Application of tea tree transcription factor CsMYB26 in regulation and control of plant anthracnose resistance

By overexpressing the CsMYB26 gene in tea and tobacco to regulate the lignin synthesis pathway, the problem of insufficient resistance to anthracnose in tea trees was solved, thereby improving the disease resistance and ecological benefits of tea varieties.

CN121992013APending Publication Date: 2026-05-08ZHEJIANG FORESTRY UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
ZHEJIANG FORESTRY UNIVERSITY
Filing Date
2025-12-30
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Anthracnose in tea trees severely affects tea yield and quality. Traditional breeding methods are inefficient and lack effective genetic resources for breeding disease-resistant varieties.

Method used

By overexpressing the tea transcription factor CsMYB26 in the plant genome, especially by using Agrobacterium-mediated transient or stable overexpression of the CsMYB26 gene in tea and tobacco, the lignin synthesis pathway can be regulated, thereby enhancing the plant's resistance to anthracnose.

Benefits of technology

It significantly enhances plant resistance to anthracnose, provides a new molecular breeding approach, has stability and sustainability, reduces pesticide use, and has good ecological benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses application of a tea tree transcription factor CsMYB26 in regulation of plant anthracnose resistance, the regulation effect of the tea tree transcription factor CsMYB26 in plant anthracnose resistance is found and verified for the first time, the biological function of the tea tree transcription factor CsMYB26 as a disease-resistant related transcription factor is defined, and the problem that in the prior art, the function of the gene is understood insufficiently is solved; the CsMYB26 provided by the invention, as an important disease-resistant gene resource possibly having a general regulation effect, can be applied to anthracnose-resistant genetic improvement of tea trees and other plants, and provides an optimal candidate gene for molecular breeding of disease-resistant varieties; compared with the traditional technology depending on chemical prevention and control, the disease-resistant strategy based on the gene regulation and control level has higher stability and sustainability, is beneficial to reduction of the pesticide consumption, and has good ecological benefits and application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

(I) Technical Field

[0002] This invention belongs to the field of bioengineering technology, specifically relating to the application of tea transcription factor CsMYB26 in regulating plant resistance to anthracnose. (II) Background Technology

[0004] tea tree[ Camellia sinensis [(L.) O. Kuntze] belongs to the genus *Camellia* of the family Theaceae and is one of my country's most important leaf-based economic crops. After processing, tea leaves can be made into various types of tea, such as green tea, black tea, and oolong tea. These teas are not only popular domestically but also exported worldwide, becoming important commodities in international trade. Therefore, the quality and safety of tea have received widespread attention. [Bacteria of the genus *Anthracis* (*L.) O. Kuntze*) Colletotrichum Anthracnose, caused by fungi, is a common disease in tea gardens, seriously affecting tea yield and quality, leading to reduced tea production and harming the development of the tea economy. Therefore, selecting and planting highly resistant tea varieties to reduce the damage of anthracnose to tea trees, and thus improving tea quality and yield, is of great significance.

[0005] MYB (v-myb avian myeloblastosis viral oncogene homolog) transcription factors are one of the largest transcription factor families in plants. They bind to DNA through their DNA-binding domains (DBDs) and participate extensively in plant growth, development, secondary metabolism, and responses to abiotic stress. Based on the number of conserved MYB domains at the N-terminus, they can be classified into four types: 1R-MYB / MYB-related, R2R3 MYB, 3R-MYB (R1R2R3-MYB), and 4R-MYB. R2R3-MYB is unique to higher plants and plays a crucial role in regulating plant growth, development, and abiotic stress responses. The DBD domain consists of approximately 52 amino acid residues, forming a helix-turn-helix structure that can bind to specific DNA sequences, thereby regulating gene expression.

[0006] Tea trees are perennial woody plants. Breeding methods such as conventional hybridization and radiation mutagenesis are characterized by complex breeding procedures, long breeding cycles, and low breeding efficiency.

[0007] CsMYB26, an important member of the tea plant R2R3-MYB family, is primarily known for its role in regulating flavonoid metabolism. Studies have confirmed that CsMYB26 regulates flavonoid metabolism by recognizing... CsLAR The MYB response element in the promoter of the colorless anthocyanin reductase gene positively regulates the biosynthesis of catechins and proanthocyanidins, but its function in regulating plant disease resistance has not been reported. (III) Summary of the Invention

[0009] The purpose of this invention is to provide an application of the tea transcription factor CsMYB26 in regulating plant resistance to anthracnose. The CsMYB26 transcription factor enhances the disease resistance of tea trees by regulating the lignin synthesis pathway, providing a gene resource for breeding tea varieties with high anthracnose resistance, and has excellent potential application value.

[0010] The technical solution adopted in this invention is:

[0011] This invention provides an application of the tea transcription factor CsMYB26 in regulating plant resistance to anthracnose.

[0012] Furthermore, the plants include woody plants and herbaceous plants, including tea trees and tobacco.

[0013] Furthermore, the nucleotide sequence of the tea tree transcription factor CsMYB26 gene is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0014] Furthermore, the application involves overexpressing the tea tree transcription factor CsMYB26 in the plant genome, including transient overexpression and stable overexpression.

[0015] Furthermore, the overexpression involves linking the tea tree transcription factor CsMYB26 with the plant expression vector pCAMBIA2300 or pCAMBIAsuper1300, which has a 35S promoter, and then transferring it into the plant genome using Agrobacterium-mediated transformation or leaf disc method to enhance the plant's resistance to anthracnose.

[0016] The present invention also provides an application of the tea tree transcription factor CsMYB26 in improving plant resistance to anthracnose, wherein the application is to overexpress the tea tree transcription factor CsMYB26 in plant genes.

[0017] The present invention relates to CsMYB26 The gene sequence has been submitted to NCBI (GenBank accession number: PX609948) and published in the TPIA database (https: / / tpia.teaplants.cn / ) (TEA004608).

[0018] The transgenic technology system for tea plants is still immature, while Nicotiana benthamiana is a model plant in the field of plant biology research. Therefore, Agrobacterium-mediated transgenic technology can be used to overexpress [the desired plant species] in Nicotiana benthamiana. CsMYB26 Genes, and then study CsMYB26The biological function of genes in plant anthracnose resistance. Meanwhile, Agrobacterium-mediated transient gene overexpression systems in tea plants are becoming increasingly sophisticated; therefore, Agrobacterium-mediated transient gene overexpression technology can be used to transiently overexpress genes in tea leaves. CsMYB26 Genes, and then study CsMYB26 Biological function of the gene in tea plant resistance to anthracnose. Cloning and functional studies of the CsMYB26 gene provide valuable genetic resources for the breeding of superior new tea varieties.

[0019] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0020] This invention is the first to discover and verify the regulatory role of the tea transcription factor CsMYB26 in plant anthracnose resistance, clarifying its biological function as a disease resistance-related transcription factor and addressing the lack of understanding of this gene's function in existing technologies. Through transient overexpression experiments, it was confirmed that CsMYB26 expression effectively enhances plant resistance to anthracnose, providing new research ideas and experimental evidence for elucidating the molecular mechanisms of tea plant disease resistance. The CsMYB26 provided by this invention, as an important and potentially universally applicable disease resistance gene resource, can be applied to the genetic improvement of anthracnose resistance in tea and other plants, providing a preferred candidate gene for molecular breeding of disease-resistant varieties. Compared with traditional chemical control techniques, this invention's disease resistance strategy based on gene regulation is more stable and sustainable, helps reduce pesticide use, and has good ecological benefits and application prospects. (iv) Description of the attached drawings

[0022] Figure 1 In Example 2, the transient overexpression of tea leaf extract... CsMYB26 Gene expression detection graph.

[0023] Figure 2 The images show the identification of anthracnose resistance in tea leaves after transient overexpression in Example 2. A. Lesions on tea leaves after inoculation with Camellia anthracnose; B. Statistical analysis of lesion area; C. Detection of anthracnose biomass in tea leaves.

[0024] Figure 3 For example 3, the overexpression of the Nicotiana benthamiana strains OE-1 and OE-8 CsMYB26 Gene expression detection graph.

[0025] Figure 4 The images show the anthracnose resistance identification of the overexpressing Tobacco Benzoinus lines OE-1 and OE-8 in Example 3. A. Lesions on tobacco leaves after inoculation with Camellia anthracnose; B. Statistical analysis of lesion area.

[0026] Figure 5 The transcription factor CsMYB26 and cinnamyl alcohol dehydrogenase gene in Example 4 CsCAD1L Promoter region binding diagram. A. Yeast one-hybrid verification of transcription factor CsMYB26 and... CsCAD1L Gene promoter region interaction; B. Dual-luciferase reporter assay to verify the binding of transcription factor CsMYB26 to... CsCAD1L Gene promoter regions are activated and their expression is stimulated.

[0027] Figure 6 The image shows the lignin content detection in tea leaves and tobacco plants overexpressing Benedictine et Rhizoma Benedictinee during transient overexpression in Example 5. A. Lignin content in tea leaves during transient overexpression. CsCAD1L A. Gene expression level; B. Total lignin content in tea leaves after transient overexpression; C. In overexpression of Nicotiana benthamiana lines OE-1 and OE-8 CsCAD1L Gene expression level; D. Total lignin content in overexpressing Nicotiana benthamiana strains OE-1 and OE-8. (V) Detailed Implementation Methods

[0029] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0030] Unless otherwise specified, all examples are conducted in accordance with conventional experimental methods or the manufacturer's instructions.

[0031] The tea trees used in the following examples ( Camellia sinensis The variety is 'Longjing 43' ( Longjing43 LJ43); the tobacco is Benzoic tobacco ( Nicotiana benthamiana Camellia anthrax ( ); Camellia anthrax bacteria ( Colletotrichum camelliae ) strain is LS_19 (Differences in the Characteristics and Pathogenicity of Colletotrichum camelliae and C. fructicola Isolated from the Tea Plant Camellia sinensis (L.) O. Kuntze]), destroying anthrax bacteria ( Colletotrichum destructivumThe strain used was NX1-1 (Source: Jiang Chaoyang et al., Identification and Biological Characteristics of Grape Anthracnose Pathogen in Ningxia, Northwest Agriculture Journal, 2024); the yeast strain used in the yeast one-hybrid experiment was Y1H Gold; the yeast strain used in the transcription factor transcription activation experiment was Y2H Gold; pCAMBIA2300 and pCAMBIAsuper1300 are both commonly used expression vectors and are commercially available; pGADT7 and pABAi vectors are both commonly used yeast transformation vectors and are commercially available; pGreenⅡ-0800-Luc and pGreenⅡ-62-SK vectors are both commonly used vectors in dual-luciferase reporter experiments and are commercially available; Agrobacterium GV3101 is a commonly used strain, which is preserved in most molecular biology laboratories and is also commercially available.

[0032] The main reagents used in the following examples were: lignin content assay kit, kanamycin, rifampin, etc., purchased from Sangon Biotech (Shanghai) Co., Ltd.; Aureobasidin A (AbA), purchased from Beijing Coollabistech Co., Ltd.; plant / fungal DNA kit, purchased from Hangzhou Xinjing Bio-Reagent Development Co., Ltd.; RNA extraction kit, reverse transcriptase, ChamQ Universal SYBR qPCR Master Mix for real-time quantitative PCR, Phanta Max Super-Fidelity DNA Polymerase and 2×Rapid Tap Master Mix for PCR reactions, ClonExpress II One Step Cloning Kit for vector construction, plasmid extraction kit, gel extraction kit, etc., all purchased from Nanjing Novizan Biotechnology Co., Ltd. All other chemical reagents used in the examples were imported or domestically produced analytical grade reagents.

[0033] In the examples, the primers to be synthesized and the vectors to be sequenced were both provided by Zhejiang Shangya Biotechnology Co., Ltd.

[0034] Table 1. Composition of Hogland nutrient solution (mg / L)

[0035]

[0036] Example 1: Cloning and overexpression vector construction of tea transcription factor CsMYB26

[0037] 1. Primer design

[0038] Based on the CsMYB26 sequence disclosed in the NCBI (GenBank accession number: PX609948) and TPIA database (https: / / tpia.teaplants.cn / ) (TEA004608), its nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence encoding the protein is shown in SEQ ID NO.2. Two pairs of primers were designed: upstream primer F1 and downstream primer R1, and upstream primer F2 and downstream primer R2.

[0039] F1: 5'-CGAGCTGTACAAGGGATCCATGGGGAGGAGTCCATGCTGC-3';

[0040] R1: 5'-GGCATGCCTGCAGGTCGACTCATGGCCAGTCCTCAGAATC-3'.

[0041] F2: 5'-GATACACCAAATCGACTCTAGAATGGGGAGGAGTCCATGCTGC-3';

[0042] R2: 5'-AACGATCGGGGAAATTCGAGCTCTCATGGCCAGTCCTCAGAATC-3'.

[0043] SEQ ID NO.1

[0044] ATGGGGAGGAGTCCATGCTGCTCCAAGGAAGGACTGAACAGAGGAGCATGGACTGCTCTAGAAGATAGAATACTTGCAGCTTATATTAAAGCTCATGGAGAAGGCAAATGGAGAAACCTCCCAAAGAGAGCTGGTTTGAAGCGATGTGGTAAGAGTTGCAGGCTTAGATGGTTGAATTATCTTAGACCAGACATCAAAAGAGGTAACATATCCCATGATGAGGAAGAACTCATCATTAGACTCCATAAGCTTCTTGGCAACAGATGGTCTTTAATAGCTGGAAGGCTTCCGGGCCGAACAGACAATGAAATCAAAAACTATTGGAACACTACTTTGGGAAAGAAAGTGAAAGTTGGAGTTGGAGTTGGAGCAGGAACTGCTGACTCCTCTCCTCCAGAATCACCACAGAGTCCGACCGCAGTCAAGAAGAATAAATCTAATTCTAAAGCAAAAAGGCCAGCCACTGTCACTGATCGTAACCCCAAGAGCTCCTCGTCCTCCCAACCAAGGCTTGAAACCTCACCACCACCACCTGCTGCTATCCGAACCAAGGCTTTGAGATGCACCGCAGTTGTGGCCCCAGCAACTGACAGTAGTAGTCTCTTTATCAACAACCCAACAACAATTGAAAATCAAAGCCACTCCTCCAACTCCATAATATCAAAACCTCAGCCAGAAATGCAATATTGCACTACTACTCAACACCTCAAATATTCTCATGGCAAACAAGTACAAGAAGAAGAAATGGAAGAAGAAGAAGAAGAAGAACCATTCAAATTTGGCTGTCATGACTTTGAACTCCACAATTATGACGATACCTTGTTCAAGGACTGGACGCCTTGTGAGTTTCTTCATCATGACAATGCCACCATAGATCTTGGATATTTGGCATCCTTTCTTGATTCTGAGGACTGGCCATGA

[0045] 2. Construction of overexpression vector and Agrobacterium transformation

[0046] RNA was extracted from tea leaves using an RNA extraction kit, and then the extracted RNA was reverse transcribed into cDNA using reverse transcriptase.

[0047] Using tea leaf cDNA as a template, PCR amplification was performed using primers F1 / R1 to obtain... CsMYB26 Gene. The target gene was constructed into the plant expression vector pCAMBIA2300 with a 35S promoter using the ClonExpress II One Step Cloning Kit. The successfully constructed pCAMBIA2300-CsMYB26 was transformed into Agrobacterium GV3101 strain (CsMYB26-OE). Agrobacterium containing the empty plasmid pCAMBIA2300 was constructed as a control Agrobacterium (EV) using the same method.

[0048] Using tea leaf cDNA as a template, PCR amplification was performed using primers F2 / R2 to obtain... CsMYB26 Gene. The target gene was constructed into the plant expression vector pCAMBIAsuper1300 with a 35S promoter using the ClonExpress II One Step Cloning Kit. The successfully constructed pCAMBIAsuper1300-CsMYB26 was transformed into Agrobacterium GV3101 strain.

[0049] Example 2: Transient overexpression of the CsMYB26 gene in tea leaves

[0050] The Agrobacterium containing pCAMBIA2300-CsMYB26 constructed in Example 1 was inoculated into LB medium and cultured at 28°C and 200 rpm until OD. 600 The value is 0.5 ~ 0.8, and Agrobacterium suspension is obtained.

[0051] Tea tree branches from the current year were cultured in Hoagland's nutrient solution. Agrobacterium suspension (Example 1) was injected into the underside of the tea leaves using a sterile syringe, ensuring the entire leaf was saturated. Leaves injected with the control Agrobacterium suspension served as negative controls. After injection, the leaves were incubated in the dark at 25°C for 24 hours. Then, the upper surface of the leaves was scratched and inoculated with Camellia anthracnose mycelium. The size of the lesions was measured and photographed at 12, 24, 48, and 72 hours of incubation. Samples were stored at -80°C.

[0052] The sample was ground with liquid nitrogen, RNA was extracted and reverse transcribed, and qRT-PCR was performed using primers (RT-F1: 5'-CTCTTTATCAACAACCCAACA-3' / RT-R1: 5'-GAAACTCACAAGGCGTCC-3') to detect RNA. CsMYB26 Gene expression levels. Results are shown in [link to results]. Figure 1 It can be found CsMYB26 Gene expression levels significantly increased at 24 h and 72 h. The lesion area resulting from *Anthracis chinensis* inoculation at 24 h and 72 h was measured using ImageJ software; results are shown below. Figure 2 Figures A and B show that transient overexpression significantly reduced the area of ​​lesions on tea leaves; simultaneously, the biomass of *Camellia anthracnose* in the leaves was detected using DNA-based qRT-PCR, and the results are shown in Figure A. Figure 2 The figure shows that transient overexpression of the CsMYB26 gene in tea leaves significantly reduced the biomass of *Anthracnose cambogia*. This indicates that transient overexpression of the CsMYB26 gene in tea leaves significantly enhances resistance to *Anthracnose cambogia*.

[0053] Example 3: Construction and Disease Resistance Phenotypic Analysis of Tobacco Plants Overexpressing the CsMYB26 Gene

[0054] The pCAMBIAsuper1300-CsMYB26 vector successfully constructed in Example 1 was transformed into Agrobacterium GV3101 strain, and then transformed into wild-type Nicotiana benthamiana using the leaf disc method, yielding seeds of the T1 generation of transgenic tobacco. The pCAMBIAsuper1300 vector carries the kanamycin resistance gene; therefore, using kanamycin and PCR amplification of the target gene to screen and isolate transgenic tobacco lines can quickly obtain homozygous lines in the T2 generation.

[0055] Overexpression lines OE-1 and OE-8 were obtained through screening. Total RNA was extracted from wild-type, OE-1, and OE-8, and cDNA was synthesized by reverse transcription. The expression level of the CsMYB26 gene in the overexpression lines OE-1 and OE-8 was detected by qRT-PCR. Results are shown below. Figure 3 It can be seen that the CsMYB26 gene is highly expressed in both OE-1 and OE-8.

[0056] Wild-type, OE-1, and OE-8 tobacco seeds were sown in nutrient soil, and their growth status was observed after 5 weeks. Figure 4 In the A-type strain, there were no significant differences in growth phenotype between the wild-type, OE-1, and OE-8 lines. When *A. anthracnose* mycelium was inoculated onto tobacco leaves and cultured in the dark at 28°C for 3 days, significant differences in resistance were observed between the overexpression lines and the wild-type; specifically, wild-type lesions were larger, while lesions in the overexpression lines were significantly smaller. Figure 4 A and B. The results showed that overexpression of the CsMYB26 gene in tobacco could enhance the tobacco's resistance to anthrax.

[0057] Example 4: Interaction analysis between transcription factor CsMYB26 and downstream target gene CsCAD1L

[0058] 1. Inhibition of CsCAD1L gene by basidiomycin A

[0059] Genomic RNA was extracted from tea leaves and reverse transcribed into cDNA. Using this cDNA as a template, upstream primer F3 and downstream primer R3 were designed based on the upstream promoter sequence (-2.0 kb) of the CsCAD1L gene (GenBank accession number: PX609947), whose nucleotide sequence is shown in SEQ ID NO.3. The CsCAD1L gene promoter sequence was amplified by PCR. The target sequence (promoter) was then constructed into the pABAi vector using the ClonExpress II One Step Cloning Kit to obtain the pABAi-proCsCAD1L vector. The pABAi-proCsCAD1L vector was transformed into yeast strain Y1H Gold, plated on SD-Ura plates, and cultured in the dark at 30℃ for 3 days. The OD of the yeast culture was adjusted with 0.9% NaCl. 600 After reaching a concentration of 0.002, the yeast was spread onto SD-Ura plates (purchased from Beijing Coollab Technology Co., Ltd.) containing different concentrations of abamin A (AbA). The AbA concentrations were set at 0 ng / mL, 100 ng / mL, 150 ng / mL, 200 ng / mL, 500 ng / mL, 800 ng / mL, and 1000 ng / mL. Yeast growth was observed after incubation at 30℃ in the dark for 3 days. The results are as follows: Figure 5 As shown in Figure A, yeast did not grow on SD-Ura plates containing 200 ng / mL AbA, indicating that 200 ng / mL AbA can inhibit the self-activation of pABAi-proCsCAD1L.

[0060] F3: 5'-TTGAATTCGAGCTCGGTACCCACTTGGAGGAATAGGG-3';

[0061] R3: 5'-TCGACAGATCCCCGGGTACCATTAGACATACTCTTAATTACT-3'.

[0062] 2. Effects of transcription factor CsMYB26 on CsCAD1L

[0063] Based on the CsMYB26 gene sequence, upstream primer F4 and downstream primer R4 were designed. Using tea leaf cDNA as a template, the CsMYB26 gene was amplified by PCR. The target gene was then constructed into the pGADT7 vector using the ClonExpress II One Step Cloning Kit, creating the pGADT7-CsMYB26 vector. The pGADT7-CsMYB26 vector was transformed into the yeast strain Y1H Gold [pABAi-proCsCAD1L] containing pABAi-proCsCAD1L. The transformed yeast was plated on SD-Leu plates and SD-Leu plates containing 200 ng / mL AbA (purchased from Beijing Coollab Technology Co., Ltd.). Yeast growth was observed after culturing at 30℃ in the dark for 3 days. Results are as follows: Figure 5 As shown in Figure A, the yeast strain Y1H Gold [pABAi-proCsCAD1L] transformed with pGADT7-CsMYB26 could grow positive colonies on SD-Leu plates containing 200 ng / mL AbA, while the yeast strain Y1H Gold [pABAi-proCsCAD1L] containing the empty pGADT7 vector could not grow. The results indicate that the transcription factor CsMYB26 can bind to the promoter region of CsCAD1L.

[0064] F4:

[0065] 5'-CATATGGCCATGGAGGCCAGTGAATTCATGGGGAGGAGTCCATGCTGC-3'R4:

[0066] 5'-TCGATGCCCACCCGGGTGGAATTCTCATGGCCAGTCCTCAGAATCAAG-3'

[0067] SEQ ID NO.3

[0068]

[0069] 3. Activation assay of CsCAD1L by transcription factor CsMYB26

[0070] Upstream primer F5 and downstream primer R5 were designed to amplify the CsMYB26 gene using tea leaf cDNA as a template by PCR. Simultaneously, upstream and downstream primers F6 and R6 were designed to obtain the CsCAD1L gene promoter sequence by PCR using tea leaf genomic DNA as a template. The CsMYB26 and CsCAD1L gene promoter sequences were constructed into pGreenⅡ-62-SK and pGreenⅡ-0800-Luc vectors, respectively, and transformed into Agrobacterium GV3101 strain. The two Agrobacterium cultures (OD200, OD200, and OD200) were then used to amplify the CsMYB26 gene and CsCAD1L gene promoter sequences. 600 Both (0.8 g / L) were mixed at a 1:1 volume ratio and injected into the leaves of 5-week-old Nicotiana benthamiana. After incubation in the dark at 25°C for 48 h, the fluorescence at the injection site was observed using a plant in vivo imaging system, and samples were taken to measure the fluorescence intensity. The results are shown in the table below. Figure 5 The B-value indicates that the transcription factor CsMYB26 can bind to the promoter region of CsCAD1L and activate its expression.

[0071] F5: 5'-CGCTCTAGAACTAGTGGATCCATGGGGAGGAGTCCATGCTGC-3';

[0072] R5: 5'-ATTTCAGCGTACCGAATTGGTACCTCATGGCCAGTCCTCAGAATC-3';

[0073] F6: 5'-TCACTATAGGGCGAATTGGGTACCCACTTGGAGGAATAGGGAC-3';

[0074] R6: 5'-CGCTCTAGAACTAGTGGATCCATTAGACATACTCTTAATTA-3'.

[0075] Example 5: Detection of lignin content in plants overexpressing CsMYB26

[0076] Using cDNA extracted from samples cultured for 12 h, 24 h, 48 h, and 72 h in Example 2 as templates, qRT-PCR was performed using primers (RT-F2: 5'-CTTGGAGGACGAAAGAACA-3' / RT-R2: 5'-CTTCATGCCCAGGAACCAT-3') to detect... CsMYB26 In samples of transient gene overexpression CsCAD1L Gene expression levels. Results are shown in [link to results]. Figure 6 From A, we can find CsCAD1L Gene expression levels significantly increased at 24 h and 72 h. The total lignin content in the tea leaf samples from Example 2 was detected using a lignin content assay kit; the results are shown in section 6B. It can be found that… CsMYB26 The total lignin content in samples with transient gene overexpression was significantly increased.

[0077] Using cDNA samples from wild-type, OE-1, and OE-8 tobacco leaves in Example 3 as templates, qRT-PCR was performed using primers (RT-F2 / RT-R2) to detect cDNA in wild-type, OE-1, and OE-8 tobacco. CsCAD1L Gene expression levels. Results are shown in [link to results]. Figure 6 In C, we can find CsCAD1L The expression level of the gene was significantly increased in the overexpression lines OE-1 and OE-8. The total lignin content of wild-type, OE-1, and OE-8 tobacco leaves in Example 3 was detected using a lignin content detection kit. The results are shown in D of 6. It can be found that the total lignin content in the leaves of the overexpression lines OE-1 and OE-8 tobacco was significantly increased.

[0078] The results showed that overexpression of the CsMYB26 gene in plants could significantly increase the expression level of the CsCAD1L gene and the total lignin content.

[0079] Based on the changes in the above physiological indicators, it is demonstrated that the transcription factor CsMYB26 enhances the disease resistance of tea trees by regulating the key gene CsCAD1L in lignin synthesis, thereby increasing lignin content.

[0080] It should be noted that the above description only represents several specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and modifications can be made based on the present invention. Therefore, all modifications made by those skilled in the art without departing from the spirit of the present invention should be considered within the scope of protection of the present invention.

Claims

1. Application of a tea transcription factor CsMYB26 in regulating plant resistance to anthracnose.

2. The application as described in claim 1, characterized in that, The plants mentioned include woody plants and herbaceous plants.

3. The application as described in claim 2, characterized in that, This includes tea trees and tobacco.

4. The application as described in claim 1, characterized in that, The nucleotide sequence of the tea plant transcription factor CsMYB26 gene is shown in SEQ ID NO.

1.

5. The application as described in claim 1, characterized in that, The application involves overexpressing the tea tree transcription factor CsMYB26 in the plant genome.

6. The application as described in claim 5, characterized in that, The overexpression involves linking the tea transcription factor CsMYB26 with the plant expression vector pCAMBIA2300 or pCAMBIAsuper1300, which has a 35S promoter, and then transferring it into the plant genome using Agrobacterium-mediated transformation or leaf disc method to enhance the plant's resistance to anthracnose.

7. The application of the tea transcription factor CsMYB26 as described in claim 1 in improving plant resistance to anthracnose.

8. The application as described in claim 7, characterized in that, The application involves overexpressing the tea transcription factor CsMYB26 in plant genes.