Free gossypol degrading bacterium YJQ-1 and application thereof

Abstract

The invention relates to the technical field of microbial fermentation and feed production, in particular to a free gossypol degrading bacterium YJQ-1 and application thereof.The free gossypol degrading bacterium YJQ-1 is Wickerhamomyces anomalus, is preserved in the China Center for Type Culture Collection on March 4, 2026, has the preservation number of CCTCC M 2026367 and is separated from Sichuan Dazhou sweet distiller's yeast. The strain can tolerate 2.0 g / L of gossypol acetate, and the degradation rate of 1.0 g / L of gossypol acetate within 72 h reaches 83.75%. The microbial inoculum prepared from the strain is inoculated to cottonseed meal sieved by a 40-mesh sieve according to the inoculum size of 5%, the moisture content is adjusted to 40%, solid state fermentation is performed at 30 DEG C for 7 days, the gossypol degradation rate is 86.52%, the free gossypol is only 144 mg / Kg, and nutritional indexes such as cottonseed meal crude protein and protein digestibility are remarkably improved. The technology is low-carbon and environment-friendly, the application range of the cottonseed meal is widened, and a foundation is laid for biological manufacturing of oil processing byproduct protein resources.

Description

Technical Field

[0001] This invention relates to the field of microbial fermentation and feed production technology, specifically to a free gossypol-degrading bacterium YJQ-1 and its applications. Background Technology

[0002] Cottonseed meal is the main byproduct remaining after cottonseed oil extraction during cottonseed processing. Its crude protein content is between 35% and 45%, and its amino acid composition, except for slightly lower levels of lysine and methionine, meets the requirements of the Food and Agriculture Organization of the United Nations, making it valuable for the development and promotion of protein feed and food. However, due to its poor palatability, indigestibility, dark color, and the presence of anti-nutritional factors such as gossypol, its utilization value is greatly reduced, resulting in significant resource waste.

[0003] Cottonseed meal contains anti-nutritional factors such as free gossypol, which can damage the animal's intestines and lead to stunted growth and development. Therefore, the removal of free gossypol is crucial for the utilization of cottonseed meal. Biological methods are widely recognized as the optimal way to remove free gossypol from cottonseed meal and improve its nutritional value. This method is not only low-cost and safe, but also increases the protein and essential amino acid content of cottonseed meal, improving palatability. In recent years, it has been widely used in cottonseed meal detoxification treatment. Although existing research has reported that various microorganisms have the potential to degrade gossypol, ideal strains capable of efficiently, stably, and safely degrading gossypol remain relatively scarce. Therefore, screening for highly efficient free gossypol-degrading bacteria is key to the microbial degradation of free gossypol.

[0004] Solid-state fermentation is an effective way to utilize agricultural processing by-products. It enables the resource reuse of these by-products by allowing microorganisms to grow on a moist, water-free solid substrate, thus enhancing their ability to metabolize anti-nutritional components, increase nutrient content, and produce beneficial metabolites. However, due to the complex composition of cottonseed meal, it is necessary to select appropriate strains and / or combinations of strains, as well as unique fermentation processes and technologies, to fully biodegrade anti-nutritional factors in cottonseed meal, ensuring product safety and enabling the widespread use of fermented cottonseed meal products in the feed and food industries. Therefore, the selection of fermentation agents is particularly important for feed protein production. Summary of the Invention

[0005] The purpose of this invention is to provide a free gossypol-degrading bacterium YJQ-1 and its applications, which solves the problem of the scarcity of efficient, stable and safe gossypol-degrading bacterial strains in the prior art, and provides a high-quality and reliable bacterial strain basis for the biological degradation of free gossypol.

[0006] The objective of this invention is achieved through the following technical solution: This invention provides a free gossypol-degrading bacterium, YJQ-1, which is classified and named *Saccharomyces aberrantis*. Wickerhamomyces anomalus This strain was deposited at the China Center for Type Culture Collection on March 4, 2026, with accession number CCTCC M 2026367.

[0007] The present invention also provides a microbial agent for the degradation of free gossypol, wherein the active ingredient comprises the free gossypol degrading bacterium YJQ-1 as described in claim 1.

[0008] Furthermore, the microbial agent is the live bacterial cells of the free gossypol-degrading bacterium YJQ-1 collected by centrifugation after fermentation culture.

[0009] The present invention also provides a method for preparing the microbial inoculant, comprising the following steps: (1) Using sweet wine yeast as the isolation source, free gossypol degrading bacteria YJQ-1 was obtained by enriching, screening, gradient domestication and purification in a culture medium containing gossypol acetate; (2) The free gossypol degrading bacteria YJQ-1 was inoculated into the fermentation medium for expansion culture. After the culture was completed, the bacterial cells were collected by centrifugation to obtain the microbial agent.

[0010] Furthermore, step (1) specifically involves: a. Take 1.00 g of sweet wine yeast sample from Dazhou City, Sichuan Province, add it to 50 mL of enrichment medium containing 50 mg of gossypol acetate, and incubate at 30℃ and 200 r / min for 4 h with shaking. Then, use sterile water to serially dilute to obtain 10... -5 A diluted bacterial solution of a certain concentration; b. Spread 50 μL of the diluted solution onto a selection medium containing 1.0 g / L gossypol acetate and incubate at 30℃. Select single colonies with strong growth ability and transfer them sequentially to mediums containing 1.0 g / L, 1.5 g / L, and 2.0 g / L gossypol acetate for gradient acclimatization. After purifying the single colonies three times, freeze them for preservation. In step (2), the culture conditions for expansion are 30℃ and 200 r / min for 48 h; wherein the enrichment medium consists of: (NH4)2SO4 5 g / L, NaCl 0.1 g / L, MgSO4·7H2O 0.5 g / L, CaCl2 0.1 g / L, KH2PO4 1 g / L, and yeast extract 0.1 g / L; The screening medium consisted of: (NH4)2SO4 5 g / L, NaCl 0.1 g / L, MgSO4·7H2O 0.5 g / L, CaCl2 0.1 g / L, KH2PO4 1 g / L, yeast extract 0.1 g / L, and agar 20 g / L. The fermentation medium consisted of: 10 g / L peptone, 5 g / L yeast extract, 0.2 g / L glucose, 5 g / L malt extract, 1.16 g / L K₂HPO₄, 2 g / L triammonium citrate, 3 g / L CH₃COONa, 0.05 g / L MgSO₄·7H₂O, 0.03 g / L MnSO₄, and 1 mL / L Tween 80.

[0011] The present invention also provides the application of the free gossypol degrading bacterium YJQ-1 or the microbial agent described herein in the degradation of free gossypol.

[0012] Furthermore, the concentration of free gossypol in the material to be treated is not higher than 2.0 g / L, and the degradation treatment temperature is 30℃; for materials with a free gossypol concentration of 1.0 g / L, the degradation rate of free gossypol within 72 h is not less than 83.75%.

[0013] The present invention also provides the application of the free gossypol degrading bacterium YJQ-1 or the microbial agent described herein in the preparation of detoxified feed protein from fermented cottonseed meal.

[0014] Furthermore, the specific process of fermenting cottonseed meal is as follows: the cottonseed meal is crushed and passed through a 40-mesh sieve, inoculated with 5% by weight of the aforementioned microbial agent, the moisture content of the system is adjusted to 40%, and solid-state fermentation is carried out at a constant temperature of 30°C for 7 days to obtain detoxified cottonseed feed protein.

[0015] Furthermore, the free gossypol content in the detoxified cottonseed feed protein obtained by fermentation is not higher than 144 mg / Kg, and the gossypol degradation rate is not lower than 86.52%. The detoxified cottonseed feed protein is used as a high-protein feed supplement in animal feed.

[0016] The beneficial effects of this invention are as follows: The *Y.JQ-1* strain obtained by screening in this invention is a novel and highly efficient gossypol-degrading strain. This strain was isolated from sweet wine yeast produced in Dazhou City, Sichuan Province. The source is readily available, and the strain has been officially deposited after identification, ensuring a clear and stable identification. This strain exhibits excellent gossypol tolerance and degradation capabilities, tolerating concentrations up to 2.0 g / L of acetate gossypol. Under 1.0 g / L acetate gossypol conditions, the gossypol degradation rate reaches 83.75% within 72 hours. Furthermore, it can grow using gossypol as a carbon source, with gossypol having a weak inhibitory effect on its growth. This solves the problem of the scarcity of highly efficient, stable, and safe gossypol-degrading strains in existing technologies, providing a high-quality and reliable strain foundation for the biological degradation of free gossypol.

[0017] The microbial agent of this invention uses free gossypol-degrading bacteria YJQ-1 as the sole active ingredient. Its preparation process is well-defined and the conditions are controllable. The gradient operation of enrichment, screening, and domestication can efficiently obtain pure culture strains. The fermentation conditions are mild and do not require special equipment. The agent can be obtained quickly by centrifuging to collect the bacterial cells. The entire preparation process is simple and easy to operate, without complicated procedures, and is suitable for large-scale production. It provides convenient microbial agent product support for the subsequent industrial application of gossypol degradation and cottonseed meal fermentation.

[0018] This invention applies the free gossypol-degrading bacterium YJQ-1 and its corresponding inoculum to the solid-state fermentation of cottonseed meal. Using a single-strain fermentation method eliminates the need for other microbial strains, effectively avoiding the problems of inter-strain antagonism and difficulty in controlling conditions during the fermentation of compound microbial strains. The fermentation process parameters are definite and easy to control; only a 5% inoculum amount, 40% moisture content, and a constant temperature of 30℃ for 7 days are required to achieve efficient detoxification and nutritional enhancement of cottonseed meal. The fermentation process requires no complex equipment, making it easy to implement and promote industrially. Furthermore, the solid-state fermentation mode is low-carbon, environmentally friendly, and sustainable, meeting the industry's development needs for green production.

[0019] Cottonseed meal fermented with the strain and inoculant described in this invention exhibits significant detoxification and comprehensive optimization of nutritional quality. The free gossypol content decreased from 1068 mg / Kg to 144 mg / Kg, with a gossypol degradation rate as high as 86.52%, significantly reducing the toxicity of anti-nutritional factors in cottonseed meal. Simultaneously, the crude protein content of the fermented cottonseed meal increased by 10.39%, protein digestibility increased by 21.77%, reducing sugar content increased by 58.94%, and total sugar content decreased by 15.93%. While retaining the original nutritional components, it significantly improved the utilization rate and absorbability of protein in cottonseed meal, substantially improving the feed nutritional value of cottonseed meal.

[0020] This invention achieves the efficient resource utilization of cottonseed meal, a byproduct of cotton processing. Through bio-fermentation and detoxification, cottonseed meal, originally only applicable to ruminants, is extended to the feed application of monogastric animals, significantly broadening its application scope and effectively solving the problem of low utilization value and serious resource waste caused by the presence of free gossypol in cottonseed meal. The detoxified cottonseed feed protein obtained through fermentation can be used as a high-protein feed supplement in animal feed production, providing an important technical reference for replacing soybean meal with protein feed. It also promotes the development of the bio-manufacturing industry of protein resources from oilseed processing byproducts, laying a material foundation for the diversified supply of feed protein resources in my country. It has good practical application value and promotion prospects in the resource utilization of agricultural processing byproducts and the development of the feed industry. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 The diagram shows the phylogenetic tree (A) and growth morphology (B) of the abnormal Wickham yeast YJQ-1 in Example 1 of this invention.

[0023] Figure 2 The figures show the growth of the abnormal Wickham yeast YJQ-1 in Example 2 of this invention on screening media of 1.0 g / L gossypol acetate, 1.5 g / L gossypol acetate, and 2.0 g / L gossypol acetate.

[0024] Figure 3 The growth curve and degradation rate of abnormal Wickham yeast YJQ-1 in 1.0 g / L gossypol acetate screening medium from 0 h to 72 h are shown in Example 3 of this invention.

[0025] Figure 4 The graph shows the changes in the content of cottonseed meal fermented by abnormal Wickham yeast YJQ-1 in Example 4 of the present invention; where A is the content of free gossypol, B is the content of crude protein, C is the content of small peptides, D is the protein digestibility, E is the content of reducing sugar, and F is the content of total sugar. Detailed Implementation

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0028] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0029] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0030] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0031] The present invention will be described in detail below through specific embodiments.

[0032] The free gossypol-degrading bacteria involved in this invention are *Saccharomyces cerevisiae* (Wickham's yeast). Wickerhamomyces anomalus YJQ-1, this strain was deposited at the China Center for Type Culture Collection on March 4, 2026, at Wuhan University, Wuhan, China, with accession number CCTCC M 2026367.

[0033] The enrichment medium consisted of: (NH4)2SO4 5 g / L, NaCl 0.1 g / L, MgSO4·7H2O 0.5 g / L, CaCl2 0.1 g / L, KH2PO4 1 g / L, and yeast extract 0.1 g / L. The screening medium consisted of: (NH4)2SO4 5 g / L, NaCl 0.1 g / L, MgSO4·7H2O 0.5 g / L, CaCl2 0.1 g / L, KH2PO4 1 g / L, yeast extract 0.1 g / L, and agar 20 g / L. The fermentation medium consisted of: 10 g / L peptone, 5 g / L yeast extract, 0.2 g / L glucose, 5 g / L malt extract, 1.16 g / L K2HPO4, 2 g / L triammonium citrate, 3 g / L CH3COONa, 0.05 g / L MgSO4·7H2O, 0.03 g / L MnSO4, and 1 mL / L Tween 80. The YPD culture medium consists of: 20 g / L peptone, 10 g / L yeast extract, and 20 g / L glucose.

[0034] Example 1: Isolation, purification and identification of abnormal Wickham yeast YJQ-1 (1) Screening of gossypol-degrading bacteria Purchase sweet wine starter from Dazhou City, Sichuan Province. Weigh 1.00 g of the starter sample and 50 mg of gossypol acetate and place them in 50 mL of enrichment medium. Incubate at 30℃ and 200 r / min for 4 h with shaking. Then, continuously dilute the enrichment medium with sterile water to obtain a concentration of 10. -5 Diluent: Take 50 μL of the diluent and spread it evenly on a screening culture plate containing 1.0 g / L gossypol acetate. (2) Isolation and purification of strains Take 50 μL of the diluted solution and spread it evenly on a screening culture plate containing 1.0 g / L gossypol acetate, and incubate at 30℃ for 24 h.

[0035] Pick a single colony from the above culture medium and inoculate it into a 5 mL container of YPD liquid culture medium. Incubate at 28-30℃ for 24 h and repeat the purification process 3 times.

[0036] To preserve the bacterial culture from the last culture, 300 μL of glycerol (50%, v / v) and 700 μL of bacterial culture were placed into preservation tubes, labeled, and frozen at -80℃ for use in subsequent experiments.

[0037] YPD medium: peptone 20 g / L, yeast extract 10 g / L, glucose 20 g / L.

[0038] (3) Identification of gossypol-degrading bacteria Molecular biological identification: Add 50 μL of Lysis Buffer to a PCR tube, then add 10 μL of the bacterial culture obtained from the last culture to 50 μL of Lysis Buffer. Incubate at 80℃ for 15 min to lyse the fungal cell wall. After brief centrifugation for 10 s, collect the supernatant as the template for PCR amplification. Use the universal 18S rDNA primer ITS1 (5'... TCCGTAGGTGAACCTGCGG 3'), ITS4 (5') TCCTCCGCTTATTGATATGC 3') The 18S rDNA sequence of the strain was amplified. PCR conditions included: pre-denaturation of the DNA double strand at 95℃ for 3 min; denaturation at 95℃ for 10 s; annealing at 55℃ for 10 s; extension at 72℃ for 42 s, repeated 30 times; and finally, holding at 72℃ for 10 min to amplify the reaction product. The amplified product was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. BLAST analysis was used to compare the results with the NCBI database, and a phylogenetic tree was constructed using MEGA-11 software. Figure 1 As shown in Figure A, after analysis and identification, strain YJQ-1 was determined to be *Saccharomyces cerevisiae* (abnormal Wickham yeast). Wickerhamomyces anomalus ).

[0039] The strain was entrusted to the China Center for Type Culture Collection, and the strain accession number is CCTCC M 2026367.

[0040] Morphological identification revealed that the colonies of strain YJQ-1 were milky white, round, smooth, glossy, and thick in texture. Figure 1 As shown in Figure B, the colonies are raised with relatively neat edges and are densely packed overall.

[0041] Example 2: Functional assessment of gossypol tolerance in abnormal Wickham yeast YJQ-1 Abnormal Wickham yeast YJQ-1 was inoculated onto enrichment medium containing 1.0 g / L gossypol acetate, 1.5 g / L gossypol acetate, and 2.0 g / L gossypol acetate, and streaked onto plates. The plates were then incubated at 30°C for 48 h. The growth status of the strain was observed over 48 h to assess the strain's tolerance to gossypol.

[0042] The results are as follows Figure 2 The abnormal Wickham yeast YJQ-1 could tolerate 1.0 g / L, 1.5 g / L, and 2.0 g / L gossypol acetate in enrichment medium (30℃, 48 h), but its growth was inhibited at a concentration of 2.0 g / L gossypol acetate, although it could still grow normally. This indicates that the abnormal Wickham yeast ( Wickerhamomyces anomalus YJQ-1 has the characteristic of high gossypol tolerance.

[0043] Example 3: Evaluation of the gossypol degradation ability of abnormal Wickham yeast YJQ-1 (1) Experiment on the degradation of gossypol by abnormal Wickham yeast YJQ-1: Single colonies of the target strain were picked and inoculated into 5 mL of fermentation medium for amplification. The inoculation tubes were placed in a 30℃ constant-temperature shaking incubator and incubated at 200 r / min for 12 h to obtain the primary seed culture in the logarithmic growth phase. A 1% inoculation was then added to fermentation medium containing 1.0 g / L gossypol acetate and incubated at 30℃ (200 rpm) for 72 h. Samples were taken at 0 h, 3 h, 6 h, 12 h, 24 h, 36 h, 48 h, 60 h, and 72 h. Three biological replicates were set up for each experiment.

[0044] (2) OD 600 Detection of free gossypol content: OD 600 Obtained by ultraviolet spectrophotometer; The free gossypol content was determined using the phloroglucinol method: The obtained sample was centrifuged at 10000 r / min and 4℃ for 10 min. The supernatant was filtered through a 0.22 μm microporous membrane for sterilization, and the change in gossypol content was determined using the phloroglucinol method. Specifically, 1.0 mL of the incubation culture was mixed with 3.0 mL of acetone and then filtered through a 0.22 μm organic phase filter to obtain the test sample. 1.0 mL of the test sample was mixed with 2.0 mL of the chromogenic substrate solution and reacted at 55℃ for 5 min. The gossypol content of the sample was calculated at OD550 nm of the reaction solution.

[0045] Preparation of colorimetric reagent: Use a pipette to measure 16.6 mL of concentrated hydrochloric acid. After accurately measuring, place it in a 250 mL beaker, add 1 g of phloroglucinol, and then dilute it to 100 mL with 95% ethanol solution. Mix and dissolve the phloroglucinol thoroughly, pour it into a brown bottle, and store it in a refrigerator at 4°C for later use.

[0046] Depend on Figure 3 It can be seen that after fermentation by *Saccharomyces cerevisiae* YJQ-1, 83.75% of the gossypol acetate was degraded within 72 hours. The rapid growth period of the strain is observed from 0 to 24 hours, reaching a plateau at 36 hours, at which point the degradation rate of gossypol reaches 40.23%. The growth curve indicates that under conditions containing gossypol from 0 to 36 hours, gossypol inhibited the normal growth of the strain to some extent, but the impact was minimal. This suggests that the screened strain does indeed exhibit gossypol tolerance and can utilize gossypol as a carbon source for growth.

[0047] Example 4: Preparation of protein feed from cottonseed meal via microbial fermentation (1) Solid-state fermentation experiment of cottonseed meal by abnormal Wickham yeast YJQ-1: Single colonies of the target strain were picked and placed in the fermentation medium. The culture was carried out at a constant temperature of 30℃ and 200 r / min for 12 h. The culture was then expanded by 1% inoculum for 24 h to obtain the fermentation liquid.

[0048] Cottonseed meal was crushed and passed through a 40-mesh sieve, then inoculated with 5% by weight of the aforementioned microbial agent. The moisture content was adjusted to 40%, and the fermentation substrate was placed in a transparent sealed container and fermented at a constant temperature of 30°C for 7 days to obtain detoxified cottonseed feed protein. The blank control group was tested with sterilized pure water, and each fermentation group was tested in triplicate.

[0049] (2) Determination of component content in fermented cottonseed meal: The determination of free gossypol content should refer to GB / T 13086-2020, "Determination of Free Gossypol in Feed". The determination of crude protein should refer to GB / T 6432-2018 Determination of Crude Protein in Feed - Kjeldahl Method; The determination of small peptide content refers to GB / T 22492-2008 Soybean Peptide Powder; Protein digestibility determination: A two-step in vitro rumen digestion experiment was conducted. 2.00 g of raw material (filtered through a 40-mesh filter) was placed in a 250 mL Erlenmeyer flask, and 30 mL of 0.04 mol / L HCl buffer and 1 mL of 60 mg / mL pepsin HCl buffer were added. Then, 0.5 mL of bacterial growth inhibitor (0.5% chloramphenicol) was added. The Erlenmeyer flask was sealed and placed on a shaker at 37°C and 80 r / min for 12 h.

[0050] Remove the Erlenmeyer flask, titrate with 1 mol / L NaOH solution to adjust the pH to 8.0, then add 20 mL of 0.05 mol / L PBS buffer and 1 mL of 16 mg / mL trypsin PBS buffer, and continue incubation for 12 h. After cooling in an ice-water bath, rinse the filter bag twice with distilled water and dry at 65℃ for 24 hours until constant weight. The absolute digestibility of the protein is given by equation (1). Cottonseed meal was used as raw material, with a blank control and three parallel groups.

[0051] (1) X digestibility is the absolute digestibility of true protein. x0 is the true protein content of cottonseed meal before digestion; x1 is the protein content of cottonseed meal after digestion.

[0052] Determination of total sugar and reducing sugar: Extraction of reducing sugars from dry fermented feed: Accurately weigh 1.00±0.001 g of dry fermented feed, place it in a 10 mL volumetric flask, add distilled water to the mark, mix well, boil in a water bath for 20 min, centrifuge at 4000 rpm for 15 min, and the supernatant is the reducing sugar extract. Perform three parallel groups.

[0053] Extraction of total sugar from dry fermented feed: Accurately weigh 0.50 ± 0.001 g of dry fermented feed and place it in a large test tube. Add 5 mL of 6 M HCl and 7.5 mL of distilled water, respectively. Heat in a boiling water bath for 30 min. After cooling, adjust the pH to neutral with 6 M NaOH and bring the volume to 50 mL. Centrifuge at 4000 rpm for 15 min. The supernatant is the total sugar extract. Perform three parallel trials.

[0054] Take 0.5 mL of the extract, add 0.5 mL of DNS, shake to mix, then heat in a boiling water bath for 5 min, immediately cool to room temperature with ice water, add 4 mL of distilled water, and measure the absorbance at 540 nm to obtain the content of total sugar and reducing sugar.

[0055] Results of solid-state fermentation of cottonseed meal as follows Figure 4 As shown, abnormal Wickham yeast ( Wickerhamomyces anomalus YJQ-1 reduced the free gossypol content in cottonseed meal from 1068 mg / Kg to 144 mg / Kg, with a degradation rate of 86.52%. At the same time, the crude protein content increased by 10.39%, the small peptide content did not change significantly, the protein digestibility increased by 21.77%, the reducing sugar increased by 58.94%, and the total sugar content decreased by 15.93%.

[0056] Based on the above embodiments, this invention starts with sweet wine yeast produced in Dazhou City, Sichuan Province, and identifies a strain with high degradation ability for gossypol. Using this strain, cottonseed meal is fermented to produce fermented protein feed. After microbial fermentation, the free gossypol content of the cottonseed meal is significantly reduced, while the crude protein content is increased. Two-step in vitro rumen digestion simulation experiments show that the fermented protein is more easily digested, resulting in cottonseed meal with high nutritional value. This invention provides highly efficient strains for bio-fermented feed by screening gossypol-degrading bacteria. Through bio-fermentation, cottonseed meal, which can only be used in ruminants, can be applied to monogastric animals. The low-toxicity feed protein obtained from fermented cottonseed meal broadens its application range and improves its utilization rate, providing a technical reference for future protein feed substitution of soybean meal.

[0057] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A strain of free gossypol-degrading bacteria, YJQ-1, is classified and named *Saccharomyces aberrantis* (Wickham's yeast). Wickerhamomyces anomalus This strain was deposited at the China Center for Type Culture Collection on March 4, 2026, with accession number CCTCCM 2026367.

2. A microbial agent for the degradation of free gossypol, characterized in that, The active ingredient comprises the free gossypol-degrading bacterium YJQ-1 as described in claim 1.

3. The microbial agent according to claim 2, characterized in that, The microbial agent is the live bacterial cells of the free gossypol-degrading bacterium YJQ-1 collected by centrifugation after fermentation culture.

4. A method for preparing the microbial inoculant of claim 2, characterized in that, Includes the following steps: (1) Using sweet wine yeast as the isolation source, free gossypol degrading bacteria YJQ-1 was obtained by enrichment, screening, gradient domestication and purification in a culture medium containing gossypol acetate; (2) The free gossypol degrading bacteria YJQ-1 was inoculated into the fermentation medium for expansion culture. After the culture was completed, the bacterial cells were collected by centrifugation to obtain the microbial agent.

5. The method according to claim 4, characterized in that, Step (1) is as follows: a. Take 1.00 g of sweet wine yeast sample from Dazhou City, Sichuan Province, add it to 50 mL of enrichment medium containing 50 mg of gossypol acetate, and incubate at 30℃ and 200 r / min for 4 h with shaking. Then, use sterile water to serially dilute to obtain 10... -5 A diluted bacterial solution of a certain concentration; b. Spread 50 μL of the diluted solution onto a selection medium containing 1.0 g / L gossypol acetate and incubate at 30℃. Select single colonies with strong growth ability and transfer them sequentially to mediums containing 1.0 g / L, 1.5 g / L, and 2.0 g / L gossypol acetate for gradient acclimatization. After purifying the single colonies three times, freeze them for preservation. In step (2), the culture conditions are 30℃ and 200 r / min for 48 h; wherein the enrichment medium consists of: (NH4)2SO4 5 g / L, NaCl 0.1 g / L, MgSO4·7H2O 0.5 g / L, CaCl2 0.1 g / L, KH2PO4 1 g / L, and yeast extract 0.1 g / L. The screening medium consisted of: (NH4)2SO4 5 g / L, NaCl 0.1 g / L, MgSO4·7H2O 0.5 g / L, CaCl2 0.1 g / L, KH2PO4 1 g / L, yeast extract 0.1 g / L, and agar 20 g / L. The fermentation medium consisted of: 10 g / L peptone, 5 g / L yeast extract, 0.2 g / L glucose, 5 g / L malt extract, 1.16 g / L K₂HPO₄, 2 g / L triammonium citrate, 3 g / L CH₃COONa, 0.05 g / L MgSO₄·7H₂O, 0.03 g / L MnSO₄, and 1 mL / L Tween 80.

6. The application of the free gossypol degrading bacteria YJQ-1 as described in claim 1 or the microbial agent as described in claim 2 in the degradation of free gossypol.

7. The application according to claim 6, characterized in that, The concentration of free gossypol in the material to be treated is not higher than 2.0 g / L, and the degradation treatment temperature is 30℃; for materials with a free gossypol concentration of 1.0 g / L, the degradation rate of free gossypol within 72 h is not less than 83.75%.

8. The application of the free gossypol-degrading bacterium YJQ-1 as described in claim 1 or the microbial agent as described in claim 2 in the preparation of detoxified feed protein from fermented cottonseed meal.

9. The application according to claim 8, characterized in that, The specific process of fermenting cottonseed meal is as follows: the cottonseed meal is crushed and passed through a 40-mesh sieve, inoculated with 5% of the microbial agent by mass, the moisture content of the system is adjusted to 40%, and solid-state fermentation is carried out at a constant temperature of 30°C for 7 days to obtain detoxified cottonseed feed protein.

10. The application according to claim 8 or 9, characterized in that, The free gossypol content in the detoxified cottonseed feed protein obtained by fermentation is not higher than 144 mg / Kg, and the gossypol degradation rate is not lower than 86.52%. The detoxified cottonseed feed protein is used as a high-protein feed supplement in animal feed.

Images