Development and application of molecular marker for main-effect qlyi2.2 of maize seedling stage tolerance to waterlogging

Abstract

The application belongs to the field of molecular biology, and discloses obtaining of a main-effect QTL qLYI2.2 of corn seedling stage waterlogging tolerance, and development and application of a molecular marker primer. qLYI2.2 The main-effect QTL site for controlling the waterlogging tolerance phenotype variation is located at the second chromosome of corn, and the physical position is Chr2:180298924-180365041 of the fifth version of the reference genome; the excellent haplotype SNP marker closely linked to the main-effect QTL site is located at the 180355749th base of the second chromosome of the B73 reference genome of corn, the explained waterlogging leaf yellow index phenotype contribution rate is 9.86%, the PARMS marker designed by using the SNP is used for detecting a corn inbred line population, it is found that the operation is simple and the typing is clear, and the corn seedling dry weight, root dry weight, root number, tassel branch number, yield and other traits under waterlogging stress all have good selection effects, and the PARMS marker can be used for molecular marker assisted selection breeding of the corn seedling stage waterlogging tolerance trait.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, specifically relating to the acquisition of the main QTL qLYI2.2 for waterlogging tolerance in maize seedlings and the development and application of its molecular marker primers. Background Technology

[0002] With the intensification of climate anomalies and uneven rainfall during the maize growing season, waterlogging stress has become one of the major natural disasters facing maize production (Zhu Shidie et al., 2024). Developing waterlogging-tolerant varieties with high yield potential is one of the main goals of maize breeding, and understanding the mechanism of waterlogging tolerance is of great significance for breeders to develop new waterlogging-tolerant varieties with different waterlogging tolerance traits (Zaidi et al., 2004).

[0003] The severity of waterlogging damage is related to the duration of stress, soil conditions, climate, cultivation techniques, crop growth stage, and genotype (Mano et al., 2002). Studies have shown that waterlogging during the seedling stage of maize for 6 days is more severe than during the jointing and tasseling stages (Ren et al., 2023), especially from the second leaf stage (V2) to the seventh leaf stage (V7), where the root system is the first to be affected by waterlogging stress (Zaidi et al., 2004). After 6 days of waterlogging treatment, most roots, except for some adventitious roots, tend to rot, and the plants cannot absorb soil nutrients well, resulting in nitrogen deficiency, leaching, and denitrification, the latter manifesting as leaf yellowing (Ren et al., 2017). Root hypoxia leads to decreased respiration rate and root vigor, accelerating leaf senescence and reducing indicators such as photosynthetic rate, intercellular CO2 concentration, transpiration rate, and stomatal conductance. Photosynthetic indicators, such as net photosynthetic rate, decrease with prolonged flooding, and the magnitude of the decrease is directly proportional to the duration of flooding (Zhou Qingyun et al., 2020; Zhang Wei et al., 2017; Han Liangliang et al., 2011). Flooding can disrupt chlorophyll synthesis; 30 days of flooding inhibits chlorophyll a synthesis, affecting photosynthesis (Zhang Wei et al., 2017), resulting in severe energy deficiency (Kauret et al., 2020; Tian et al., 2021). Maize cannot withstand low-oxygen conditions in the root zone, leading to a significant reduction in yield (Dennis et al., 2000).

[0004] However, the current scarcity of waterlogging-tolerant maize germplasm resources, insufficient discovery of key genes, unclear molecular regulatory mechanisms, and lack of efficient molecular breeding technologies severely restrict the cultivation of new waterlogging-tolerant varieties. Discovering and effectively utilizing waterlogging-tolerant genes, exploring the molecular mechanisms of waterlogging tolerance in maize, creating new waterlogging-tolerant maize germplasm, and cultivating new waterlogging-tolerant varieties are the most economical and effective ways to reduce maize losses, increase yield per unit area, and expand the maize planting area (Zaidi et al., 2004, 2010).

[0005] The health of leaves is an important indicator of plant health. The degree of yellowing of leaves under waterlogging conditions varies greatly among maize materials of different genotypes. However, the site information and regulatory mechanism of this adaptation to waterlogging stress are not yet clear in maize.

[0006] Based on this, this study extensively collected 567 backbone inbred lines from maize producing areas in Southwest China and the Huang-Huai-Hai Plain, established a population of superior germplasm with different characteristics, completed whole-genome resequencing at a depth of 20X using the DNBSEQ-T7 / PE150 sequencing platform, and evaluated waterlogging at the seedling stage. Furthermore, through association analysis, superior allelic variations were identified, specific functional markers were developed and used to create intermediate breeding materials, providing superior allelic resources for carrying out molecular breeding for maize waterlogging tolerance. Summary of the Invention

[0007] The purpose of this invention is to provide a reagent for detecting the base at position 180355749 of the second chromosome of the maize genome and its application in the screening and breeding of waterlogging tolerance traits in maize seedlings.

[0008] Another objective of this invention is to provide the application of a reagent for detecting the base at position 180355749 of the second chromosome of the maize genome in the preparation of a screening kit for waterlogging tolerance in maize seedlings.

[0009] The final objective of this invention is to provide a method for screening and breeding maize seedlings to tolerate waterlogging.

[0010] To achieve the above objectives, the present invention is implemented through the following technical solution:

[0011] Obtaining the main-effect QTL qLYI2.2 for controlling the yellowing index of maize seedlings due to waterlogging:

[0012] 1) Through genome-wide association analysis, this invention detected the QTL qLYI 2.2, which regulates the seedling waterlogging leaf yellowing index, on chromosome 2 of maize. This interval contains 87 significant SNP sites with a total length of 0.066 Mb (Chr2: 180298924-180365041). Furthermore, a superior haplotype SNP marker closely linked to it was discovered, located at 180355749 bases on chromosome 2 of the maize B73 reference genome (Zm-B73-REFERENCE-NAM-5.0), which explained 9.86% of the phenotypic contribution of the waterlogging leaf yellowing index.

[0013] 2) For the above SNP molecular markers, the applicant developed PARMS marker primers. The PARMS marker primers are: qLYI2.2F1 (waterlogging resistance haplotype T): GAAGGTGACCAAGTTCATGCTTCCTACACTAAGCCTTGGCTCT;

[0014] qLYI2.2F2 (waterlogging-sensitive haplotype C): GAAGGTCGGAGTCAACGGATTTCCTACACTAAGCCTTGGCTCC;

[0015] and qLYI2.2R: AGACTCAAGACAAAAGACACATGC.

[0016] The scope of protection of this invention also includes:

[0017] Application of reagents for detecting base position 180355749 on chromosome 2 of the maize genome in screening breeding for waterlogging tolerance during maize seedling stage.

[0018] Application of reagents for detecting base position 180355749 on chromosome 2 of the maize genome in the preparation of a screening kit for waterlogging tolerance in maize seedlings.

[0019] In the above-described applications, preferably, the reagent is a primer.

[0020] If the base at position 180355749 of the second chromosome of the maize genome is detected as T, then the maize is determined to be waterlogging-tolerant maize in the seedling stage.

[0021] If the base at position 180355749 of the second chromosome of the maize genome is detected as C, then the maize is determined to be a seedling-sensitive maize.

[0022] The primers described above are preferably PARMS detection primers, and more preferably the primers provided by this invention: qLYI2.2F1 (waterlogging resistant haplotype T): GAAGGTGACCAAGTTCATGCTTCCTACACTAAGCCTTGGCTCT; qLYI2.2F2 (waterlogging sensitive haplotype C): GAAGGTCGGAGTCAACGGATTTCCTACACTAAGCCTTGGCTCC; and qLYI2.2R: AGACTCAAGACAAAAGACACATGC.

[0023] A method for screening and breeding maize seedlings for waterlogging tolerance includes detecting the 180355749th base on chromosome 2 of the maize genome using conventional methods in the art. These conventional methods include, but are not limited to: sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, and mass spectrometry.

[0024] The waterlogging resistance characteristics mentioned in the above-described applications or methods include the waterlogging leaf yellowing index or the root length waterlogging resistance coefficient.

[0025] The above-described applications or methods also include yield traits.

[0026] The reference genome of maize used in this invention is Zm-B73-REFERENCE-NAM-5.0.

[0027] Compared with the prior art, the present invention has the following advantages:

[0028] This invention provides the first fine mapping of a novel major QTL controlling waterlogging-induced yellowing index in maize seedlings based on genome-wide association analysis. The major QTL is located on chromosome 2, a region containing 87 significant SNP loci with a total length of 0.066 Mb (Chr2: 180298924-180365041). These loci are all major QTL loci controlling waterlogging tolerance phenotype variations. A closely linked superior haplotype SNP marker is located at nucleotide 180355749 on chromosome 2 of the maize B73 reference genome (Zm-B73-REFERENCE-NAM-5.0), explaining 9.86% of the waterlogging-induced yellowing index phenotype. The PARMS marker developed based on its optimal allele can be used for marker-assisted selection breeding.

[0029] The applicant verified, through the seedling waterlogging leaf yellowing index phenotype of 567 maize inbred lines, that the superior haplotype qLYI2.2 can reduce the waterlogging leaf yellowing index by 29% in natural populations. Furthermore, it exhibits good selection effects on traits such as seedling dry weight, root dry weight, root number, tassel branch number, and yield under maize waterlogging stress, and has received strong selection in breeding practice. This superior haplotype provides genetic resources for the creation of waterlogging-tolerant maize lines. Attached Figure Description

[0030] Figure 1 Partial field photos of the seedling waterlogging tolerance assessment of 567 inbred line materials;

[0031] The control group had 3 replicates, and the waterlogging treatment group had 3 replicates.

[0032] Figure 2 The distribution of leaf chlorosis index in an inbred line population after two weeks of waterlogging.

[0033] Figure 3 This is a schematic diagram of the qLYI2.2 site association analysis;

[0034] Association analysis of 13.2 million polymorphic variation sites with a minimum allele frequency greater than 0.05 at the qLYI2.2 locus with the waterlogged leaf yellowing index phenotype in 567 different inbred lines, with each dot representing a polymorphic site.

[0035] Figure 4 A schematic diagram for the analysis of superior haplotype effects;

[0036] A comparative analysis of the waterlogging leaf chlorosis index of 177 Hap1 inbred lines and 256 Hap2 inbred lines was conducted. Each box represents the median and interquartile range, extended to the maximum and minimum values. The significance of the differences was estimated by one-way ANOVA.

[0037] Figure 5 This is a schematic diagram illustrating the evaluation of the genetic effects of qLYI2.2 on traits such as seedling dry weight, root dry weight, number of adventitious roots, and total number of roots.

[0038] Scatter plots represent the pedigree chlorosis index distribution, with each box representing the median and interquartile range, extended to the maximum and minimum values. Error bars represent SD, and the significance of differences was estimated by one-way ANOVA.

[0039] Figure 6 This is a schematic diagram illustrating the genetic effects of qLYI2.2 on the number of male branchings, average panicle weight, average grain weight per panicle, and traits.

[0040] Scatter plots represent the pedigree chlorosis index distribution, with each box representing the median and interquartile range, extended to the maximum and minimum values. Error bars represent SD, and the significance of differences was estimated by one-way ANOVA.

[0041] Figure 7 A schematic diagram illustrating the development and utilization of the optimal haplotype functional marker for qLYI2.2;

[0042] In the diagram: Blue: qLYI2.2 type family has strong waterlogging resistance; Green: qlyi2.2 type family has weak waterlogging resistance; Red: Hybrid material. Detailed Implementation

[0043] Unless otherwise specified, the technical solutions described in this invention are conventional solutions in the field; unless otherwise specified, the reagents or materials described are all publicly available.

[0044] The reference genome for maize in this invention is Zm-B73-REFERENCE-NAM-5.0 (MaizeGDB GenomeCenter). Example 1:

[0045] Obtaining the main active ingredient (QTL) qLYI2.2 for waterlogging tolerance in maize seedlings:

[0046] 1. Materials and Methods

[0047] 1.1 Materials

[0048] A total of 567 backbone inbred lines from maize producing areas in Southwest China and the Huang-Huai-Hai Plain were collected. A population of superior germplasm with different characteristics was established. The whole genome was resequencing at a depth of 20X based on the DNBSEQ-T7 / PE150 sequencing platform, and 13.2 million high-quality SNP markers were obtained.

[0049] 1.2 Experimental Methods

[0050] 1.2.1 Phenotypic Identification

[0051] For related populations, 20 seeds from each family were planted in a rectangular plastic box (60 cm long, 25 cm deep, 35 cm wide) divided into 10 compartments, each containing 30 kg of quartz sand. Each experiment was repeated three times, with no replicates for each square box. At the two-leaf stage, 10 uniformly growing seedlings were retained from each replicate and subjected to waterlogging, with the water level maintained 5-7 cm above the quartz sand. A parallel control experiment under normal growth conditions was also conducted. After 8 days of waterlogging stress, 10 traits of seedlings under control (CK) and waterlogging (WT / R) conditions were measured, including seedling height (cm), root length (cm), seedling fresh weight (g), root fresh weight (g), seedling dry weight (g), root dry weight (g), number of adventitious roots, number of primary roots, and total number of roots (adventitious roots + primary roots). The yellowing index and survival rate were scored only under waterlogging conditions. If seedlings did not show leaf chlorosis, the yellowing index was 0; if 50% of the first leaf was chlorotic, the yellowing index was 0.5, and so on. The survival rate was the ratio of the number of surviving seedlings to the total number of seedlings, and the waterlogging tolerance coefficient was the ratio of the trait value under waterlogging conditions to the trait value under control conditions.

[0052] 1.2.1 Genome-wide association analysis of the leaf yellowing index locus during seedling waterlogging

[0053] For the raw sequencing data after sequencing, data quality control was performed to obtain high-quality clean data. This clean data was then aligned to a reference genome for variant detection. The reference genome used was AGPv5, downloaded from http: / / plants.ensembl.org / Zea_mays / Info / Index. BWA software was used to align PE reads with the B73 reference genome sequence, obtaining alignment results in AM format. The SAM format file was converted to BAM format using samtools software. Then, the reads in the BAM file were sorted using the SortSam tool in Picard, and PCR duplicates were removed to obtain the final BAM file suitable for variant calling. Finally, the HaplotypeCaller module of GATK was used for variant detection, including SNPs and InDels. Q and K were calculated using STRUCTURE and TESSEL 5.0 software, respectively. After correction, the P-value was set to 1.0 × 10⁻⁶. -5 As a threshold for the significance of GWAS results.

[0054] 1.2.2 Development of optimal haplotype molecular markers

[0055] Based on the B73 genome and differentially expressed site information provided by qLYI2.2 sequencing, specific primers were designed and detected using PARMS technology. Three marker-specific primers were included, requiring custom design and synthesis according to the experimental objectives. One primer was a locus-specific primer, and the other two were allele-specific primers for SNPs. A 21-base specific universal adapter sequence was added to the 5' end of each of these two primers for matching amplification with fluorescent universal primers. The adapter sequence matching FAM fluorescence was GAAGGTGACCAAGTTCATGCT, and the adapter sequence matching HEX fluorescence was GAAGGTCGGAGTCAACGGATT.

[0056] 1.2.3 Genotype Analysis

[0057] Small-scale DNA extraction from maize was performed using the CTAB (Cetyltrimethyl Ammonium Bromide) method (Saghai-Maroof et al 1984), followed by PARMS SNP detection.

[0058] 2. Results and Analysis

[0059] 2.1 Evaluation of the waterlogging resistance of 567 inbred lines

[0060] At the two-leaf-one-heart stage, after two weeks of waterlogging treatment, the control group showed normal growth. Among the population groups, the root length waterlogging tolerance coefficient was the lowest at 0.48, with a variation range of 0.17-0.99. There were highly significant differences in root length between the control group and the waterlogging treatment group. The waterlogging tolerance coefficient for fresh root weight was 0.63, with a variation range of 0.12-0.98, and the waterlogging tolerance coefficient for dry root weight was 0.76, with a variation range of 0.20-1.03. This indicates that there is relatively rich genetic variation among the populations, and root length is the most sensitive to waterlogging stress. The waterlogging tolerance coefficients for indeterminate root number and total root number were 1.06 and 1.04, respectively, indicating that waterlogging stress has a relatively small impact on the root coefficient (Table 1).

[0061] Based on the yellowing index of leaves after two weeks of waterlogging, the population was divided into 6 levels. Among them, there were 127 inbred lines with a yellowing index greater than 2, 168 inbred lines with a yellowing index less than 1, and 272 inbred lines with a yellowing index between 1 and 2. Figure 2 ).

[0062] Table 1. Evaluation of the waterlogging tolerance of inbred line populations

[0063]

[0064] WT represents the waterlogged treatment group, CK represents the normal growth group, and T-test two-way ANOVA is used for significance testing.

[0065] 2.2 Identification and Genetic Effect Analysis of the qLYI2.2 Gene Locus for the Yellowing Index of Leaves Due to Waterlogging

[0066] This application identifies a novel major-effect QTL controlling the yellowing index of maize seedlings due to waterlogging based on genome-wide association analysis. This major-effect QTL is located on chromosome 2, and the region contains 87 significant SNP loci with a total length of 0.066 Mb (Chr2: 180298924-180365041), named qLYI2.2. Figure 3 ).

[0067] qLYI2.2 locus lead SNP 180355749(T / C) A significant association was found at P=2.21E-6, located at base 180355749 on chromosome 2 of the maize genome (maize B73 reference genome Zm-B73-REFERENCE-NAM-5.0, referred to in this invention as maize B73V5 reference genome), explaining 9.86% of the waterlogged leaf yellowing index phenotype.

[0068] PARMS primers were designed for the above SNP sites as follows:

[0069] (1) Label the leadSNP for peak SNPs closely linked to qLYI2.2. 180355749(T / C) The sequence of 200 bp upstream and downstream of position 180355749 on chromosome 2 of the maize B73V5 reference genome was extracted. The PARMS marker detection primer sequences were obtained according to primer design principles as follows:

[0070] qLYI2.2F1: GAAGGTGACCAAGTTCATGCT TCCTACACTAAGCCTTGGCTCT;

[0071] qLYI2.2F2: GAAGGTCGGAGTCAACGGATT TCCTACACTAAGCCTTGGCTCC ；

[0072] qLYI2.2R:AGACTCAAGACAAAAGACACATGC;

[0073] The underlined part of the forward primer is the fluorescent adapter sequence.

[0074] (2) Using the genomic DNA of the maize inbred line population as a template, the above primers were used to perform real-time PCR amplification. The FAM and HEX signals were scanned using a Tecan F200 and the results were output. Finally, the genotype was converted.

[0075] Using the primers described above, the sequence amplified in the stain-resistant material N75 (parent of Yidan 629) is: TCCTACACTAAGCCTTGGCTC T GGCCTCCAGGTCTTCAAGTCTCCCCGGGCATGTGTCTTTTGTCTTGAGTCT;

[0076] The sequence amplified in the stain-sensitive material PA212 (Dica 007 parent material) is: TCCTACACTAAGCCTTGGCTC C GGCCTCCAGGTCTTCAAGTCTCCCCGGGCATGTGTCTTTTGTCTTGAGTCT.

[0077] Amplification system:

[0078]

[0079] Amplification parameters:

[0080]

[0081] According to SNP 180355749(T / C) The 567 maize inbred lines were divided into two haplotypes, named Hap1 and Hap2, and then paired to compare the differences in leaf chlorosis index between the two haplotypes after two weeks of waterlogging. Among these, 177 inbred lines were SNPs. 180355749(T / T) Also known as the Hap1 allele, 256 materials are SNPs 180355749(C / C) Alternatively referred to as the Hap2 allele, other heterozygous loci were filtered out and not counted. Compared to the Hap2 haplotype, the waterlogging leaf yellowing index of the Hap1 haplotype inbred lines was reduced by an average of 29% (p = 2.3E-11). Figure 4 Therefore, Hap1 is a superior haplotype of qLYI2.2, accounting for 41%.

[0082] Meanwhile, qLYI2.2 is a pleiotropic gene locus. Under waterlogging stress, its superior haplotype HAP1 significantly enhanced the waterlogging tolerance coefficients of seedling dry weight, root dry weight, adventitious root number, and total root number. Compared with the Hap2 haplotype, the waterlogging tolerance coefficient of the Hap1 haplotype inbred lines increased by an average of 0.086 (p = 0.02) for adventitious root number, 0.064 (p = 0.008) for total root number, 0.064 (p = 0.01) for root dry weight, and 0.059 (p = 0.008) for seedling dry weight. Figure 5Regarding plant type-related traits, under waterlogging stress, the number of male spike branches in Hap1 haplotype inbred lines increased by an average of 1.3 compared to Hap2 haplotype (p = 0.002). Regarding yield-related traits, under normal conditions, the average spike weight of Hap1 haplotype was 66.64 g, and that of Hap2 haplotype was 71.49 g (p = 0.038), while under waterlogging stress, the average spike weight of Hap1 haplotype was 38.74 g, and that of Hap2 haplotype was 41.66 g (p = 0.048). Under normal conditions, the average grain weight per spike of Hap1 haplotype was 51.36 g, and that of Hap2 haplotype was 57.92 g (p = 0.001), while under waterlogging stress, the average grain weight of Hap1 haplotype was 29.08 g, and that of Hap2 haplotype was [missing data]. The average weight of 100 seeds for the Hap1 haplotype was 32.53g (p = 0.008). Under normal conditions, the average weight of 100 seeds for the Hap1 haplotype was 22.53g, and for the Hap2 haplotype it was 23.57g (p = 0.0025). However, under waterlogging stress, the average weight of the Hap1 haplotype was 19.74g, and for the Hap2 haplotype it was 20.54g (p = 0.015). This indicates that this locus negatively regulates yield-related traits, suggesting a certain degree of linkage burden between the seedling-stage waterlogging-resistant alleles and yield-related trait loci. Furthermore, the frequency of Hap1 in inbred lines was 41%, further implying that there is still considerable potential for improving waterlogging tolerance in inbred lines using qLYI2.2 in breeding practice. It is possible to aggregate other yield-related gene loci to achieve the improvement effect of waterlogging tolerance and high yield. Figure 6 ).

[0083] Example 2:

[0084] Application of the superior haplotype molecular marker primer qLYI2.2, a major QTL for waterlogging tolerance in maize seedlings:

[0085] In a population of 214 maize inbred lines and 1200 local germplasm, after one week of waterlogging at the two-leaf stage, 25 families with a yellow leaf index (YI) less than 0.5 and 25 families with a YI greater than 2 were randomly selected. Eight plants from each family were pooled, and DNA was extracted. Genotyping was performed using PARMS primers developed for the optimal allele at the qLYI2.2 locus in Example 1. The results showed that 20 families with a YI less than 0.5 belonged to the Hap1 allele, while all 24 families with a YI greater than 2 contained the unfavorable Hap2 allele. The remaining 6 families showed heterozygosity (Table 3). These results confirm that the developed functional markers can be used for marker-assisted selection in the genetic improvement of waterlogging-tolerant lines, providing selection targets for creating new waterlogging-tolerant maize germplasm and breeding new waterlogging-tolerant varieties. Figure 7 ).

[0086] Table 2 shows that the PARMS designation qLYI2.2SR can be used for stain resistance assessment.

[0087]

[0088]

Claims

1. The application of a reagent for detecting the 22nd base of the polynucleotide shown in SEQ ID NO.4 in the maize genome in the screening and breeding of waterlogging tolerance in maize seedlings, characterized in that: If a homozygote of the 22th base of the polynucleotide shown in SEQ ID NO. 4 in the corn genome is T, the corn is determined to be a seedling stage waterlogging tolerant corn, and if a homozygote of the 22th base of the polynucleotide shown in SEQ ID NO. 4 in the corn genome is C, the corn is determined to be a seedling stage waterlogging sensitive corn.

2. The use of a reagent for detecting the 22th base of the polynucleotide as shown in SEQ ID NO. 4 in the maize genome in the preparation of a kit for screening the maize seedling stage waterlogging tolerance trait, characterized in that: If a homozygote of the 22th base of the polynucleotide shown in SEQ ID NO. 4 in the corn genome is T, the corn is determined to be a seedling stage waterlogging tolerant corn, and if a homozygote of the 22th base of the polynucleotide shown in SEQ ID NO. 4 in the corn genome is C, the corn is determined to be a seedling stage waterlogging sensitive corn.

3. Use according to claim 1 or 2, characterized in that, The reagent is a primer.

4. Use according to claim 3, wherein the primer is: qLYI2.2F1 : GAAGGTGACCAAGTTCATGCTTCCTACACTAAGCCTTGGCTCT, qLYI2.2F2 : GAAGGTCGGAGTCAACGGATTTCCTACACTAAGCCTTGGCTCC and qLYI2.2R : AGACTCAAGACAAAAGACACATGC.

5. A method for screening and breeding of a corn seedling stage waterlogging tolerance trait, comprising detecting the 22th base of the polynucleotide shown in SEQ ID NO. 4 in the corn genome, the detection method being sequencing, TaqMan probe method, molecular beacon method, high resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method or mass spectrometry method; if a homozygote of the 22th base of the polynucleotide shown in SEQ ID NO. 4 in the corn genome is T, the corn is determined to be a seedling stage waterlogging tolerant corn, and if a homozygote of the 22th base of the polynucleotide shown in SEQ ID NO. 4 in the corn genome is C, the corn is determined to be a seedling stage waterlogging sensitive corn.

Images