP1 homologs control flowering time and plant height. Journal of Integrative Plant Biology 62(12):1868-1879.). However, there are no reports on other meristematic attribute genes and floral organ development regulatory genes in primary stem development and yield formation.

[0003] CRISPR / Cas9-mediated gene editing is a precise, rapid, and highly efficient genome editing technology developed in recent years. In this system, artificially designed target sequences are transcribed into guide RNA in the cell. Guided by the gRNA, the Cas9 endonuclease recognizes and cuts the target gene, causing double-strand DNA breaks. This triggers the cell's self-repair mechanism, which may result in insertion, deletion, or substitution mutations, thus disrupting the function of the target gene. With continuous improvements in CRISPR / Cas9 technology, editing soybean genes has become simpler and faster, which is of great significance for discovering new genes regulating the number of main stem nodes in soybeans. Summary of the Invention

[0004] To overcome the shortcomings of the prior art, this invention provides a method for CRISPR / Cas9-specific knockout of the soybean PId gene and its application in creating soybean germplasm resources with a large number of main stem nodes.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] This invention provides the application of mutants of the soybean PId gene in altering the plant architecture of soybean varieties and / or increasing soybean yield.

[0007] This invention also provides the application of mutants of the soybean PId gene in the breeding of soybean varieties with more nodes on the main stem.

[0008] Preferably, the mutants of the soybean PId gene include mutants with a 2bp deletion in the exon region of the PId gene and mutants with a 33bp deletion in the exon region and a 13bp deletion in the intron region of the PId gene.

[0009] Preferably, the mutant of the soybean PId gene is obtained by specifically knocking out the soybean PId gene using CRISPR / Cas9 technology.

[0010] A more preferred method is to specifically knock out the soybean PId gene using CRISPR / Cas9 technology:

[0011] S1. Using the pYLCRISPR / Cas9 vector as a backbone, a Cas9gRNA vector pYLCRISPR / Cas9-PId-T1 containing the soybean PId gene editing target site T1 was constructed. This vector was then transfected into Agrobacterium competent cells, and single clones were selected for PCR detection to confirm successful transfection of pYLCRISPR / Cas9-PId-T1. The nucleotide sequence of the soybean PId gene editing target site T1 is shown in SEQ ID No: 7.

[0012] S2. Use the selected positive monoclonal antibodies to infect soybean cotyledons, screen for plants resistant to Basta (glufosinate), and obtain stable T0 generation transformed plants.

[0013] S3. Extract DNA from fresh leaves of T0 generation transgenic soybeans, amplify plasmid backbone fragments, and screen for positive lines;

[0014] S4. After harvesting seeds from positive T0 generation plants, extract DNA from the leaves of T1 generation plants, amplify plasmid backbone fragments and PId gene fragments, and then screen for stable homozygous pid mutants of T1 generation by agarose gel electrophoresis and PCR product sequencing.

[0015] Furthermore, the method for constructing the Cas9 gRNA vector pYLCRISPR / Cas9-PId-T1 containing the soybean PId gene editing target site T1 is as follows: After PCR amplification of the target primers shown in SEQ ID No: 8 and SEQ ID No: 9, the target primers are digested and ligated with the gRNA expression cassette. After two rounds of PCR, a complete expression cassette containing the promoter, target site, and gRNA is constructed. The obtained gRNA expression cassette is then ligated with the pYLCRISPR / Cas9 vector, transformed into E. coli competent cells, and positive E. coli clones are screened.

[0016] Furthermore, Bsa I and T4 DNA ligase were used to ligate the target primers to the gRNA expression cassette via enzyme digestion.

[0017] Furthermore, the first round of PCR was performed using the adapter primers UF and gRNA-R shown in SEQ ID No: 1 and 2; the second round of PCR was performed using the adapter primers B1 and BL shown in SEQ ID No: 3 and 4; and the positive clones of E. coli were screened using the sequencing primers SP1 and SP3 shown in SEQ ID No: 5 and 6.

[0018] Furthermore, the PCR amplification program for the target dual-linker was 90℃ for 30s, followed by room temperature cooling and annealing.

[0019] Furthermore, the plasmid backbone fragment was amplified using the detection primers SP1 and SP3 shown in SEQ ID No: 5 and 6, and the PId gene fragment was amplified using the detection primers shown in SEQ ID No: 12 and 13.

[0020] Compared with the prior art, the beneficial effects of the present invention are:

[0021] This invention utilizes CRISPR / Cas9 technology to target and edit the soybean PId gene (Glyma.06G117600), successfully constructing a homozygous PId mutant. This mutant was then transformed into Agrobacterium and stably transformed into soybeans, yielding PId homozygous mutant soybean plants. Verification of the soybean PId gene's function in regulating the number of main stem nodes revealed that it does indeed participate in regulating this function, suggesting its potential application in creating soybean germplasm resources with a higher number of main stem nodes. Furthermore, this invention is significant for creating germplasm resources using CRISPR / Cas9 technology to alter soybean variety plant architecture and increase soybean yield. Attached Figure Description

[0022] Figure 1 Electrophoretic mapping for the knockout vector;

[0023] In the diagram, A represents the first and second rounds of PCR products amplified by the sgRNA expression cassette, B represents the electrophoresis image of E. coli DH5α colony PCR products, and M represents the 2kb DNA ladder.

[0024] Figure 2 A schematic diagram of a Cas9 sgRNA expression vector with an inserted editing site T1; a schematic diagram of a Cas9 sgRNA expression vector, which is an expression vector with a pYLCRISPR / Cas9 vector as the backbone, containing the herbicide (Bar) gene, the Cas9 gene, the AtU3d promoter, the target site T1, and sgRNA.

[0025] Figure 3 The editing effect of the target site for transgenic hairy roots was observed; the product of transgenic hairy roots amplified by the target detection primers was sequenced, and the peak near the target site was a double peak.

[0026] Figure 4 Screening for T0 generation transgenic positive plants:

[0027] The PCR product of the plasmid backbone fragment, M is a 2kb DNA ladder.

[0028] Figure 5 For screening of stable homozygous pid mutants in generation T1;

[0029] Sequencing peak diagram of PCR products of PId gene fragments near the target site.

[0030] Figure 6 Phenotypic identification of stable homozygous soybean mutants with pid (A represents Yinchuan, B represents Jingzhou). Detailed Implementation

[0031] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0032] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.

[0033] In the following examples, the description of the YLCRISPR / Cas9 vector can be found in: Ma X., Zhu Q., Chen Y., and Liu Y.-G. (2016). CRISPR / Cas9 platforms for genome editing in plants: developments and applications. Mol.Plant.doi:10.1016 / j.molp.2016.04.009. The description of the gRNA vector can be found in: Ma X., Zhu Q., Chen Y., and Liu Y.-G. (2016). CRISPR / Cas9 platforms for genome editing in plants: developments and applications. Mol.Plant.doi:10.1016 / j.molp.2016.04.009.

[0034] To investigate whether the soybean PId gene (Glyma.06G117600) is involved in regulating the number of main stem nodes and other functions, this invention constructed a Cas9gRNA vector pYLCRISPR / Cas9-PId-T1 with the soybean PId gene editing target site T1 inserted into it, using the pYLCRISPR / Cas9 vector as a backbone. This vector was then transfected into Agrobacterium K599 competent cells, and single clones were selected for PCR detection to confirm successful transfection of pYLCRISPR / Cas9-PId-T1. Subsequently, soybean cotyledons were infected, and DNA was extracted from the cotyledon hairy roots. The editing efficiency of this editing site was then identified by PCR.

[0035] The following detailed explanation, with reference to specific examples, details the process of investigating whether the soybean PId gene participates in regulating the number of main stem nodes and other functions.

[0036] 1. Construct a CRISPR / Cas9 knockout vector containing the soybean PId gene editing target site T1.

[0037] 1.1 Sources of Main Reagents and Materials

[0038] E. coli DH5α, gRNA vector, and pYLCRISPR / Cas9 vector were all preserved in our laboratory. The endotoxin-free plasmid extraction kit was purchased from Kangwei Century Company; the agarose gel extraction kit was purchased from TransGen Biotech; KODPlus Neo enzyme, Master Taq mix, restriction endonuclease Bsa I, T4 DNA ligase, CutSmart Buffer, kanamycin, spectinomycin, and DNA marker were all purchased from TaKaRa Company; sequencing and primer synthesis were outsourced to Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd.

[0039] Connector primers:

[0040] UF:5'CTCCGTTTTACCTGTGGAATCG 3' (SEQ ID No: 1);

[0041] gRNA-R:5'CGGAGGAAAATTCCATCCAC 3' (SEQ ID No: 2);

[0042] B1:5'TTCAGAGGTCTCTctcgACTAGTGGAATCGGGCAGCAAAGG 3' (SEQ ID No: 3);

[0043] BL:5'AGCGTGGGTCTCGaccgACGCGTCCATCCACTCCAAGCTC 3' (SEQ ID No: 4);

[0044] Sequencing primers:

[0045] SP1:5'GTCGTGTCCACATGTTGACC 3' (SEQ ID No: 5);

[0046] SP3: 5'TGCAATAACTTCGTATAGGCT 3' (SEQ ID No: 6).

[0047] 1.2 Target Primer Design

[0048] According to the Phytozome database (Phytozome(doe.gov)) and the NCBI database ( https: / / www.ncbi.nlm.nih.gov / The PId (Glyma.06G117600) gene sequences from two databases were used to design target sites on the CRISPRdirect website (http: / / crispr.dbcls.jp). A 23bp target sequence, Target1 (CCTCTGGGATGCTAAGCATGAGG, SEQ ID No: 7), was found on the first exon of the PId gene (located in the 398-420bp region). Target primers were designed based on the target sequence.

[0049] Target primers:

[0050] 5'GTCACCTCATGCTTAGCATCCCAG 3' (SEQ ID No: 8);

[0051] 5'AAACCTGGGATGCTAAGCATGAGG 3' (SEQ ID No: 9).

[0052] 1.3 Operational Steps (1) Ligation and Amplification of Target Adapter and gRNA Expression Cascade

[0053] ① Amplification of the target double primer: Add the target forward primer and the target reverse primer to 0.5×TE and mix to a concentration of 100μmol / L. Then, take 1μL of the forward and reverse primers and add them to the PCR tube. Add 98μL of ddH2O to 100μL and perform PCR. The PCR program is 90℃ for 30s, followed by cooling and annealing at room temperature.

[0054] ② Ligation of the dual-linker to the gRNA expression cassette: Prepare a 10 μL ligation reaction mixture: 2 μL 10 ng / μL gRNA vector, 0.5 μL 100 μmol / L target dual-linker, 0.5 μL LBaSa I (10 U / μL), 0.2 μL T4 DNA ligase, 1 μL 10×NEB T4 DNA ligase buffer, 1 μL 10×NEB Cut Smart Buffer, and 4.8 μL ddH2O. The PCR program was: 37℃ for 5 min, 20℃ for 5 min, for a total of 5 cycles.

[0055] ③ Two rounds of PCR:

[0056] First round of PCR, amplifying the gRNA expression cassette:

[0057] Prepare a 15 μL PCR reaction mixture: 2 μL of the PCR product from step two, 0.3 μL of high-fidelity enzyme KOD Plus Neo, 1.5 μL of KOD Plus Neo Buffer, 0.6 μL of MgSO4, 1.5 μL of dNTPs, 0.2 μL of 10 μmol / L LU-F, 0.2 μL of 10 μmol / L gRNA-R, and bring the total volume to 15 μL with ddH2O. The PCR program is as follows: 95℃ for 2 min; 10 cycles—95℃ for 15 s, 55℃ for 15 s, 68℃ for 10 s; 20 cycles—95℃ for 15 s, 60℃ for 15 s, 68℃ for 10 s, and incubate at 16℃. Perform 1% agarose gel electrophoresis to check for the appearance of a target band of approximately 500 bp.

[0058] In the second round of PCR, the gRNA carrying the target (i.e., the product of the previous round of PCR) was ligated to a specific adapter to construct a complete expression cassette containing the promoter (Ma X., Zhu Q., Chen Y., and Liu Y.-G. (2016). CRISPR / Cas9 platforms for genome editing in plants: developments and applications. Mol. Plant. doi:10.1016 / j.molp.2016.04.009.), the target, and the gRNA.

[0059] Prepare a 20 μL reaction mixture: 2 μL KOD Plus Neo Buffer, 2 μL dNTPs Mix, 0.4 μL KOD Plus Neo, 0.15 μL B1 primer, 0.15 μL BL primer, 1 μL 10-fold dilution of the first-round PCR product, and sterile water to a final volume of 20 μL. The PCR program is: 95℃ for 2 min, 28 cycles (95℃ for 10 s, 58℃ for 15 s, 68℃ for 20 s), and incubation at 16℃. Perform 1% agarose gel electrophoresis to check for a 500 bp band and recover the target band.

[0060] (2) Ligation of gRNA expression cassette with pYLCRISPR / Cas9 vector

[0061] Prepare a 15 μL reaction mixture: Cut SmartBuffer 1.5 μL, CRISPR / Cas9 plasmid 0.5 μL, BsaI 1 μL, add the purified product from the previous step to ensure a concentration of 60–70 ng / μL, and add ddH2O to bring the total volume to 15 μL. The PCR program is: 37℃ for 5 min, 10℃ for 5 min, 20℃ for 5 min, 37℃ for 5 min, for a total of 15 cycles.

[0062] (3) Transformation of Escherichia coli competent cells

[0063] Add 10 μL of the ligation reaction solution from the previous step to Escherichia coli competent cell DH5α, incubate in ice bath for 30 min, incubate in a water bath at 42 °C for 30 s, incubate in ice bath for 2 min, then add 500 μL of LB culture medium in a laminar flow hood, and incubate with shaking at 37 °C and 220 rpm for 1 hour. Then spread it on the LB solid medium containing spectinomycin (Table 1) and culture it in an incubator at 37 °C for 12 hours.

[0064] (4) Screening of positive clones in Escherichia coli

[0065] Prepare a 10 μL reaction system: 5 μL of Master Taq mix, 0.2 μL each of primers SP1 and SP3, 4.6 μL of sterile water, and a small amount of colonies. Then perform PCR according to the procedure: 95 °C for 2 min; 35 cycles (95 °C for 30 s, 58 °C for 30 s, 72 °C for 90 s); 72 °C for 2 min. Then perform 1% agarose gel electrophoresis to check whether a target band of about 500 bp appears. Finally, select positive clones for sequencing, and extract plasmids from the positive clones with correct sequencing ( Figure 1 、 2 ).

[0066] Table 1 Medium formula

[0067]

[0068]

[0069] Note: "-" means no addition is required.

[0070] 2. Root hair transformation and detection of target editing efficiency

[0071] 2.1. Sources of main reagents and materials

[0072] The soybean variety is cultivated soybean (Glycine max L. Merrill) Willams82 (W82), and the Agrobacterium rhizogenes K599 is preserved in this laboratory (or can be purchased from Vidy Biotechnology). Kanamycin, rifampicin, spectinomycin, and DNAmaker are all purchased from TaKaRa Company. Yeast extract, agarose, MES, DMSO, sodium chloride, and other common reagents are mostly domestic analytical pure. The DNA extraction kit is purchased from ComWin Biotech Co., Ltd.; sequencing and primer synthesis are entrusted to Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd. to complete.

[0073] Primers for target detection:

[0074] T1-F:5'TGCTCAAGTTTCCCTTATCATCT 3' (SEQ ID No: 10);

[0075] T1-R: 5'CACTAGATCTGGCTGTATAGCTT 3' (SEQ ID No: 11).

[0076] 2.2 Operating Procedures

[0077] (1) Transformation of soybean in vitro hair roots

[0078] Agrobacterium K599 competent cells were transformed with the pYLCRISPR / Cas9-PId-T1 plasmid. After two days of incubation at 28°C, colony PCR was performed to detect the colonies and screen for positive single clones. Soybean Willam82 seeds were disinfected with 10% H2O2 for 1 minute and then rinsed thoroughly with sterile deionized water. The disinfected seeds were then sown on germination medium (Table 1) and cultured in a soybean climate chamber for one week (12 hours light, 12 hours dark). Agrobacterium K599 containing the target plasmid was then cultured at 28°C until the OD value reached approximately 0.6. Afterward, the bacterial solution was used to create a grid pattern on the upper surface of the soybean cotyledons with a scalpel. The cotyledons were then placed on the rooting medium and transferred to the soybean climate chamber for approximately 15 days of incubation.

[0079] (2) Target editing efficiency detection

[0080] After hairy roots grew from soybean cotyledon callus, DNA was extracted from the hairy roots to amplify the PId gene fragment. The amplification reaction system (30 μL) consisted of: 15 μL Master Taq mix, 2 μL T1-F primer, 2 μL T1-R primer, 10 μL sterile water, and 1 μL DNA template. The PCR program was: 95℃ for 2 min; 35 PCR cycles (95℃ for 30 s, 59℃ for 30 s, 72℃ for 1 min); and a final 72℃ for 2 min. The PCR products were sequenced, and the editing efficiency of the target site was calculated based on the sequencing results. The sequencing results showed a double peak from the target site onwards, indicating that the designed target site could effectively edit the coding region of the PId gene, with an editing efficiency of 50%. Figure 3 ).

[0081] 3. Creation of stable homozygous soybean mutants with PId

[0082] 3.1 Sources of Main Reagents and Materials

[0083] The soybean variety used was cultivated soybean (Glycine max L. Merrill) Williams82 (W82). Agrobacterium EHA101 was preserved in our laboratory (it can also be purchased from Weidi Biotechnology). Basta was purchased from Coolapk, and kanamycin, rifampin, spectinomycin, and DNAmaker were all purchased from TaKaRa. Yeast extract, agarose, MES, DMSO, sodium chloride, and other commonly used reagents were mostly domestically produced analytical grade. The DNA extraction kit was purchased from Kangwei Century Company; sequencing and primer synthesis were outsourced to Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd.

[0084] Backbone detection primers:

[0085] SP1:5'GTCGTGTCCACATGTTGACC 3' (SEQ ID No: 5);

[0086] SP3: 5'TGCAATAACTTCGTATAGGCT 3' (SEQ ID No: 6).

[0087] Target detection primers:

[0088] T1-F:5'TGCTCAAGTTTCCCTTATCATCT 3' (SEQ ID No: 10);

[0089] T1-R: 5'CACTAGATCTGGCTGTATAGCTT 3' (SEQ ID No: 11).

[0090] 3.2 Operating Procedures

[0091] (1) Stable conversion of soybeans

[0092] Agrobacterium EHA101 competent cells were transformed with the pYLCRISPR / Cas9-PId-T1 plasmid and cultured at 28°C for two days. Colony PCR was then performed using primers SP1 and SP3 to screen for positive single clones. Sterilized soybean Williams82 (W82) seeds were then sown in germination medium and cultured in a soybean climate chamber for three days. Cotyledonary nodes were then used as explants for Agrobacterium infection. After co-culture, shoot induction, shoot elongation, and rooting culture, plants resistant to Basta (glufosinate) were screened to obtain stable T0 generation transformed plants.

[0093] (2) Screening of T0 generation transgenic positive plants

[0094] DNA was extracted from fresh leaves of T0 generation transgenic soybeans, and the plasmid backbone fragment was amplified. The amplification reaction system (10 μL) consisted of: 5 μL Master Taq mix, 0.2 μL each of primers SP1 and SP3, 3.6 μL sterile water, and 1 μL DNA template. The PCR program was: 95℃ for 2 min; 35 cycles (95℃ for 30 s, 58℃ for 30 s, 72℃ for 90 s); 72℃ for 2 min. Then, 1% agarose gel electrophoresis was performed to check for the appearance of a target band of approximately 500 bp. The results showed that lines 2 and 4 were positive lines, while lines 1, 3, 5, 6, and 7 were negative lines. Figure 4 ).

[0095] (3) Screening of stable homozygous pid mutants in the T1 generation

[0096] After harvesting seeds from the positive T0 generation plants, DNA was extracted from the leaves of the T1 generation plants. The plasmid backbone fragment was amplified using primers SP1 and SP3, and the PId gene fragment was amplified using primers T1-F and T1-R. The amplified fragments were then subjected to 1% agarose gel electrophoresis and PCR product sequencing. The results showed that homozygous soybean PId lines without a Cas9 backbone were obtained. Line 2 had a 2bp deletion in the exon region (CC, 233-234bp site of the PId gene), named pid-1; line 4 had a 33bp deletion in the exon region (TCTGGGAAGACCCTCTGGGATGCTAAGCATGAG (SEQ ID No: 12), 223-255bp site of the PId gene) and a 13bp deletion in the intron (GTAGGGTTTTTTA (SEQ ID No: 13), 256-268bp site of the PId gene), named pid-2. Figure 5 ).

[0097] 4. Phenotypic identification of stable homozygous soybean mutants with PId

[0098] Homozygous pid mutants pid-1 and pid-2, along with the control Williams82 (W82), were planted at the Yinchuan soybean field experimental base (106°8′29.436″E, 38°29′50.352″N; natural long-day conditions) and the Jingzhou soybean field experimental base (111°45′4.6″E, 30°10′30.3″N; natural short-day conditions). The number of nodes and yield phenotypes were recorded at maturity. Results showed that pid-1 and pid-2 had more nodes and higher yields than W82. Figure 6 ).

[0099] In summary, the soybean PId gene can regulate the number of nodes on the main stem of soybeans, and it is expected to be applied to the creation of soybean germplasm resources with a large number of nodes on the main stem. It is also of great significance for creating germplasm resources through CRISPR / Cas9 technology to change the plant type of soybean varieties and increase soybean yield.

[0100] The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.

Claims

1. The application of mutants of the soybean PId gene in altering the number of nodes on the main stem of soybean and / or increasing soybean yield, characterized in that, The wild-type nucleotide sequence of the soybean PId gene is shown in SEQ ID No: 14, and the CDS sequence is shown in SEQ ID No: 17; the mutant nucleotide sequence of the soybean PId gene is shown in SEQ ID No: 15 or SEQ ID No: 16, and the CDS sequence is shown in SEQ ID No: 18 or SEQ ID No:

19.

2. The application according to claim 1, characterized in that, The mutant of the soybean PId gene was obtained by specifically knocking out the wild-type sequence of the soybean PId gene using CRISPR / Cas9 technology.

Images