A detection primer set, detection method, kit and application of apple snail
By using MIRA detection primer combinations and fluorescent probes, combined with isothermal amplification and gel electrophoresis or fluorescence methods, the problems of long PCR amplification time and expensive equipment have been solved, enabling rapid and convenient detection of golden apple snails, especially improving detection efficiency and effectiveness in port scenarios.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- 成都海关技术中心
- Filing Date
- 2026-01-09
- Publication Date
- 2026-04-14
AI Technical Summary
Existing technologies for detecting golden apple snails, such as PCR amplification, have drawbacks such as being time-consuming and requiring expensive equipment, and cannot meet the needs for rapid and convenient detection in scenarios such as ports of entry.
The MIRA detection primer composition, including upstream and downstream primers, combined with a fluorescent probe, was used to detect Pomacea canaliculata by isothermal amplification at 37-42℃, followed by gel electrophoresis or fluorescence method.
The detection time for spotted golden apple snails has been reduced to 4 minutes. It has excellent specificity and low detection limit, and can be detected in water samples inhabited by organisms, thus improving the efficiency and effectiveness of quarantine identification.
Smart Images

Figure CN121472430B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of quarantine and identification technology of Pomacea canaliculata, specifically involving a primer set, detection method, reagent kit and application for detecting Pomacea canaliculata. Background Technology
[0002] The spotted golden apple snail (Pomacea canaliculata) is an invasive alien species native to South America. Introduced to China in 1981, it was included in the first batch of invasive alien species lists. It possesses extremely high reproductive capacity (a single female snail can lay eggs 20-40 times a year, with an egg hatching rate exceeding 90%) and adaptability (tolerating water temperatures from 0-45℃). It primarily disrupts the food chain by feeding on aquatic plants (such as rice and water chestnuts), potentially leading to crop failure. The parasites it carries can also cause diseases such as meningoencephalitis in humans, threatening public health and safety. Quarantine identification of the spotted golden apple snail is crucial, as it is both a legal requirement under the Biosafety Law and the Regulations on the Management of Invasive Alien Species, and a key link in preventing its spread. The "Quarantine Identification Method for Spotted Golden Apple Snails" (GB / T 44619-2024), implemented in April 2025, clarifies the technical specifications for morphological detection and molecular biological identification (such as COI gene sequencing) of adult snails, providing a unified standard for port quarantine and field monitoring.
[0003] In existing technologies, the quarantine identification of spotted golden apple snails generally uses PCR amplification technology. For example, CN108588243A - Specific primers for rapid identification of the alien species spotted golden apple snail, multiplex PCR detection kit and detection method, CN120442820A - Probe and primer combination, kit and application of TaqMan real-time fluorescence quantitative PCR for identifying spotted golden apple snails... Although PCR amplification technology has achieved the quarantine identification of spotted golden apple snails, it has disadvantages such as long time consumption and expensive equipment, which cannot meet the needs of rapid and convenient detection in scenarios such as ports. Summary of the Invention
[0004] To address the shortcomings of existing PCR amplification techniques for identifying spotted golden apple snails, such as long processing time and expensive equipment, which cannot meet the needs of rapid and convenient detection in scenarios such as ports of entry, this invention provides a primer set, detection method, reagent kit, and application for detecting spotted golden apple snails.
[0005] The technical solution adopted in this invention is as follows:
[0006] A primer set for detecting the spotted golden apple snail, a MIRA detection primer composition, comprising:
[0007] Upstream primer: 5'-ATAGATCTACAGTCTATCGCTTAAAACTCAGC-3';
[0008] Downstream primer: 5'-TGATTCCTTAAGGAAGACTATTTCTTCTAG-3'.
[0009] Preferably, a fluorescent probe is also included:
[0010] 5'-ATATGACAATACCCTCTAAAGATTTCTTA[FAMdT]C[THF][BHQ1dT]AGAATTTGCAATTCTA-[3'C3spacer].
[0011] A method for detecting spotted golden apple snails includes the following steps:
[0012] S1: Add the DNA sample to be tested to the MIRA amplification system, which includes the spotted golden apple snail detection primer set described above;
[0013] S2: Amplify at 37-42℃ for at least 4 minutes to obtain amplification products, and determine whether it is Pomacea canaliculata based on the amplification products.
[0014] Preferably, the DNA sample to be tested comes from biological tissue or water samples from which the organism is living.
[0015] Preferably, the amplification temperature is 40℃ or 42℃.
[0016] As a preferred method, the amplification product obtained in S2 is used to determine whether it is Pomacea canaliculata by gel electrophoresis, fluorescence method, or colloidal gold method.
[0017] A kit for detecting *Pomacea canaliculata* based on the described primer set or the described method for detecting *Pomacea canaliculata*.
[0018] The application of the aforementioned Pomacea canaliculata detection primer set in the identification of Pomacea canaliculata.
[0019] In summary, due to the adoption of the above technical solution, the beneficial effects of the present invention are:
[0020] This invention provides a primer set, detection method, kit, and application for detecting Pomacea canaliculata. The upstream and downstream primers provided by this invention can be used in both basic and fluorescence methods, demonstrating their versatility. The invention allows for the selection of either basic or fluorescence methods for MIRA detection of Pomacea canaliculata, reducing detection time to as short as 4 minutes. The amplification temperature is 37-42℃, and the method exhibits excellent specificity and a low detection limit. Furthermore, it can detect Pomacea canaliculata in aquatic samples, significantly improving the efficiency and effectiveness of quarantine and identification of Pomacea canaliculata. Attached Figure Description
[0021] Figure 1 Image showing the gel electrophoresis results of preliminary screening of primers using the basic method;
[0022] Figure 2 Image showing the gel electrophoresis results of primer re-screening using the basic method;
[0023] Figure 3 The image shows the banding results of the second screening using the basic primer method compared with the sequencing results.
[0024] Figure 4 Image of gel electrophoresis results for temperature screening based on the fundamental method;
[0025] Figure 5 Image of gel electrophoresis results for specific detection using the basic method;
[0026] Figure 6 The image shows the results of gel electrophoresis for the lowest detection limit of DNA concentration in the basic method;
[0027] Figure 7 The image shows the results of gel electrophoresis for the lowest detection limit based on plasmid concentration in the basic method;
[0028] Figure 8 Fluorescence pattern for primer screening using fluorescence method;
[0029] Figure 9 This is an orthogonal amplification diagram of 1F2R, 1F1R, and 1F3R during fluorescent primer screening;
[0030] Figure 10 This is a reverse cross amplification diagram of 2F2R, 2F1R, and 3F2R primers during fluorescence primer screening;
[0031] Figure 11 This is a fluorescence temperature gradient screening amplification map, where N: Negative control; P: Pomaceamaculata, experimental sample.
[0032] Figure 12 Fluorescence spectrum for screening temperature gradient using fluorescence method, where N: Negative control; P: Pomaceamaculata, experimental sample;
[0033] Figure 13 Fluorescence chromatograms were used to screen for cycle time using a fluorescence method, where N stands for Negative control.
[0034] Figure 14This is a fluorescence-based specific detection amplification image. The samples are: positive sample PC-yang (DNA concentration 68.28 ng / µL); spotted golden apple snail tissue sample PC-60 (DNA concentration 68.28 ng / µL); cyst snail tissue sample PC-nang (DNA concentration 70.47 ng / µL); small tube golden apple snail tissue sample PC-xiao (DNA concentration 86.33 ng / µL); field snail tissue sample PC-tian (DNA concentration 76.14 ng / µL); river snail tissue sample PC-shi (DNA concentration 68.41 ng / µL); cryptic golden apple snail tissue sample PC-ying (DNA concentration 70.13 ng / µL); and the first water sample PC-shui-1 (PC-shui1) (total DNA concentration in the water sample was 29.3 ng / µL). The first water sample had a concentration of 16.1 ng / µL, the second water sample PC-shui-2 (PC-shui2) had a concentration of 8.5 ng / µL, the third water sample PC-shui-3 (PC-shui3) had a concentration of 8.5 ng / µL, the fourth water sample PC-shui-4 (PC-shui4) had a concentration of 4.7 ng / µL, and the negative sample was ddH2O.
[0035] Figure 15 The fluorescence images show the specific detection results using the fluorescence method. Among them, the positive sample PC-yang (DNA concentration 68.28 ng / µL), the spotted golden apple snail tissue sample PC-60 (DNA concentration 68.28 ng / µL), the cyst snail tissue sample PC-nang (DNA concentration 70.47 ng / µL), the small tube golden apple snail tissue sample PC-xiao (DNA concentration 86.33 ng / µL), the river snail tissue sample PC-tian (DNA concentration 76.14 ng / µL), the rock snail tissue sample PC-shi (DNA concentration 68.41 ng / µL), the cryptic golden apple snail tissue sample PC-ying (DNA concentration 70.13 ng / µL), and the first water sample PC-shui-1 (PC-shui1) (the total DNA concentration in the water sample was 29.3%). The first water sample had a concentration of 16.1 ng / µL, the second water sample PC-shui-2 (PC-shui2) had a concentration of 8.5 ng / µL, the third water sample PC-shui-3 (PC-shui3) had a concentration of 8.5 ng / µL, the fourth water sample PC-shui-4 (PC-shui4) had a concentration of 4.7 ng / µL, and the negative sample was ddH2O.
[0036] Figure 16This is a graph showing the fluorescence results at the lowest detection limit using a plasmid concentration meter in a fluorescence assay. Detailed Implementation
[0037] To make the objectives, technical solutions, and advantages of the embodiments of this application clearer, the technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, and not all embodiments.
[0038] It should be noted that the samples in this embodiment were obtained from spotted golden apple snails provided by Sichuan Agricultural University. The DNA samples were extracted using the Universal Genomic DNA Kit (a rapid DNA extraction kit for whole blood / tissue / cell / bacterial cells; Aidelai Biotechnology). Note: DNA samples were stored at -20°C.
[0039] I. Basic Law
[0040] (I) Screening of primer compositions using basic methods
[0041] Referring to GenBank: MF401379.1, *Pomacea maculata mitochondrion*, complete genome. After reviewing the complete sequence, CDS, and inferred conserved region sequences in Snap Gene, the following sequences were selected for primer and probe design:
[0042] TACATTATATTCAGACGAACATCCACATAATTAGGTAATTTTTTATTTATTAGTATTTTATATTATAAGAGAGAAATCTCATTTTTAGGGTATGAACCTAACAGCTTGCTTTTAGCTTATCTTATATAATAGAAGAATTTTAATAATAAATATACAGAGAAGAATTAACTTCGTTAATAGATCTACAGTCTATCGCTTAAAACTCAGCCA TCAAGTATAATTATATGACAATACCCTCTAAAGATTTCTTATCTTAGAATTTGCAATTCTACATTTTTTATTATTAAACTATAAGGAAATATACAAGATTTGAAATATGGTTTTCCTTTAGGCTTTGAAGGCCCATGGTCTCATTAACCTAAAATCTTATGATAATAAGTTTACTAGAAGAAATAGTCTTCCTTAAGGAATCAAAACCCTTTG;
[0043] In this embodiment, all primer compositions on which the final basic method (gel electrophoresis) is based are shown in Table 1:
[0044] Table 1
[0045]
[0046] The process of screening all primer sets for the basic method is as follows:
[0047] 1. Sample: Pomacea canaliculata DNA at a concentration of 563.1 ng / μL;
[0048] 2. Reagent kit: DNA isothermal rapid amplification kit (basic type)-II, AMP Future; It should be noted that the MIRA detection system in this example is prepared according to the instructions of the DNA isothermal rapid amplification kit (basic type)-II, with a reaction volume of 25 μL (the instructions state a 50 μL system, and the sample volume after splitting is half of that in the instructions).
[0049] 3. Sample loading volume: 2.5 μL of Pomacea canaliculata DNA template at a concentration of 563.1 ng / μL, 1 μL of upstream primer, and 1 μL of downstream primer;
[0050] 4. Amplification conditions: Incubate at a constant temperature of 40℃ for 20 min;
[0051] 5. Gel electrophoresis detection:
[0052] (1) Protein removal: Extraction method: Solarbio's finished extraction solution was used, and the operation was carried out according to the instructions of the Amp Future RNA Isothermal Rapid Amplification Kit (Basic Type)-II;
[0053] (2) Running the glue: 50V for 70min; 80V for 50min;
[0054] 6. Test results: such as Figure 1 As shown, according to Figure 1 The bands 1F1R, 1F3R, 2F1R, and 2F2R shown are brighter than the others (it should be noted that, although from...) Figure 1 At first glance, 2F3R appears brighter than 2F1R. However, when using comparison software to screen primer pairs, the background color of 2F3R is actually brighter than that of 2F1R, and 2F3R has more stray bands and more severe tailing. Therefore, 2F1R was chosen instead of 2F3R. Thus, primer pairs 1F1R, 1F3R, 2F1R, and 2F2R were selected for further screening. The screening process was the same as described above, and the resulting detection results are as follows. Figure 2 As shown, the obtained gel bands were sequenced, and the sequencing results are as follows. Figure 3 As shown, from Figure 2 It can be seen that the band obtained by 2F2R is the brightest, and from Figure 3 It can be seen that: Sample A, primer combination 1F1R (tissue DNA), showed no band after recovery due to low concentration. Sample B, primer combination 1F3R (tissue DNA), showed no band after recovery due to low concentration. Sample C, primer combination 2F1R (tissue DNA), showed no band after recovery due to low concentration. Sample D, primer combination 2F2R (tissue DNA), with DNAMAN5 being the sequencing sequence and DNAMAN4 being the target sequence; therefore, based on the band distribution, the optimal primer combination is determined to be 2F2R.
[0055] (II) Temperature gradient screening
[0056] 1. Sample: Pomacea canaliculata DNA at a concentration of 563.1 ng / μL;
[0057] 2. Reagent kit: DNA isothermal rapid amplification kit (basic type)-II, AMP Future; It should be noted that the MIRA detection system in this example is prepared according to the instructions of the DNA isothermal rapid amplification kit (basic type)-II, with a reaction volume of 25 μL (the instructions state a 50 μL system, and the sample volume after splitting is half of that in the instructions).
[0058] 3. Sample loading volume: 2.5 μL of Pomacea canaliculata DNA template at a concentration of 563.1 ng / μL, 1 μL of upstream primer, and 1 μL of downstream primer;
[0059] 4. Amplification conditions: Incubate at 40℃ for 30 min; after incubation, add 25 μL of Solarbio DNA phenol extraction kit (saturated phenol: chloroform: isoamyl alcohol = 25:24:1) and centrifuge at 12000 rpm / min for 5 min.
[0060] 5. Gel electrophoresis detection:
[0061] (1) Protein removal: Extraction method: Solarbio's finished extraction solution was used, and the operation was carried out according to the instructions of the Amp Future RNA Isothermal Rapid Amplification Kit (Basic Type)-II;
[0062] (2) Running the glue: 50V for 70min; 80V for 50min;
[0063] 6. Experimental Results: Temperature gradient screening results are as follows Figure 4 As shown, from Figure 4 It can be seen that there are no impurities at amplification temperatures of 39℃ and 40℃, and the band is brighter at amplification temperature of 40℃. Therefore, 40℃ was chosen as the amplification temperature.
[0064] (III) Specificity
[0065] 1. Samples: Positive sample (DNA concentration 563.1 ng / μL), Pomacea canaliculata tissue sample (DNA concentration 563.1 ng / μL), Pomacea canaliculata tissue sample (DNA concentration 704.7 ng / µL), Pomacea canaliculata tissue sample (DNA concentration 863.3 ng / µL), Pomacea canaliculata tissue sample (DNA concentration 761.4 ng / µL), 12 μL, 10 μL, and 8 μL of wild water samples where Pomacea canaliculata lived (total DNA concentration in water samples 29.3 ng / µL), and negative sample (ddH2O);
[0066] 2. Reagent kit: DNA isothermal rapid amplification kit (basic type)-II, AMP Future; It should be noted that the MIRA detection system in this example is prepared according to the instructions of the DNA isothermal rapid amplification kit (basic type)-II, with a reaction volume of 25 μL (the instructions state a 50 μL system, and the sample volume after splitting is half of that in the instructions).
[0067] 3. Sample loading volume: Add 2.5 μL of each sample, 1 μL of upstream primer, and 1 μL of downstream primer according to the sample concentrations mentioned above;
[0068] 4. Amplification temperature: 40℃; Amplification time: 20 minutes;
[0069] 5. Gel electrophoresis detection:
[0070] (1) Protein removal: Extraction method: Solarbio's finished extraction solution was used, and the operation was carried out according to the instructions of the Amp Future RNA Isothermal Rapid Amplification Kit (Basic Type)-II;
[0071] (2) Running the glue: 50V for 70min; 80V for 50min;
[0072] 6. Test Results: The test results are as follows Figure 5 As shown, from Figure 5 It can be seen that the primer composition provided by this invention has good specificity and can directly achieve the quarantine identification of Pomacea canaliculata through environmental DNA. It should be noted that the difficulty in achieving the quarantine of Pomacea canaliculata through water samples lies in the fact that Pomacea canaliculata is small in size, has a low population density in the environment, and leaves little DNA in the environment. Therefore, 95% of the 29.3 ng / µL DNA in the collected water sample may be impurities, which can seriously interfere with the detection of Pomacea canaliculata. Therefore, the primers provided by this invention, which enable the quarantine of Pomacea canaliculata through water samples, represent a significant breakthrough.
[0073] (iv) Minimum detection threshold
[0074] (1) Detection limit using Pomacea canaliculata DNA concentration meter
[0075] 1. Samples: Positive sample (DNA, concentration 563.1 ng / μL), negative sample (template ddH2O), and the concentrations of DNA in the remaining samples are 5.6 x 10⁻⁶. 2 ng / μL, 5.6x10 1 ng / μL, 5.6x10 -1 ng / μL, 5.6x10 -2 ng / μL, 5.6x10 -3 ng / μL, 5.6x10 -4 ng / μL, 5.6x10 -5 ng / μL, 5.6x10 -6 ng / μL, 5.6x10 -7 ng / μL;
[0076] 2. Reagent kit: DNA isothermal rapid amplification kit (basic type)-II, AMP Future; It should be noted that the MIRA detection system in this example is prepared according to the instructions of the DNA isothermal rapid amplification kit (basic type)-II, with a reaction volume of 25 μL (the instructions state a 50 μL system, and the sample volume after splitting is half of that in the instructions).
[0077] 3. Sample loading volume: Add 2.5 μL of each sample, 1 μL of upstream primer, and 1 μL of downstream primer according to the sample concentrations mentioned above;
[0078] 4. Amplification temperature: 40℃; Amplification time: 20 minutes;
[0079] 5. Gel electrophoresis detection:
[0080] (1) Protein removal: Extraction method: Solarbio's finished extraction solution was used, and the operation was carried out according to the instructions of the Amp Future RNA Isothermal Rapid Amplification Kit (Basic Type)-II;
[0081] (2) Running the glue: 50V for 70min; 80V for 50min;
[0082] 6. Test Results: The results are as follows Figure 6 As shown, from Figure 6 It can be seen that when the DNA concentration is 5.6 x 10⁻⁶ -5 Bands were still observed at ng / μL, therefore the limit of detection was 5.6 x 10⁻⁶. -5 ng / μL.
[0083] (2) Limit of detection as measured by plasmid concentration
[0084] 1. Detection limit based on plasmid concentration
[0085] 1. Sample: Plasmid concentration is 10 2Sample concentration of ng / µL, plasmid concentration of 10 1 Sample concentration of ng / µL, plasmid concentration of 10 0 Sample concentration of ng / µL, plasmid concentration of 10 -1 Sample concentration of ng / µL, plasmid concentration of 10 -1 Sample concentration of ng / µL, plasmid concentration of 10 -2 Sample concentration of ng / µL, plasmid concentration of 10 -3 Sample concentration of ng / µL, plasmid concentration of 10 -4 Sample concentration of ng / µL, plasmid concentration of 10 -5 Sample concentration of ng / µL, plasmid concentration of 10 -6 Sample concentration of ng / µL, plasmid concentration of 10 -7 Sample concentration of ng / µL, plasmid concentration of 10 -8 Sample concentration of ng / µL, plasmid concentration of 10 -9 Sample concentration of ng / µL, plasmid concentration of 10 -10 Samples in ng / µL;
[0086] 2. Reagent kit: DNA isothermal rapid amplification kit (basic type)-II, AMP Future; It should be noted that the MIRA detection system in this example is prepared according to the instructions of the DNA isothermal rapid amplification kit (basic type)-II, with a reaction volume of 25 μL (the instructions state a 50 μL system, and the sample volume after splitting is half of that in the instructions).
[0087] 3. Sample loading volume: Add 2.5 μL of each sample, 1 μL of upstream primer, and 1 μL of downstream primer according to the sample concentrations mentioned above;
[0088] 4. Amplification temperature: 40℃; Amplification time: 20 minutes;
[0089] 5. Gel electrophoresis detection:
[0090] (1) Protein removal: Extraction method: Solarbio's finished extraction solution was used, and the operation was carried out according to the instructions of the Amp Future RNA Isothermal Rapid Amplification Kit (Basic Type)-II;
[0091] (2) Running the glue: 50V for 70min; 80V for 50min;
[0092] 6. Test Results: The results are as follows Figure 7 As shown, from Figure 7 It can be seen that when the plasmid concentration is 1x10 -5 A band was still present at ng / μL, therefore the limit of detection was 1x10⁻⁶. -5 ng / μL.
[0093] II. Fluorescence Method
[0094] (I) Screening of primer compositions using fluorescence method
[0095] Referring to GenBank: MF401379.1, *Pomacea maculata mitochondrion*, complete genome. After reviewing the complete sequence, CDS, and inferred conserved region sequences in Snap Gene, the following sequences were selected for primer and probe design:
[0096] TACATTATATTCAGACGAACATCCACATAATTAGGTAATTTTTTATTTATTAGTATTTTATATTATAAGAGAGAAATCTCATTTTTAGGGTATGAACCTAACAGCTTGCTTTTAGCTTATCTTATATAATAGAAGAATTTTAATAATAAATATACAGAGAAGAATTAACTTCGTTAATAGATCTACAGTCTATCGCTTAAAACTCAGCCA TCAAGTATAATTATATGACAATACCCTCTAAAGATTTCTTATCTTAGAATTTGCAATTCTACATTTTTTATTATTAAACTATAAGGAAATATACAAGATTTGAAATATGGTTTTCCTTTAGGCTTTGAAGGCCCATGGTCTCATTAACCTAAAATCTTATGATAATAAGTTTACTAGAAGAAATAGTCTTCCTTAAGGAATCAAAACCCTTTG;
[0097] In this embodiment, all primer compositions used for the fluorescence method are shown in Table 2:
[0098] Table 2
[0099]
[0100] The process of screening all primer sets for the fluorescence method is as follows:
[0101] 1. Sample: A tissue sample from Pomacea canaliculata with a DNA concentration of 68.28 ng / μL;
[0102] 2. Reagent kit: DNA isothermal rapid amplification kit (basic type)-II, AMP Future; It should be noted that the MIRA detection system in this example is prepared according to the instructions of the DNA isothermal rapid amplification kit (basic type)-II, with a reaction volume of 25 μL (the instructions say 50 μL, and the sample volume after splitting is half of that in the instructions).
[0103] 3. Sample loading volume: 2.5 μL of spotted golden apple snail DNA template at a concentration of 68.28 ng / μL, 1 μL of upstream primer, 1 μL of downstream primer, and 0.3 μL of fluorescent probe;
[0104] 4. Amplification conditions: Incubate at a constant temperature of 40℃ for 20 min;
[0105] 5. Collect fluorescence images of the product and obtain amplification images;
[0106] 6. Experimental Results: The results are as follows Figure 8-10 As shown, from Figure 8 It can be seen that the fluorescence image taken with 2F2R+p is the brightest; from Figure 9 and Figure 10 Based on the orthogonal and reciprocal amplification curves, the 2F2R+p combination showed the best amplification effect. Therefore, considering all factors, the 2F2R+p combination is the optimal choice.
[0107] (ii) Temperature gradient screening
[0108] 1. Sample: Spotted golden apple snail tissue sample with DNA concentration of 68.28 ng / μL, ddH2O (negative control);
[0109] 2. Reagent kit: DNA isothermal rapid amplification kit (basic type)-II, AMP Future; It should be noted that the MIRA detection system in this example is prepared according to the instructions of the DNA isothermal rapid amplification kit (basic type)-II, with a reaction volume of 25 μL (the instructions say 50 μL, and the sample volume after splitting is half of that in the instructions).
[0110] 3. Sample loading volume: 2.5 μL of spotted golden apple snail DNA template at a concentration of 68.28 ng / μL, 1 μL of upstream primer, 1 μL of downstream primer, and 0.3 μL of fluorescent probe (2F2R+p).
[0111] 4. Amplification conditions: 38℃, 39℃, 40℃, 41℃, 42℃, 43℃; amplification time: 20 minutes;
[0112] 5. Collect fluorescence images of the product and obtain amplification images;
[0113] 6. Experimental Results: The amplification diagram is shown below. Figure 11 As shown, the fluorescence pattern is as follows: Figure 12 As shown, from Figure 11-12 It can be seen that when the amplification temperatures are 39℃, 41℃, and 42℃, the negative control curve is stable, and the positive sample is in the exponential growth phase. Taking all factors into consideration, 42℃ is determined to be the optimal amplification temperature.
[0114] (III) Cycle Time Filtering
[0115] 1. Sample: Spotted golden apple snail tissue sample with DNA concentration of 68.28 ng / μL; ddH2O (negative control);
[0116] 2. Reagent kit: DNA isothermal rapid amplification kit (basic type)-II, AMP Future; It should be noted that the MIRA detection system in this example is prepared according to the instructions of the DNA isothermal rapid amplification kit (basic type)-II, with a reaction volume of 25 μL (the instructions say 50 μL, and the sample volume after splitting is half of that in the instructions).
[0117] 3. Sample loading volume: 2.5 μL of spotted golden apple snail DNA template at a concentration of 68.28 ng / μL, 1 μL of upstream primer, 1 μL of downstream primer, and 0.3 μL of fluorescent probe (2F2R+p).
[0118] 4. Amplification conditions: Set reaction time gradients of 4 min, 8 min, 12 min, 16 min, and 20 min; Temperature: 42℃;
[0119] 5. Collect fluorescence signals every 30 seconds;
[0120] 6. Experimental Results: The results are as follows Figure 13 As shown, from Figure 13 As can be seen, a significant fluorescence signal can be detected when the amplification time is 4 minutes. Therefore, in urgent situations, results can be obtained after 4 minutes of amplification. However, if the sample concentration is low, such as an environmental DNA sample, it is still advisable to ensure that the amplification time is 20 minutes.
[0121] (iv) Specificity
[0122] 1. Samples: Positive sample PC-yang (DNA concentration 68.28 ng / µL), Pomacea canaliculata tissue sample PC-60 (DNA concentration 68.28 ng / µL), Pomacea canaliculata tissue sample PC-nang (DNA concentration 70.47 ng / µL), Pomacea canaliculata tissue sample PC-xiao (DNA concentration 86.33 ng / µL), Pomacea canaliculata tissue sample PC-tian (DNA concentration 76.14 ng / µL), Pomacea canaliculata tissue sample PC-shi (DNA concentration 68.41 ng / µL), Pomacea canaliculata tissue sample PC-ying (DNA concentration 70.13 ng / µL), first water sample PC-shui-1 (PC-shui1) (total DNA concentration in water sample 29.3 ng / µL), second water sample PC-shui-2 (PC-shui2) (total DNA concentration in water sample 16.1 ng / µL), third water sample PC-shui-3 (PC-shui3) (total DNA concentration in water sample 8.5 ng / µL). ng / µL), the fourth water sample PC-shui-4 (PC-shui4) (the total DNA concentration in the water sample was 4.7 ng / µL), and the negative sample Negative (ddH2O);
[0123] 2. Reagent kit: DNA isothermal rapid amplification kit (basic type)-II, AMP Future; It should be noted that the MIRA detection system in this example is prepared according to the instructions of the DNA isothermal rapid amplification kit (basic type)-II, with a reaction volume of 25 μL (the instructions say 50 μL, and the sample volume after splitting is half of that in the instructions).
[0124] 3. Sample volume: 2.5 μL of the above sample, 1 μL of upstream primer, 1 μL of downstream primer, and 0.3 μL of fluorescent probe (2F2R+p);
[0125] 4. Amplification conditions: Amplification temperature set at 42℃; cycle number: 40; fluorescence signal collected every 30 seconds;
[0126] 5. Collect fluorescence images of the product and obtain amplification images;
[0127] 6. Experimental Results: The amplification diagram is shown below. Figure 14 As shown, the fluorescence pattern is as follows: Figure 15As shown, when the amplification temperature is 42℃ and the time is 20 min, the amplification curves of positive samples and Pomacea canaliculata tissue samples show obvious exponential growth and fluorescence. However, water samples cannot be detected. That is, the basic method of this invention can detect Pomacea canaliculata through water samples, while the fluorescence method cannot. The reason may be that the eDNA extracted from water samples under field conditions may contain other impurities such as salt, which may interfere with probe binding and prevent fluorescence. For the basic method, gel electrophoresis is not affected by other impurities, so even at low concentrations, bands can be displayed under suitable conditions. Therefore, when it is necessary to quarantine Pomacea canaliculata through water samples, the basic method can be used. When rapid detection is required, the fluorescence method using Pomacea canaliculata tissue can be given priority, and the quarantine results can be obtained in as little as 4 minutes.
[0128] (v) Screening with the lowest detection limit
[0129] Detection limit based on plasmid concentration
[0130] 1. Sample: Plasmid concentration is 10 2 Sample concentration of ng / µL, plasmid concentration of 10 1 Sample concentration of ng / µL, plasmid concentration of 10 0 Sample concentration of ng / µL, plasmid concentration of 10 -1 Sample concentration of ng / µL, plasmid concentration of 10 -1 Sample concentration of ng / µL, plasmid concentration of 10 -2 Sample concentration of ng / µL, plasmid concentration of 10 -3 Sample concentration of ng / µL, plasmid concentration of 10 -4 Sample concentration of ng / µL, plasmid concentration of 10 -5 Sample concentration of ng / µL, plasmid concentration of 10 -6 Sample concentration of ng / µL, plasmid concentration of 10 -7 Sample concentration of ng / µL, plasmid concentration of 10 -8 Sample concentration of ng / µL, plasmid concentration of 10 -9 Sample concentration of ng / µL, plasmid concentration of 10 -10 The sample with ng / µL was negative (ddH2O).
[0131] 2. Reagent kit: DNA isothermal rapid amplification kit (basic type)-II, AMP Future; It should be noted that the MIRA detection system in this example is prepared according to the instructions of the DNA isothermal rapid amplification kit (basic type)-II, with a reaction volume of 25 μL (the instructions say 50 μL, and the sample volume after splitting is half of that in the instructions).
[0132] 3. Sample volume: 2.5 μL of the above sample, 1 μL of upstream primer, 1 μL of downstream primer, and 0.3 μL of fluorescent probe (2F2R+p).
[0133] 4. Amplification conditions: Amplification temperature set at 42℃; fluorescence signal collected every 30 seconds, amplification for 20 minutes;
[0134] 5. Collect fluorescence images of the product;
[0135] 6. Experimental Results: The results are as follows Figure 16 As shown, from Figure 16 It can be seen that the limit of detection for plasmid concentration when using fluorescence method to detect Pomacea canaliculata is 1 x 10⁻⁶. -8 .
[0136] The embodiments described above merely illustrate specific implementation methods of this application, and while the descriptions are detailed and specific, they should not be construed as limiting the scope of protection of this application. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the technical solution of this application, and these modifications and improvements all fall within the scope of protection of this application.
Claims
1. A primer set for detecting Pomacea canaliculata, characterized in that: The MIRA detection primer composition comprises: Upstream primer: 5'-ATAGATCTACAGTCTATCGCTTAAAACTCAGC-3'; Downstream primer: 5'-TGATTCCTTAAGGAAGACTATTTCTTCTAG-3'.
2. The detection primer set for *Pomacea canaliculata* according to claim 1, characterized in that: It also includes fluorescent probes: 5'-ATATGACAATACCCTCTAAAGATTTCTTA[FAMdT]C[THF][BHQ1dT]AGAATTTGCAATTCTA-[3'C3spacer].
3. A method for detecting spotted golden apple snails, characterized in that: Includes the following steps: S1: Add the DNA sample to be tested to the MIRA amplification system, wherein the MIRA amplification system includes the spot golden apple snail detection primer set as described in any one of claims 1-2; S2: Amplify at 37-42℃ for at least 4 minutes to obtain amplification products, and determine whether it is Pomacea canaliculata based on the amplification products.
4. The method for detecting Pomacea canaliculata according to claim 3, characterized in that: The DNA sample to be tested comes from biological tissue or water samples from which organisms live.
5. The method for detecting Pomacea canaliculata according to claim 3, characterized in that: The amplification temperature is 40℃ or 42℃.
6. The method for detecting Pomacea canaliculata according to claim 3, characterized in that: The amplification products obtained in S2 were used to determine whether they were Pomacea canaliculata by gel electrophoresis, fluorescence method, and colloidal gold method.
7. A reagent kit, characterized in that: It includes the spotted golden apple snail detection primer set as described in any one of claims 1-2.
8. The application of a primer set for detecting Pomacea canaliculata as described in any one of claims 1-2 or the detection method for Pomacea canaliculata as described in any one of claims 3-6 in the identification of Pomacea canaliculata.
Citation Information
Patent Citations
TaqMan real-time fluorescent quantitative PCR probe and primer combination for identifying ampullaria gigas, kit and application of TaqMan real-time fluorescent quantitative PCR probe and primer combination
CN120442820A
Specific primer for rapid identification of non-indigenous organism apple snail, multiplex PCR detection kit and detection method thereof
CN108588243A
Specific primer combination, kit thereof and application of specific primer combination in detection of ampullaria gigas
CN116716413A