A monoclonal antibody for tyrosine iodine-modified pp2a protein, a preparation method and application thereof

By developing a monoclonal antibody to modify the PP2Ac protein with tyrosine iodide, the problem of detection difficulties in existing technologies has been solved, achieving detection with high sensitivity and specificity, supporting the diagnosis and treatment of tumors and Alzheimer's disease.

CN122255284APending Publication Date: 2026-06-23PEKING UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
PEKING UNIV
Filing Date
2026-02-04
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently detecting and monitoring the tyrosine iodination modification of the catalytic subunit of the PP2A protein, which affects the diagnosis and treatment of diseases such as tumors and Alzheimer's disease.

Method used

A monoclonal antibody against tyrosine-iodinated PP2Ac protein was developed. High-affinity and high-specificity antibodies were screened using phage display technology for immunoassay and diagnosis, including immunohistochemistry, Western blotting, and immune cell imaging.

Benefits of technology

This study achieves highly sensitive and specific detection of iodine modification of 307 site of PP2Ac protein, providing new diagnostic and treatment strategies and supporting the development of precision medicine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122255284A_ABST
    Figure CN122255284A_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of biology, and particularly discloses a kind of tyrosine iodination modified PP2A protein monoclonal antibody, preparation method and application.The present application is prepared by tyrosine iodination modified PP2A protein antigen peptide, rabbit is immunized to prepare monoclonal antibody, and is selected by phage display technology, expression vector amplification and ELISA screening, finally obtains a strain of monoclonal antibody R004 that can effectively recognize target.The antibody shows good sensitivity and specificity in immunohistochemistry, cell immunofluorescence and protein immunoblotting.The monoclonal antibody screened in the present application can be used in the detection of tyrosine iodination modification of PP2A protein catalytic subunit 307, and provides support for tumor diagnosis, anti-tumor and neurological disease drug research and development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology. Specifically, this invention relates to a monoclonal antibody of tyrosine iodide-modified PP2A protein, its preparation method, and its application. Background Technology

[0002] Protein phosphatase 2A (PP2A) is an important cellular serine-threonine phosphatase with a heteromorphic triomer structure, consisting of a 36 kDa catalytic C subunit, a 65 kDa structural A subunit, and a variety of regulatory B subunits. PP2Ac plays a central role in the regulation of PP2A. PP2A is a key regulator of cellular activities such as cell proliferation, cell cycle, and apoptosis. It directly dephosphorylates key pathological proteins such as Akt and tau proteins, giving PP2A potential therapeutic applications in tumor growth and the progression of Alzheimer's disease. The quaternary structure of PP2A is regulated by phosphorylation of PP2Ac at the Tyr307 site. This phosphorylation event inhibits the interaction between PP2Ac and the B56 subunit and prevents the formation of the PP2A complex containing the B55 subunit, ultimately leading to PP2A inactivation and accelerating disease progression. For example, phosphorylation of PP2Ac at Tyr307 leads to PP2A inactivation, which in turn induces an increase in tau protein phosphorylation levels, the formation of neurofibrillary tangles, exacerbates neurotoxicity and neuroinflammation, and accelerates the onset and progression of Alzheimer's disease.

[0003] Tyrosine iodination is ubiquitous in proteins. Referring to the antagonistic relationship between protein iodination and phosphorylation as elucidated in CN202310055904.3 and CN202411474023.6, the presence of iodination in some key proteins and the detection of iodinated proteins are also issues of interest to those skilled in the art. Summary of the Invention

[0004] Based on previous research, analysis using liquid chromatography-mass spectrometry revealed that the Tyr307 site of PP2Ac is particularly susceptible to iodination. Given the crucial role of PP2Ac protein in tumorigenesis and Alzheimer's disease, to better investigate iodination modification of PP2Ac protein, elucidate the molecular mechanisms of iodinated PP2Ac in disease development, its potential role as a biomarker in tumor and Alzheimer's disease diagnosis, and to assist in assessing the PP2Ac protein modification status and enzyme activity in patients, it is necessary to develop an iodinated PP2Ac-Tyr 307 monoclonal antibody.

[0005] Therefore, the objective of this invention is to provide a monoclonal antibody that rapidly, specifically, and sensitively modulates the catalytic subunit of the PP2A protein through iodination, thereby meeting the needs of detection and monitoring. Through extensive research and screening, this invention has achieved this objective, and the solution provided by this invention is as follows: In one aspect, the present invention discloses a monoclonal antibody of tyrosine iodination-modified PP2Ac protein, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0006] In one aspect, the present invention discloses a monoclonal antibody of tyrosine iodide-modified PP2Ac protein, the amino acid sequence of which is shown in SEQ ID NO.4.

[0007] In one aspect, the present invention discloses a nucleic acid vector containing a nucleic acid sequence of a monoclonal antibody fragment of a tyrosine iodinated modified protein, the nucleic acid sequence being as shown in SEQ ID NO.7 or SEQ ID NO.11.

[0008] In one aspect, the present invention discloses a method for preparing an iodide-modified PP2Ac protein monoclonal antibody, the method comprising recombinantly expressing a vector containing the light chain fragment and heavy chain fragment sequences of a monoclonal antibody containing PP2Ac protein; preferably, the sequence of the light chain fragment of the monoclonal antibody containing PP2Ac protein is shown in SEQ ID NO.7; and the sequence of the heavy chain fragment of the monoclonal antibody containing PP2Ac protein is shown in SEQ ID NO.11.

[0009] In one aspect, the present invention discloses the application of an iodine-modified PP2Ac protein monoclonal antibody, comprising binding the aforementioned tyrosine-iodine-modified PP2Ac protein monoclonal antibody to the PP2Ac protein in a sample to detect whether the tyrosine residue at position 307 of the PP2Ac protein is iodized.

[0010] In one aspect, the present invention discloses the application of an iodinated PP2Ac protein monoclonal antibody in a kit for preparing a reagent kit, the kit comprising the aforementioned monoclonal antibody, the kit being used to bind the monoclonal antibody to the PP2Ac protein in a sample to detect whether the tyrosine residue at position 307 of the PP2Ac protein is iodinated.

[0011] In one aspect, the present invention discloses the application of an iodide-modified PP2Ac protein monoclonal antibody in the preparation of an immunoassay kit.

[0012] In one aspect, this invention discloses the application of an iodide-modified PP2Ac protein monoclonal antibody in immunoassay, wherein the immunoassay includes one or more of immunohistochemistry, Western blotting, immunocellular imaging, immunochemiluminescence, immunofluorescence, ELISA, immunolateral flow, immunoelectrochemistry, and fluorescence resonance energy transfer (FRET). Those skilled in the art know that in immunoassay, a monoclonal antibody targeting the iodide-modified PP2Ac protein can be bound to a target sample to determine the presence of 307-position tyrosine iodide-modified PP2Ac protein in the sample, and also to determine the content of the iodide-modified protein. In some embodiments, a secondary antibody is also used to bind to the monoclonal antibody described in this invention. A marker molecule can also be modified on the antibody of this invention for direct detection. In some embodiments, the binding can be detected by observing interfacial changes caused by antigen-antibody binding, thereby reflecting the binding of antigen and antibody by detecting changes in interfacial information, such as changes in interfacial current signals, changes in interfacial optical information, or changes in interfacial structural information. The sample source can be blood, plasma, serum, cells, tissue, feces, urine, or saliva. The sample belongs to humans or mammals.

[0013] In one aspect, the present invention discloses a reagent or kit for detecting iodinated PP2Ac protein, wherein the reagent comprises a monoclonal antibody that specifically binds to the iodinated tyrosine residue at position 307 of the PP2Ac protein. The amino acid sequence of the monoclonal antibody is shown in SEQ ID NO. 4.

[0014] In one embodiment, the reagent or kit is suitable for immunohistochemistry, Western blotting, immunocellular imaging, immunochemiluminescence, immunofluorescence, ELISA, immunolateral flow, immunoelectrochemistry, and fluorescence resonance energy transfer (FRET).

[0015] In one embodiment, the immune test is used to detect tumors or neurological conditions, preferably Alzheimer's disease. Beneficial effects

[0016] This invention is the first to use phage display technology to screen for a PP2Ac protein antibody (R004) with high affinity and specificity for iodination modification at the 307 tyrosine position. The antibody provided by this invention can be used as a protein functional modification antibody in non-disease diagnostic and therapeutic research and development, and can also be used as a diagnostic antibody for the detection of iodination modification of the PP2Ac protein at the 307 tyrosine position.

[0017] Furthermore, the monoclonal antibody at the iodinated PP2Ac-Tyr 307 site provided by this invention is expected to provide new strategies for precision medicine, such as screening iodination agonists of PP2Ac, developing drugs or combination therapies that inhibit PP2Ac phosphorylation by promoting iodination.

[0018] Therefore, developing a highly specific and sensitive iodinated PP2Ac-Tyr 307 protein antibody has significant scientific research and clinical application value. Attached Figure Description

[0019] Figure 1 The staining results of iY307-PP2Ac in the mouse cerebral cortex and hippocampus were obtained by immunohistochemistry according to the embodiments of the present invention.

[0020] Figure 2 The staining results (A) of iY307-PP2Ac in SH-SY5Y cells detected by the high-content cell imaging method provided in this embodiment of the invention, and the statistical analysis (B) of the effect of antibody concentration on the average staining area. Data in Figure B are expressed as mean ± standard deviation. p-values ​​were calculated using one-way ANOVA, with p < 0.0001.

[0021] Figure 3 The image shows the protein bands of iY307-PP2Ac in SH-SY5Y cells as detected by Western blotting in an embodiment of the present invention. Detailed Implementation

[0022] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments and experimental examples are commercially available. Unless otherwise stated, all reagents used in this invention are analytical grade reagents. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0023] The preparation method for PP2Ac-Tyr307 iodide-modified monoclonal antibody is as follows: (1) Synthesis of PP2Ac polypeptide antigen modified by iodination of tyrosine at position 307: synthesize iodinated polypeptide PP2Ac (I): CGEPHVTRRTPDY (I)FL; at the same time synthesize polypeptide antigen PP2Ac (no I) modified by non-iodination of tyrosine at position 307: CGEPHVTRRTPDYFL.

[0024] (2) The synthesized iodinated modified polypeptide PP2Ac(I) and non-iodinated modified polypeptide PP2Ac(no I) were coupled with KLH and BSA as immunogenic antigens, respectively.

[0025] (3) The above-mentioned immunoantigens were mixed and emulsified with Freund's complete adjuvant. Balb / c mice (100 μg / mouse / dose), New Zealand white rabbits (0.5 mg / mouse / dose), and chicken models (0.5 mg / mouse / dose) were then immunized subcutaneously at multiple sites (more than 8 sites). A second immunization was performed two weeks later, replacing the Freund's complete adjuvant with an incomplete adjuvant. All other steps were the same as the first immunization. From the third immunization onwards, no adjuvant was added. After three immunizations, blood was collected and serum titers were determined using a serially diluted ELISA method. An ELISA titer of 240,000 was used as the standard. If the titer requirement was not met, immunization continued. If the titer requirement was met, all serum from the animals was separated, and spleen and bone marrow tissue were collected based on the titer results.

[0026] (4) After RNA extraction, antibody light chain and heavy chain ScFv phage display library was established by reverse transcription, in vitro gene amplification, and phage particle construction.

[0027] (5) Target phage panning: The phage solution was added to a high-affinity enzyme-linked plate coated with PP2Ac(I) antigen for panning to rescue and amplify the eluted phages and obtain the phage screening library; (6) Antibody DNA sequencing: After phage screening, the sequence of candidate monoclonal antibodies is obtained by antibody DNA sequencing.

[0028] (7) Construct expression vectors to express and purify candidate antibodies.

[0029] (8) Use ELISA to screen for antibodies that have stable high affinity for antigen proteins.

[0030] 1.1 The specific sequences of the monoclonal clones screened in step (6) above are shown in Table 1.

[0031] Table 1 Sequence information of candidate antibodies

[0032] 1.2 Construction of antibody gene vector: 1) The VL nucleotide sequence of the R003 antibody, obtained through sequencing and analysis, is as follows: GAGCTCGAGCTGAACCAGACTGCATCTCCCGTGTCTGCAGCTGTGGGAGGCACAGTCAGCATCAGTTGCCAGTCCAGTCAGAGTGTTTATAATAACAACCTCTTATCCTGGTTTCAGCAGAAACCAGGGCAGCCTCCCAAGCGCCTGATCTACAGGGCTTCCACTCTGGCATCTGGGGTCCCGTCGCGGTTCAAGGGCAGTGGATCTGGGACACAGTTCACTCTCACCATCAGCGACGTGCAGTGCGACGATGCTGCCACTTACTACTGTGCAGGCGGTTATAATAGTCCTAGTGATAATGCTTTCGGCGGAGGGACCGAGGTGGTCGTCAAAGGGGATCCAGTTGCACCTACTGTCCTCATCTTCCCACCAGCTGCTGATCAGGTGGCAACTGGAACAGTCACCATCGTGTGTGTGGCGAATAAATACTTTCCCGATGTCACCGTCACCTGGGAGGTGGATGGCACCACCCAAACAACTGGCATCGAGAACAGTAAAACACCGCAGAATTCTGCAGATTGTACCTACAACCTCAGCAGCACTCTGACACTGACCAGCACACAGTACAACAGCCACAAAGAGTACACCTGCAAGGTGACCCAGGGCACGACCTCAGTCGTCCAGAGCTTCAATAGGGGTGACTGT (SEQ ID NO.5) The VL sequence information of the R003 antibody expression vector for construction is as follows: AtgggctggtccctgattctgctgttcctggtggctgtggctaccagggtgctgagtGAGCTCGAGCTGAACCAGACTGCATCTCCCGTGTCTGCAGCTGTGGGAGGCACAGTCAGCATCAGTTGCCAGTCCAGTCAGAGTGTTTATAATAACAACCTCTTATCCTGGTTTCAGCAGAAACCAGGGCAGCCTCCCAAGCGCCTGATCTACAGGGCTTCCACTCTGGCATCTGGGGTCCCGTCGCGGTTCAAGGGCAGTGGATCTGGGACACAGTTCACTCTCACCATCAGCGACGTGCAGTGCGACGATGCTGCCACTTACTACTGTGCAGGCGGTTATAATAGTCCTAGTGATAATGCTTTCGGCGGAGGGACCGAGGTGGTCGTCAAAGGGGATCCAGTTGCACCTACTGTCCTCATCTTCCCACCAGCTGCTGATCAGGTGGCAACTGGAACAGTCACCATCGTGTGTGTGGCGAATAAATACTTTCCCGATGTCACCGTCACCTGGGAGGTGGATGGCACCACCCAAACAACTGGCATCGAGAACAGTAAAACACCGCAGAATTCTGCAGATTGTACCTACAACCTCAGCAGCACTCTGACACTGACCAGCACACAGTACAACAGCCACAAAGAGTACACCTGCAAGGTGACCCAGGGCACGACCTCAGTCGTCCAGAGCTTCAATAGGGGTGACTGTtaa (SEQ ID NO.6); 2) The VL nucleotide sequence of the R004 antibody obtained by sequencing and analysis is: GATGTCGTGCTGACCCAGACTGCATCTCCCGTGTCTGCAGCTGTGGGAGGCACAGTCACCATCAGTTGCCAGGCCAGTCAAAGTGTTTATAATAACAACCTCTTATCCTGGTTTCAGCAGAAACCAGGGCAGCCTCCCAAGCGCCTGATCTACAAGGCTTCCACTCTGGCATCTGGGGTCCCATCGCGGTTCAAGGGCAGTGGATCTGGGACACAGTTCACTCTCACCATCAGCGACGTGCAGTGCGACGATGCTGCCACTTACTACTGTGCAGGCGGTTATGATAGTCCTAGTGATAATGCTTTCGGCGGAGGGACCGAGGTGGTCGTCAAAGGGGATCCAGTTGCACCTACTGTCCTCATCTTCCCACCAGCTGCTGATCAGGTGGCAACTGGAACAGTCACCATCGTGTGTGTGGCGAATAAATACTTTCCCGATGTCACCGTCACCTGGGAGGTGGATGGCACCACCCAAACAACTGGCATCGAGAACAGTAAAACACCGCAGAATTCTGCAGATTGTACCTACAACCTCAGCAGCACTCTGACACTGACCAGCACACAGTACAACAGCCACAAAGAGTACACCTGCAAGGTGACCCAGGGCACGACCTCAGTCGTCCAGAGCTTCAATAGGGGTGACTGT (SEQ ID NO.7) The sequence information of the VL used for constructing the R004 antibody expression vector is as follows: AtgggctggtccctgattctgctgttcctggtggctgtggctaccagggtgctgagtGATGTCGTGCTGACCCAGACTGCATCTCCCGTGTCTGCAGCTGTGGGAGGCACAGTCACCATCAGTTGCCAGGCCAGTCAAAGTGTTTATAATAACAACCTCTTATCCTGGTTTCAGCAGAAACCAGGGCAGCCTCCCAAGCGCCTGATCTACAAGGCTTCCACTCTGGCATCTGGGGTCCCATCGCGGTTCAAGGGCAGTGGATCTGGGACACAGTTCACTCTCACCATCAGCGACGTGCAGTGCGACGATGCTGCCACTTACTACTGTGCAGGCGGTTATGATAGTCCTAGTGATAATGCTTTCGGCGGAGGGACCGAGGTGGTCGTCAAAGGGGATCCAGTTGCACCTACTGTCCTCATCTTCCCACCAGCTGCTGATCAGGTGGCAACTGGAACAGTCACCATCGTGTGTGTGGCGAATAAATACTTTCCCGATGTCACCGTCACCTGGGAGGTGGATGGCACCACCCAAACAACTGGCATCGAGAACAGTAAAACACCGCAGAATTCTGCAGATTGTACCTACAACCTCAGCAGCACTCTGACACTGACCAGCACACAGTACAACAGCCACAAAGAGTACACCTGCAAGGTGACCCAGGGCACGACCTCAGTCGTCCAGAGCTTCAATAGGGGTGACTGTtaa (SEQ ID NO.8).

[0033] 3) The VH nucleotide sequence of the R003 antibody obtained by sequencing and analysis is: The VH sequence information used to construct the R003 antibody expression vector is as follows: 4) The VH nucleotide sequence of the R004 antibody, obtained through sequencing and analysis, is as follows: The VH sequence information used to construct the R004 antibody expression vector is as follows: 5) PCR system reaction conditions:

[0034] The primer sequences are shown in the table below:

[0035] The PCR amplification program is shown in the table below, where steps 2-4 are repeated 30 times:

[0036] After the reaction was completed, the PCR products were detected by 1% agarose gel electrophoresis, and the target fragments were recovered at the corresponding lengths.

[0037] 6) Recombinant plasmid digestion: The pABm-rFC vector was double-digested with EcoRV / EcoRV, and the double digestion system is shown in the table below.

[0038]

[0039] After mixing the above enzyme digestion system, place it in a 37°C water bath for 15 min, and then perform gel extraction and recovery.

[0040] The vector recovered from gel cutting was ligated with the target fragment using recombinase and reacted at 50°C for 15-20 min. The reaction system (20 μL) is shown in the table below.

[0041]

[0042] 7) Transformation: Transform the ligation system into DH5α competent cells. The specific steps are as follows: Take one tube of competent cells from a -80℃ freezer and immediately place it on ice; add the ligation system (volume not exceeding 10 μL), mix gently, and place on ice for 30 min; accurately heat shock in a 42℃ water bath for 90 s, and then quickly place on ice to cool for 3-5 min; add 1 mL of LB liquid medium (without antibiotics) to the tube, mix well, and incubate at 37℃ and 200 rpm for 1 h to allow the bacteria to return to normal growth; centrifuge the above bacterial culture, remove 800 μL of supernatant, and aspirate and mix the remaining medium, then spread it onto a selection plate containing the appropriate antibiotic; invert the culture dish and incubate at 37℃ for 16-24 h; pick bacteria from the transformed plate and incubate overnight at 37℃ with shaking on LB liquid medium.

[0043] 8) Identify positive clones: Take an appropriate amount of the bacteria after overnight culture at 37°C with shaking and sequence them.

[0044] 9) Large-scale extraction of recombinant plasmids: The bacterial strains with successfully constructed plasmids were inoculated into LB liquid medium and cultured at 37°C with shaking for 12-24 h; plasmid DNA was extracted from the bacterial culture using an endotoxin-free plasmid large-scale extraction kit.

[0045] 10) Cell Culture and Protein Expression: HEK293 cells were passaged in serum-free CD medium (293). The plasmid to be expressed was mixed with transfection reagent TF2 and added to the cells. Serum-free CD medium (293) was added on days 1, 3, and 5 post-transfection. Shake flask culture conditions: 5% CO2, temperature 37℃, shaker speed 175 rpm. Reactor culture conditions: pH 7.2, temperature 37℃, stirring speed 150 rpm, dissolved oxygen 40%.

[0046] 11) Protein purification: ① Collect the cell supernatant after culture and centrifuge it in a low-temperature centrifuge (5000 rpm, 30 min, 4℃), retaining the supernatant; ② Filter the centrifuged supernatant through a 0.45 μm filter membrane; ③ Add 5 mL of Protein G packing material to the filtered sample, incubate at 4℃ for 2 h, and then purify the protein using a chromatography column. The steps are as follows: Flow the incubated sample through the chromatography column at a rate of 1 mL / min; equilibrate the column with Buffer A; Buffer A: PBS, pH 7.4; elute with 0.1 M glycine (pH 2.7, adjusted to neutral with 2 M Tris, pH 9.0); analyze the eluted samples using SDS-PAGE gel to determine if the target protein is present; ④ Collect the eluted protein, dialyze it into PBS buffer (pH 7.4), incubate overnight at 4℃, and detect the purity of the target protein using SDS-PAGE gel.

[0047] 1.3 The results of ELISA detection of candidate antibodies are shown in Table 2.

[0048] The results showed that the value of R004 binding to PP2Ac(I) (1.331) was significantly higher than that of PP2Ac(NO I) (0.3564), indicating that its specific binding effect was better than that of R003, suggesting that R004 is an antibody against iodinated PP2Ac.

[0049] In this embodiment, antibody R004 obtained in Example 1 of the present invention was used to perform immunohistochemical experiments on mouse brain tissue. The specific operation steps are as follows: (1) Paraffin sections were routinely dewaxed and then placed in distilled water for 5 minutes to hydrate.

[0050] (2) Place the slides in the antigen retrieval solution and soak them at 94°C for 20 min. Then allow the slides to cool naturally to room temperature and wash them three times with PBS.

[0051] (3) Add 3% hydrogen peroxide, incubate at room temperature for 5 min, and then wash 3 times with PBS.

[0052] (4) Add blocking solution and seal at 37°C for 30 min.

[0053] (5) Add the diluted antibody R004 at a concentration of 4 μg / mL, incubate overnight at 4°C, and wash three times with PBS.

[0054] (6) Add the secondary antibody diluted at 1:1000, incubate at 37°C for 30 min, and then wash three times with PBS.

[0055] (7) Add DBA colorimetric solution and examine the colorimetric effect under a microscope at room temperature.

[0056] (8) After rinsing the surface of the slide with water, immerse the slide in a hematoxylin staining tank. After staining, remove the slide and rinse with water. Then, place the slide in 1% hydrochloric acid alcohol for differentiation and immediately remove it, then rinse the slide with water.

[0057] (9) Soak the sections in 90% ethanol and anhydrous ethanol in sequence, gently dry the alcohol remaining on the tissue surface with a hair dryer, and then mount them with resin.

[0058] The dyeing effect is shown in the attached image. Figure 1 As shown, from Figure 1 As can be seen from the results, antibody R004 of this invention can specifically detect the expression of iY307-PP2Ac, with accurate localization, clear staining, and no non-specific staining. Therefore, antibody R004 can be used for immunohistochemical analysis.

[0059] Example 3: Antibodies used for high-content cell imaging analysis This embodiment uses high-content cell imaging, i.e., cell immunofluorescence verification, to verify the R004 antibody obtained in Embodiment 1 of the invention. The specific operation steps are as follows: (1) Instruments and reagents: High-content cell imaging analysis system (ImageXpress, Molecular Devices); Fixative: 4% tissue cell fixative (Solarbio, P1110); Permeabilization solution: PBS containing 0.25% Triton X-100; Blocking solution / antibody dilution: QuickBlock blocking solution (Beyotime, P0260); Anti-rabbit IgG (H+L), F(ab')2 Fragment (Alexa Fluor® 647 Conjugate) (Cell signaling technology, 4414), Hoechst 33342 StainSolution (Solarbio, C0031).

[0060] (2) Culture of SH-SY5Y cells (human neuroblastoma cells) and analysis of iodination modification at tyrosine site 307 of PP2Ac protein 1) SH-SY5Y cell resuscitation and passage: Thaw cells rapidly by shaking in a 37℃ water bath, add 9 mL of preheated SH-SY5Y cell culture medium (Procell, CM-0208) and mix well. Centrifuge at 1000 rpm for 5 min, discard the supernatant, add 4-6 mL of complete culture medium, and then add the cell suspension to a T25 culture flask and culture for 24-48 h, changing the medium and checking the cell density during this period.

[0061] 2) When cell confluence reaches 80% or higher, passage culture can be performed. After washing the cells with PBS, add 1 mL of pre-warmed 0.25% trypsin digestion solution, incubate at 37 ℃ for 1 min, and then add 3 mL of complete culture medium to stop the digestion. Gently pipette the cells off the flask wall to completely detach them, then collect the cell suspension, centrifuge at 1000 rpm for 5 min, discard the supernatant, resuspend the cells in complete culture medium, and then passage.

[0062] 3) Once the cells have grown to a sufficient quantity, collect the cells and determine the cell density at 2 × 10⁶ cells per well. 5 Cells were seeded into black 96-well plates at a density of 1 cell per well and incubated in a cell culture incubator at 37 ℃ and 5% CO2 for 48 h.

[0063] 4) Cell fixation: After washing the cells with PBS 2-3 times, add 100 μL of fixative to each well and fix at room temperature for 15 min.

[0064] 5) Cell washing: After fixation, wash with permeabilizing solution, 200 μL per well, and shake twice.

[0065] 6) Permeation: Add 200 μL of permeation solution to each well and permeate at room temperature for 15 min.

[0066] 7) Blocking: Add 100 μL of blocking solution to each well and incubate at room temperature for 15 min.

[0067] 8) Primary antibody incubation: Discard the blocking solution, add 50 μL of R004 antibody (5 μg / mL) prepared with antibody dilution buffer to each well, and incubate overnight at 4°C.

[0068] 9) Secondary antibody incubation: After washing 3 times with permeation buffer, prepare a mixed staining solution of fluorescent secondary antibody (1:1000) and Hoechst (1:100) with antibody dilution buffer, add 50 μL to each well, and incubate at room temperature in the dark for 1 h.

[0069] 10) High Content Cell Detection: After washing three times with permeabilization buffer, add 200 μL of Flurbrite DMEM and immediately use a high content cell imaging analysis system for detection. During imaging, select both the DAPI and FITC channels for detection, with an exposure time of 10 ms for the DAPI channel and 100 ms for the FITC channel. Set nine fields of view per well for image acquisition and analysis of cell staining results.

[0070] The dyeing effect is shown in the attached image. Figure 2 As shown in Figure A, the staining effect of antibody R004 is excellent. The staining of iY307-PP2Ac in the cells is very clear with no non-specific staining and a clean background. Furthermore, this invention used different concentrations of diluted R004 antibody to stain SH-SY5Y cells, and the results are attached. Figure 2 As shown in Figure B, the average staining area of ​​iY307-PP2Ac increases with increasing R004 antibody concentration. Based on the staining effect analysis, this invention recommends an antibody concentration of 5 μg / mL for cell immunofluorescence staining.

[0071] (1) Instruments and reagents: Non-contact ultrasonic disruptor (QSonica, Q800R3), iBlot2 dry transfer system (ThermoFisher, IB21001), 10× cell lysis buffer (Cell Signaling Technology, 9803S), protease inhibitor (Roche, 04693116001), BCA protein assay kit (ThermoFisher, 23227), 3× Blue Loading Buffer (CST, 56036S), 10× TBST (Cell Signaling Technology, 9997S), 20× MOPS / SDS electrophoresis buffer (Sangon Biotech, C506051), 4-12% Bis-Tris denaturing precast gel (ThermoFisher, NP0322BOX), high-sensitivity luminescent solution (ThermoFisher, 34095), Anti-rabbit IgG, HRP-linked Antibody (Cell Signaling Technology, 7074).

[0072] (2) Protein extraction from SH-SY5Y cells and analysis of iodination modification at site 307 of PP2Ac protein 1) After culturing SH-SY5Y cells in a 10 cm dish for 48 h as described in Example 3, the culture medium was discarded, the cells were washed twice with PBS, and 500 μL of 1× cell lysis buffer containing protease inhibitors was added on ice. After equilibration for 3 min, the cells were gently scraped off and collected into EP tubes.

[0073] 2) After sonicating the cells at 4℃, centrifuge at 12000 rpm at 4℃ for 15 min, take the supernatant protein solution for protein quantification analysis, and adjust the sample protein concentration to 1.5 μg / μL.

[0074] 3) Mix the protein extract with 3×Blue Loading Buffer, adjust the protein concentration to 1 μg / μL, mix well, heat at 100℃ for 5 min, and cool on ice.

[0075] 4) Protein samples were separated using a 4-12% Bis-Tris denaturing pregel and transferred onto a membrane using the iBlot2 dry transfer system.

[0076] 5) Incubate with 5% skim milk at room temperature for 1 h, then incubate the membrane with 1 μg / mL of R004 primary antibody diluted with 3% skim milk overnight at 4°C.

[0077] 6) After washing the membrane 6 times with 1×TBST, incubate it with the secondary antibody at room temperature for 1 h, and then repeat the washing step with 1×TBST.

[0078] 7) After adding the highly sensitive luminescent solution, the membrane was developed using a gel imaging analysis system. Finally, ImageJ (1.53c) software was used for grayscale quantitative analysis of the protein bands.

[0079] The results are attached. Figure 3 As shown, antibody R004 exhibits good recognition specificity in Western blotting. The results show that antibody R004 precisely binds to the iY307-PP2Ac protein in SH-SY5Y cells, with a clear protein band background and no obvious non-specific bands. Furthermore, its molecular weight is around 36 kDa, consistent with the molecular weight of the PP2Ac protein. Therefore, antibody R004 can be used for Western blotting analysis.

[0080] The above description, in conjunction with specific embodiments, provides a further detailed explanation of the present invention. It should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, several simple deductions or substitutions can be made without departing from the concept of the present invention, and all such deductions or substitutions should be considered to fall within the scope of protection defined by the claims submitted herein.

Claims

1. A monoclonal antibody against tyrosine-iodinated PP2Ac protein, characterized in that, The nucleotide sequence of the monoclonal antibody is shown in SEQ ID NO.

3.

2. A monoclonal antibody against tyrosine-iodinated PP2Ac protein, characterized in that, The amino acid sequence of the monoclonal antibody is shown in SEQ ID NO.

4.

3. A nucleic acid vector, characterized in that, The nucleic acid vector contains a nucleic acid sequence of a monoclonal antibody fragment of tyrosine-iodinated modified PP2Ac protein, as shown in SEQ ID NO.7 or SEQ ID NO.

11.

4. A method for preparing an iodide-modified PP2Ac protein monoclonal antibody, characterized in that, The method includes recombinantly expressing a vector containing a light chain fragment and a heavy chain sequence fragment of a monoclonal antibody containing the PP2Ac protein; preferably, the sequence of the light chain fragment of the monoclonal antibody containing the PP2Ac protein is shown in SEQ ID NO.7; and the sequence of the heavy chain fragment of the monoclonal antibody containing the PP2Ac protein is shown in SEQ ID NO.

11.

5. The application of an iodide-modified PP2Ac protein monoclonal antibody in a kit preparation method, characterized in that, The kit includes the monoclonal antibody as described in claim 1 or claim 2, and the kit is used to bind the monoclonal antibody to the PP2Ac protein in a sample to detect whether the tyrosine residue at position 307 of the PP2Ac protein is iodinated.

6. The application of an iodide-modified PP2Ac protein monoclonal antibody in the preparation of an immunoassay kit, characterized in that, The kit includes the monoclonal antibody as described in claim 1 or claim 2, and the immunoassay includes one or more of immunohistochemistry, immunocellular imaging, immunochemiluminescence, immunofluorescence, ELISA, immunolateral flow, immunoelectrochemistry, and fluorescence resonance energy transfer (FRET).

7. The application according to claim 6, characterized in that, The samples for immune testing can be one or more of the following: blood, plasma, serum, cells, tissue, feces, urine, and saliva.

8. The application according to claim 7, characterized in that, The immune test is used for tumors or Alzheimer's disease.

9. A reagent for detecting iodinated PP2Ac protein, characterized in that, The reagent comprises a monoclonal antibody that specifically binds to the 307-position tyrosine iodide-modified PP2Ac protein, the amino acid sequence of which is shown in SEQ ID NO.

4.

10. A kit for detecting iodinated PP2Ac protein, characterized in that, The reagent comprises a monoclonal antibody that specifically binds to the 307-position tyrosine iodide-modified PP2Ac protein, the amino acid sequence of which is shown in SEQ ID NO.4.