A plant constitutive promoter osSULTR2;2pro and application thereof

Abstract

This invention belongs to the field of agricultural biotechnology, specifically relating to a plant constitutive promoter OsSULTR2;2pro and its applications. The nucleotide sequence of the promoter OsSULTR2;2pro is shown in SEQ ID NO.1. The promoter OsSULTR2;2pro of this invention is an endogenous constitutive promoter for rice, capable of driving efficient and stable expression of target genes in plant callus tissue, roots, stems, leaves during vegetative growth, as well as young panicles and seeds, and can replace existing non-plant-derived promoters. It has significant application value in the field of plant genetic engineering and can effectively reduce the potential safety risks of transgenic plants caused by the introduction of exogenous DNA.

Description

A plant constitutive promoter OsSULTR2;2pro and its applications Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a plant constitutive promoter OsSULTR2;2pro and its applications. Background Technology

[0002] As key DNA sequences regulating gene transcription, promoters are the core regions where RNA polymerase specifically recognizes, binds to, and initiates transcription. They contain conserved elements essential for transcription initiation, are mostly located upstream of the transcription start site of structural genes, and do not participate in the transcription process themselves. Based on gene expression regulation patterns, promoters can be classified into three types: constitutive, inducible, and spatiotemporally specific. Constitutive promoters, because they can continuously initiate gene transcription in all or most plant tissues, ensure the spatiotemporal stability and constancy of target gene expression, playing an irreplaceable role in plant genetic engineering.

[0003] Currently, the most widely used constitutive promoters in plant transgenic operations are the cauliflower floret virus promoter (CaMV35Spro) and the maize polyubiquitin protein gene promoter (ZmUbipro). However, CaMV35Spro is derived from a plant DNA virus, and its heterologous viral origin raises concerns about biosafety. Although ZmUbipro is a plant-derived promoter, frequent repetition of its use in multi-gene transformation systems can trigger homology sequence-dependent transgene silencing, leading to a decrease in the expression efficiency of the target gene. Therefore, discovering novel and highly efficient plant-derived constitutive promoters, especially those with both low biosafety risks and stable transcriptional activity, has become a key requirement for overcoming existing transgenic technology bottlenecks and promoting the sustainable development of plant genetic engineering. Summary of the Invention

[0004] The purpose of this invention is to discover and verify a safe and efficient constitutive promoter derived from rice, in order to overcome the limitations of existing transgenic promoters in terms of safety and application effectiveness.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] The first aspect of this invention provides a plant constitutive promoter OsSULTR2;2pro, the nucleotide sequence of which is shown in SEQ ID NO.1. This promoter can be efficiently amplified using the primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3.

[0007] The second aspect of this invention provides biomaterials related to the plant constitutive promoter OsSULTR2;2pro:

[0008] 1) An expression cassette containing the promoter OsSULTR2;2pro.

[0009] In this embodiment, the present inventors constructed an expression cassette OsSULTR2;2pro-GUS-nosT containing this promoter. The expression cassette also includes a functional gene and a terminator, with the nucleotide sequence shown in SEQ ID NO.4. The structures within the expression cassette are functionally linked to each other in the transcriptional direction.

[0010] 2) Recombinant vectors containing the promoter OsSULTR2;2pro or the expression cassette described above.

[0011] In an embodiment, the present inventors inserted the above-mentioned promoter or expression cassette between the HindIII and NcoI double restriction sites of the 1305gusplus vector to construct the recombinant vector 1305gusplus-OsSULTR2;2pro-1589.

[0012] 3) Recombinant microorganisms containing the promoter OsSULTR2;2pro, the expression cassette, or the recombinant vector.

[0013] 4) Transgenic plant cell lines containing the promoter OsSULTR2;2pro, the expression cassette, or the recombinant vector.

[0014] The third aspect of this invention provides any of the following applications of the plant constitutive promoter OsSULTR2;2pro and the aforementioned related biomaterials:

[0015] 1) Application in the preparation of transgenic plants;

[0016] 2) Application of driving the expression of exogenous genes in plant callus and / or tissues and / or reproductive organs during the vegetative growth stage;

[0017] The exogenous gene is the GUS gene; the plants include rice, corn, and wheat;

[0018] When the plant is rice, the GUS gene is expressed in callus tissue, seedling roots, seedling stems, roots at the heading stage, stems at the heading stage, leaves at the heading stage, anthers at the heading stage, and grains 15 days after grain filling.

[0019] When the plant is maize, the GUS gene is expressed in callus tissue, seedling leaves, roots during the tasseling stage, stems during the tasseling stage, leaves during the tasseling stage, anthers during the tasseling stage, and grains 30 days after grain filling.

[0020] When the plant is wheat, the GUS gene is expressed in callus tissue, seedling leaves, roots during the heading stage, stems during the heading stage, leaves during the heading stage, anthers during the heading stage, and grains 30 days after grain filling.

[0021] Furthermore, the application is to construct the OsSULTR2;2pro promoter into a vector and then introduce it into a plant to prepare a transgenic plant; or to introduce the biological material into a plant to prepare a transgenic plant.

[0022] Furthermore, the application is to introduce target DNA operatively linked to the aforementioned OsSULTR2;2pro promoter into plants.

[0023] Furthermore, after obtaining the transgenic plants, they are screened using marker genes.

[0024] As a preferred embodiment, the present invention provides a method for preparing transgenic rice, comprising:

[0025] The vector containing the OsSULTR2;2pro promoter was transformed into rice callus using Agrobacterium-mediated transformation.

[0026] Rice seedlings were obtained by resistance screening and differentiation of the rice callus tissue;

[0027] Transgenic rice was obtained by rooting the rice seedlings.

[0028] Furthermore, the rice callus tissue was prepared by the following method:

[0029] After the rice seeds are dehulled and disinfected, the mature embryos are inoculated into an induction medium to induce embryogenic callus tissue, and cultured in the dark at 28-30℃ for 30-50 days.

[0030] Furthermore, after transforming the plant constitutive promoter OsSULTR2;2pro into rice callus, co-culture is also included, wherein the co-culture is carried out in the dark at 22-24°C until bacterial cells appear on the surface of the callus.

[0031] Furthermore, the resistance screening involves inoculating co-cultured callus tissue into a screening medium supplemented with hygromycin, and incubating it in the dark at 28-30°C for 30-50 days to perform resistance screening.

[0032] Furthermore, the differentiation involves adding the resistance-selected callus tissue to a differentiation medium supplemented with hygromycin and culturing it under light at 28-30°C for 25-40 days.

[0033] Furthermore, the rooting culture involves inoculating rice seedlings onto a rooting medium supplemented with hygromycin and cultivating them under light at 30-32°C for 5-20 days.

[0034] Furthermore, after rooting culture, including PCR testing, plants that test positive are selected for planting.

[0035] The beneficial effects of this invention are:

[0036] (1) The present invention screened a plant constitutive promoter OsSULTR2;2pro, which is derived from rice. It can drive the gene to be expressed efficiently in the callus tissue, major functional tissues (roots, leaves, flowers, seedlings, young spikes, etc.) or reproductive organs of rice.

[0037] The promoter OsSULTR2;2pro provided by this invention can be combined with endogenous or exogenous plant selection marker genes to form a plant transgenic selection expression cassette or a plant genetic transformation selection vector, and other functional elements can be added for plant tissue culture or plant genetic transformation, providing an effective tool and method for screening plant genetic transformation.

[0038] (2) The primer pair provided by the present invention can efficiently amplify the OsSULTR2;2pro promoter of the target gene.

[0039] (3) The biomaterials provided by the present invention can improve the efficiency of vector construction and genetic transformation.

[0040] (4) The promoter OsSULTR2;2pro provided by this invention can also drive the gene to be expressed efficiently in the main functional tissues of the aboveground and underground parts during the vegetative growth period of the transformed seedling. In addition, the promoter OsSULTR2;2pro is an endogenous gene of the plant, and no exogenous gene fragments such as bacteria are introduced during the transgenic process. This not only enriches the promoter resources for plant transgenics, but also effectively reduces the potential safety risks of transgenic plants caused by exogenous genes and the public's concerns about the safety of transgenic plants. It is conducive to the commercial application of transgenic plants and has good market value and social benefits. Attached Figure Description

[0041] Figure 1 shows the agarose gel electrophoresis results provided in Example 2 of the present invention;

[0042] In this context, a and b represent the amplified fragment of the promoter OsSULTR2;2pro-1589 and the digested fragment of the vector 1305gusplus, respectively.

[0043] Figure 2 is a vector map of the 1305gusplus vector provided in Embodiment 2 of the present invention.

[0044] Figure 3 is an electrophoresis diagram of the 1305gusplus-OsSULTR2;2pro-1589 vector provided in Example 2 of the present invention after digestion with HindIII and NcoI enzymes;

[0045] Where M is the Marker, ck1 is the undigested 1305gusplus-OsSULTR2;2pro-1589 recombinant plasmid, and 1 is the digested 1305gusplus-OsSULTR2;2pro-1589 recombinant plasmid.

[0046] Figure 4 is a vector map of the 1305gusplus-OsSULTR2;2pro-1589 vector provided in Embodiment 2 of the present invention.

[0047] Figure 5 shows the PCR detection electrophoresis results of Agrobacterium after transformation provided in Example 3 of the present invention; where M is the Marker, ck+ is the positive control of the 1305gusplus-OsSULTR2;2pro-1589 recombinant plasmid, and 1-3 are samples of Agrobacterium monoclonal bacterial culture transformed with the 1305gusplus-OsSULTR2;2pro-1589 recombinant plasmid.

[0048] Figure 6 is a schematic diagram of the results of screening callus tissue using the hygromycin screening medium provided in Example 3 of the present invention.

[0049] Among them, WT is a schematic diagram of hygromycin screening of Zhonghua 11 callus, and 1305gusplus-OsSULTR2;2pro-1589 is a schematic diagram of hygromycin screening of 1305gusplus-OsSULTR2;2pro-1589 converted to Zhonghua 11 callus.

[0050] Figure 7 is an electrophoresis diagram of PCR detection of transgenic sample plants provided in Example 3 of the present invention; where M is the marker, H2O is the blank control, ck- is the genomic DNA of non-transgenic plants of Zhonghua 11, ck+ is the positive control of 1305gusplus-OsSULTR2;2pro-1589 recombinant plasmid, and 1-7 are the genomic DNA of transgenic plants obtained by screening.

[0051] Figure 8 shows the GUS staining results of callus, seedlings (roots and stems), heading stage (roots, stems, leaves, and anthers), and grains 15 days after grain filling of the T0 generation transgenic line of the 1305gusplus-OsSULTR2;2pro-1589 plasmid provided in Experimental Example 1 of this invention.

[0052] Among them, Ck- represents the staining results of the negative control (Zhonghua 11) at each developmental stage, and 1305gusplus-OsSULTR2;2pro-1589 represents the staining results of the 1305gusplus-OsSULTR2;2pro-1589 transgenic line. Detailed Implementation

[0053] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0054] Unless otherwise specified, the experimental methods described in the following examples are conventional methods. Unless otherwise specified, the materials and reagents described in the following examples are commercially available.

[0055] Explanation of the sequence list:

[0056]

[0057] SEQ ID NO.2: 1305-OsSULTR2;2pro-F

[0058] gacctgcaggcatgcaagcttTGTCCGCGGCTTATCTCACCA

[0059] SEQ ID NO.3: 1305-OsSULTR2;2pro-R

[0060] ctcagatctaccatggTGCTCAGCACGAGCCTGG

[0061] SEQ ID NO.4: Transgenic expression cassette OsSULTR2;2pro-GUS-nosT

[0062]

[0063] SEQ ID NO.5:1305-OsSULTR2;2pro-test-F

[0064] TTCAGTAGCTGCTACTGTAG

[0065] SEQ ID NO.6:1305-OsSULTR2;2pro-test-R

[0066] Cacgaccagctcaccattga

[0067] SEQ ID NO.7:Hn-F

[0068] Gatcggacgattgcgtcgca

[0069] SEQ ID NO.8:Hn-R

[0070] Acaaccggtcgcggaggcta

[0071] SEQ ID NO.9:GUS genetic clone

[0072]

[0073] SEQ ID NO.10: nosT terminator sequence

[0074] gatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacg ttatttatgagatgggttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttatactagatc

[0075] Example 1

[0076] In this embodiment, bioinformatics analysis of the upstream sequence of the OsSULTR2;2 gene using promoter function prediction software PlantCARE and PlantPAN revealed that the sequence is rich in various promoter-related cis-acting elements, such as TATA-box and CAAT-box, indicating that the sequence possesses structural characteristics of plant cell promoters. Furthermore, PlantPAN analysis showed that the sequence from 1bp to 1589bp is rich in CpG islands, which are also a sequence characteristic of eukaryotic promoters; therefore, this invention hypothesizes that this sequence should possess promoter activity.

[0077] In this embodiment, the upstream sequence of the OsSULTR2;2 gene, 1589 bp, was further extracted for promoter activity identification. Finally, the sequence shown in SEQ ID NO.1 was selected as the promoter sequence and named OsSULTR2;2pro. The OsSULTR2;2pro promoter can drive the gene to be expressed efficiently in the callus tissue and the main tissues during the vegetative growth stage of rice.

[0078] The promoter OsSULTR2;2pro can be amplified using the following primers:

[0079] The amplification primer sequences for the promoter shown in SEQ ID NO.1 are as follows:

[0080] SEQ ID NO.2: 5'-gacctgcaggcatgcaagcttTGTCCGCGGCTTATCTCACCA-3';

[0081] SEQ ID NO. 3: 5'-ctcagatctaccatggTGCTCAGCACGAGCCTGG-3'.

[0082] Example 2

[0083] In this embodiment, the promoter OsSULTR2;2pro is constructed into the expression cassette and vector. The specific process is as follows:

[0084] 1. Preparation of plant transgenic expression cassettes containing the promoter OsSULTR2;2pro

[0085] The method for constructing the plant transgenic expression cassette OsSULTR2;2pro-GUS-nosT (sequence as shown in SEQ ID NO.4) of the present invention is as follows:

[0086] Primers 1305-OsSULTR2;2pro-F / 1305-OsSULTR2;2pro-R were designed to amplify the promoter OsSULTR2;2pro-1589 fragment from the rice genome. Primer 1305-OsSULTR2;2pro-F has a 20-nucleotide repeat at its 5' end with the corresponding ligation site in the vector; primer 1305-OsSULTR2;2pro-R has a 17-nucleotide repeat at its 5' end with the corresponding ligation site in the vector, facilitating subsequent recombination and ligation using the ClonExpress II One Step Cloning Kit.

[0087] The primer sequences are as follows:

[0088] 1305-OsSULTR2;2pro-F:5'-gacctgcaggcatgcaagcttTGTCCGCGGCTTATCTCACCA-3' (SEQ ID NO.2);

[0089] 1305-OsSULTR2;2pro-R: 5'-ctcagatctaccatggTGCTCAGCACGAGCCTGG-3' (SEQ ID NO. 3).

[0090] The PCR amplification reaction system is as follows:

[0091] Table 1 PCR amplification reaction system

[0092]

[0093] The PCR amplification program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55-65℃ annealing for 30 s, 72℃ extension for 5 min, 35 cycles; 68℃ extension for 10 min, 16℃ end.

[0094] The PCR product amplified by primers 1305-EPSPSpro-F and 1305-OsSULTR2;2pro-R was the EPSPSpro-1589 fragment, which was recovered by 1.0% agarose gel electrophoresis as a product of size 1589bp (the result is shown in Figure 1a).

[0095] 2. Construction of plant genetic transformation vectors

[0096] Using the ClonExpress II One Step Cloning Kit, the amplification product from step 1 was inserted into the 1305gusplus vector (vector map shown in Figure 2), between the HindIII and NcoI double restriction sites. The specific method is as follows:

[0097] (1) The vector plasmid 1305gusplus was double-digested with HindIII+NcoI. After agarose gel electrophoresis, a band of about 11 kb was recovered using EZNA® Gel Extraction kit (Omega, the same below) to obtain the linear fragment of 1305gusplus.

[0098] The BamHI+NcoI double enzyme digestion reaction system is as follows:

[0099] Table 2 Enzyme digestion reaction system

[0100]

[0101] The enzyme digestion results are shown in Figure 1c.

[0102] (2) The ClonExpress II One Step Cloning Kit was used to ligate the OsSULTR2;2pro-1589 fragment into the 1305gusplus vector. The ligation system is as follows:

[0103] Table 3 Connection System

[0104]

[0105] Connection procedure: 37℃, 30min.

[0106] (3) Transformation: Take 10 μl of the ligation product from step (2) and add it to 100 μl of competent E. coli cells. Mix lightly and incubate on ice for 30 min. Heat shock at 42℃ for 90 s. Incubate in an ice-water bath for 2 min. Add 900 μl of SOC medium and culture at 37℃ and 220 rpm for 1 h. Centrifuge at 5000 rpm for 30 s, discard 900 μl of supernatant, mix the remaining cells with the medium, and spread them on LB plates containing kanamycin. After incubation at 37℃ for approximately 16 hours, single colonies were picked and colony PCR was performed using specific primers (1305-OsSULTR2;2pro-test-F and 1305-OsSULTR2;2pro-test-R). Positive colonies were selected, and the colonies were incubated overnight at 37℃ and 220 rpm. Plasmids were extracted using a high-purity plasmid miniprep kit (Zhongke Ruitai). After successful enzyme digestion (the results are shown in Figure 3, where M is the marker, ck1 is the undigested 1305gusplus-OsSULTR2;2pro-1589 recombinant plasmid, and 1 is the digested 1305gusplus-OsSULTR2;2pro-1589 recombinant plasmid, yielding a fragment of approximately 1589 bp), the strain was preserved and sent for sequencing. The resulting vector was named 1305gusplus-OsSULTR2;2pro-1589, and its vector map is shown in Figure 4.

[0107] Primer sequences:

[0108] 1305-OsSULTR2;2pro-test-F: 5'-TTCAGTAGCTGCTACTGTAG-3' (SEQ ID NO.5);

[0109] 1305-OsSULTR2;2pro-test-R: 5'-cacgaccagctcaccattga-3' (SEQ ID NO. 6).

[0110] Example 3

[0111] In this embodiment, the OsSULTR2;2pro promoter is transformed into plants to prepare the corresponding transgenic plants. The specific process is as follows:

[0112] 1. Agrobacterium transformation and identification

[0113] Take Agrobacterium EHA105 competent cells stored at -80℃, add 1 μl of the sequenced plasmid 1305gusplus-OsSULTR2;2pro-1589 obtained in Example 2, and transform by electroporation at 2.5 KV. The culture was spread on YEP plates containing kanamycin, rifampin, and streptomycin and incubated at 28°C for approximately 48 hours. Single colonies were picked and shaken overnight. PCR verification was performed using specific primers (1305-OsSULTR2;2pro-test-F / 1305-OsSULTR2;2pro-test-R) (the results are shown in Figure 5, where M is the marker, ck+ is the positive control for the 1305gusplus-OsSULTR2;2pro-1589 recombinant plasmid, and 1-3 are samples of Agrobacterium monoclonal culture transformed with the 1305gusplus-OsSULTR2;2pro-1589 recombinant plasmid, with an amplified band size of 560 bp or higher, which is correct). Approximately 560 bp of the target fragment was amplified. Positive clones (engineered Agrobacterium) were selected, shaken for 36-48 hours, and the culture was preserved for infection.

[0114] 2. Agrobacterium-mediated genetic transformation

[0115] (1) Induction: After disinfecting with sodium hypochlorite, the seeds of Zhonghua 11 were placed on induction medium (N6 + 2,4-D 3mg / L + CH 0.6g / L + Pro 0.5g / L + sucrose 30g / L + Phytagel 3 g / L) and cultured in the dark at room temperature at 28℃ for 30-40 days. The induced callus was then subcultured for 30-40 days.

[0116] (2) Screening: The engineered Agrobacterium obtained in step 1 was transformed into the callus obtained in (1) by Agrobacterium-mediated genetic transformation. After co-culturing for 3 days, the callus was washed 5-6 times and transferred to a selection medium containing 50 mg / L hygromycin. The callus was cultured in the dark at 30°C for 30-50 days. The results are shown in Figure 7. The callus infected with Agrobacterium 1305gusplus-OsSULTR2;2pro-1589 can be screened to obtain resistant callus.

[0117] (3) Differentiation: The resistant callus obtained by screening was transferred to a differentiation medium containing 50 mg / L hygromycin and positive seedlings were obtained after 25-30 days of differentiation;

[0118] (4) Rooting: Positive seedlings obtained after differentiation were transferred to a rooting medium containing 50 mg / L hygromycin. After 7-15 days of rooting, positive transgenic plants were finally obtained.

[0119] (5) Hardening off and transplanting: Open the bottle cap of the transformed strain with vigorous root growth, add sterile water to cover the culture medium 1-2 cm thick, place it at room temperature to contact with air for hardening off for 2-3 days, and then transplant it to the greenhouse for cultivation.

[0120] 3. Identification of transgenic lines

[0121] To identify whether the lines obtained in step 2 are transgenic lines, this embodiment performs PCR verification on some positive transgenic plants obtained through screening culture, differentiation culture and rooting culture.

[0122] First, extract DNA from the sample. The DNA extraction steps are as follows: Take a rice leaf about 2 cm long and place it in a 2 ml centrifuge tube; add 800 μl of 1.5×CTAB to a mortar and grind the leaf into a homogenate and pour it back into the centrifuge tube; incubate at 65℃ for 20-30 min, inverting and mixing once every 5 min; centrifuge at 12000 rpm for 10 min; transfer 400 μl of supernatant to a new centrifuge tube, add 2 volumes of ice-cold anhydrous ethanol, and incubate at -20℃ for 20 min; centrifuge at 12000 rpm for 10 min; discard the supernatant, add 500 μl of 75% ethanol, invert and rinse, centrifuge at 8000 rpm for 5 min; discard the supernatant, place in a clean bench to air dry or air dry naturally, and add 100 μl of lddH2O to dissolve the DNA.

[0123] The genomic DNA samples of the transgenic line were amplified by PCR using hygromycin primers (Hn-F / Hn-R). This primer pair could not amplify the fragment using the endogenous rice genome as a template, but the fragment size obtained by amplification using transgenic seedlings was 561 bp.

[0124] The primer sequences are as follows:

[0125] Hn-F: 5'-Gatcggacgattgcgtcgca-3' (SEQ ID NO.7);

[0126] Hn-R: 5'-acaaccggtcgcggaggcta-3' (SEQ ID NO. 8).

[0127] Genomic DNA of Zhonghua 11 was used as a negative control, and water was used as a blank control. The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 60℃ annealing for 30 s; 72℃ extension for 5 min; 30-35 cycles; 72℃ further extension for 10 min; 16℃ final temperature.

[0128] The PCR reaction system is as follows:

[0129] Table 4 PCR reaction system

[0130]

[0131] The PCR products were subjected to agarose gel electrophoresis, and the results are shown in Figure 7. The results showed that most transgenic samples contained a 561 bp transgenic band, which was the same size as the vector control; while the blank control and negative control, Flower 11, could not amplify the band.

[0132] Experimental Example 1

[0133] This experimental example further analyzes the transgenic lines obtained in Example 3, as follows:

[0134] 1. GUS staining analysis of plant tissues

[0135] GUS staining analysis was performed using a GUS staining kit (Zhongke Ruitai, catalog number: RTU4032). Positive callus tissues showed obvious staining. GUS staining was performed on seedling leaves, heading stage (roots, stems, leaves, and anthers), and grains 15 days after grain filling. The results are shown in Figure 8. Figure 8 shows that the GUS gene expression level driven by the OsSULTR2;2pro-1589 promoter is high. The nucleotide sequence of the GUS gene is shown in SEQ ID NO.9.

[0136] 2. Tissue expression analysis in maize

[0137] Using a method similar to that used for rice in Example 3, transgenic maize plants were obtained. GUS staining of various tissues revealed that the selected positive callus tissue showed significant staining. GUS staining of seedling leaves, tasseling stage (roots, stems, leaves, anthers), and grains 30 days after grain filling all showed good staining. This indicates that the OsSULTR2;2pro-1589 promoter can stably drive GUS gene expression at the callus level, seedling leaves, tasseling stage (roots, stems, leaves, anthers), and grains 15 days after grain filling, making it a highly efficient constitutive promoter.

[0138] 3. Tissue expression analysis in wheat

[0139] Using a method similar to that used for rice in Example 3, transgenic wheat plants were obtained. GUS staining of various tissues revealed that the selected positive callus tissue showed significant staining. GUS staining of seedling leaves, heading stage (roots, stems, leaves, anthers), and grains 30 days after grain filling all showed good staining. This indicates that the OsSULTR2;2pro-1589 promoter can stably drive GUS gene expression at the callus level, seedling stage, mature leaves, heading stage (roots, stems, leaves, anthers), and 15 days after grain filling in wheat, making it a highly efficient constitutive promoter.

[0140] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. The application of a plant constitutive promoter OsSULTR2;2pro, characterized in that, The application is any one of the following: 1) application in the preparation of transgenic rice; 2) application in driving the expression of exogenous genes in rice callus, seedling roots, seedling stems, roots at the heading stage, stems at the heading stage, leaves at the heading stage, anthers at the heading stage, and grains at 15 days of grain filling; the exogenous gene is the GUS gene; the nucleotide sequence of the promoter OsSULTR2;2pro is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, In the application of this method in the preparation of transgenic rice, the GUS gene expression cassette is introduced into rice to obtain transgenic rice; in the GUS gene expression cassette, the promoter OsSULTR2;2pro drives the transcription of the GUS gene.

3. The application according to claim 1, characterized in that, The promoter OsSULTR2;2pro was amplified using the primer pair shown in SEQ ID NO. 2-3.

4. The application of biomaterials related to the promoter OsSULTR2;2pro described in claim 1, characterized in that, The application is any one of the following: 1) application in the preparation of transgenic rice; 2) application in driving the expression of a foreign gene in rice callus, seedling roots, seedling stems, roots at the heading stage, stems at the heading stage, leaves at the heading stage, anthers at the heading stage, and grains at 15 days of grain filling; the foreign gene is the GUS gene; the biological material is any one of the following A1) to A3): A1) an expression cassette containing the promoter OsSULTR2;2pro; A2) a recombinant vector containing the promoter OsSULTR2;2pro, or a recombinant vector containing the expression cassette of A1); A3) a recombinant microorganism containing the promoter OsSULTR2;2pro, or a recombinant microorganism containing the expression cassette of A1), or a recombinant microorganism containing the recombinant vector of A2).

Images