Chryseobacterium ziniae TR-6 and application thereof in preventing and treating rice blast

Abstract

This invention discloses a strain of *Chlorella vulgaris* TR-6 without phospholipase and its application in the control of rice blast, relating to the field of microbial technology. The preservation number of *Chlorella vulgaris* TR-6 is CCTCC NO: M 2026492. *Chlorella vulgaris* TR-6 significantly inhibits the growth of rice blast fungus and significantly inhibits the formation of appressoria of the pathogen. Its application in the control of rice blast shows good biocontrol efficacy and high safety, with no negative effects on rice germination and growth, and can even promote rice seedling growth. The application of this invention can significantly reduce the use of biochemical agents in the treatment of rice diseases.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and more specifically to a strain of phospholipase-free Chrysophagus TR-6 and its application in the prevention and control of rice blast. Background Technology

[0002] By the semi-living nutritional pathogenic fungus rice blast fungus ( Magnaporthe oryzae Rice blast, caused by [unspecified pathogen], can lead to severe yield losses or even total crop failure if it occurs on a large scale. Taxonomically, it belongs to the kingdom Fungi, phylum Ascomycota ([unspecified phylum]). Ascomycota ) Class of Fibromycetes ( Sordariomycetes Pyrenaceae ( Pyriculariaceae The rice blast fungus initiates primary infection via conidia. Under high humidity, the spores adhere to the hydrophobic epidermis of rice leaves, germinate, and form polar germ tubes that specialize into melanized appressorium. These appressoriums accumulate glycerol, generating turgor pressure that allows them to mechanically penetrate the host epidermal tissue. Once inside the host cells, the infecting hyphae induce cell necrosis, lesion formation, and the production of new conidia for reinfection, continuously triggering disease outbreaks under suitable environmental conditions. Therefore, inhibiting appressorium formation can effectively reduce infection rates.

[0003] Biological control overcomes the drawbacks of chemical control and aligns with the principles of environmentally friendly and green pest control. It utilizes beneficial microorganisms or their metabolic products to inhibit pathogen infection, achieving the goal of reducing disease occurrence in an environmentally friendly, non-toxic, residue-free, and cost-effective manner. This is a significant method for plant disease control. However, currently, there is a scarcity of biocontrol strains that target the formation of appressoriums in rice blast disease to block infection, creating an urgent market demand.

[0004] Therefore, providing biocontrol strains for the prevention and control of rice blast is a technical problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides a strain of lecithinase-free Chrysobacterium TR-6, which has a good inhibitory effect on the formation of appressorium by rice blast pathogen and is a biocontrol strain with great development potential.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A strain of lecithinase-free Chrysophagium ( Chryseobacterium lecithinasegens TR-6, the lecithinase-free *Chlorella vulgaris* TR-6, with accession number CCTCC NO: M 2026492, was deposited on March 23, 2026, at the China Center for Type Culture Collection, Wuhan University, Wuhan, China. (Classification and nomenclature are not provided in the original text.) Chryseobacterium lecithinasegens TR-6.

[0008] Preferably, the phospholipase-free Chrysophagus TR-6 inhibits the growth of rice blast fungus and / or inhibits the formation of appressorium.

[0009] Another object of the present invention is to provide a microbial inoculant comprising the above-mentioned phospholipase-free Chrysophagus TR-6 or its fermentation supernatant.

[0010] Another object of the present invention is to provide the application of the above-mentioned lecithinase-free Chrysophagus TR-6 or the above-mentioned microbial agent in the prevention and control of rice blast disease.

[0011] Another object of the present invention is to provide a planting method for preventing and controlling rice blast, wherein the rice seeds are soaked with the above-mentioned microbial agent, and / or the rice leaves are sprayed with the above-mentioned microbial agent during the rice seedling stage.

[0012] Another object of the present invention is to provide the application of the above-mentioned phospholipase-free Chrysophagium in increasing the dry weight of rice.

[0013] Beneficial effects: The lecithinase-free *Cyclocarya paliurus* TR-6 provided by this invention significantly inhibits the growth of rice blast fungus and significantly inhibits the formation of pathogen appressoria. Its application in the control of rice blast demonstrates good biocontrol efficacy and high safety, with no negative effects on rice germination and growth, and can even promote rice seedling growth. The application of this invention can significantly reduce the use of biochemical agents in rice disease control. Attached Figure Description

[0014] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0015] Figure 1 The colony morphology (A), Gram staining (B), and scanning electron microscope (C) images of the biocontrol strain TR-6 screened in this invention are shown below.

[0016] Figure 2 Phylogenetic tree of the 16S rRNA, gyrB, and rpoB genes of strain TR-6 of this invention, obtained by maximum likelihood method.

[0017] Figure 3 The inhibition of rice blast fungus by confrontation culture of strain TR-6 of this invention (A), and the colony diameter bar graph (B).

[0018] Figure 4The invention's strain TR-6, when cultured in CM (complete medium) and BY (beef extract yeast medium) at 20% fermentation supernatant, exhibits the following effects on rice blast fungus: A) inhibition of colony diameter; B) inhibition of colony diameter.

[0019] Figure 5 The inhibitory effects of 50% and 100% fermentation supernatants of strain TR-6 of the present invention on spore germination (4h) and appressorium formation (24h) of rice blast fungus, A (scale bar is 20μm), and the number of spores germinating and the number of appressorium forming, B.

[0020] Figure 6 The effects of the fermentation broth and supernatant of strain TR-6 of this invention on the control of barley blast fungus, A; the control effect of tricyclazole on barley blast fungus, B; and the disease inhibition rate, C.

[0021] Figure 7 The effects of the fermentation broth and supernatant of strain TR-6 of this invention on the control of rice blast fungus are: A. Effect of tricyclazole on the control of rice blast fungus; B. Disease inhibition rate.

[0022] Figure 8 The invention relates to the efficacy of TR-6 bacterial solution spraying and combined seed soaking and spraying in controlling rice blast fungus in the field. Detailed Implementation

[0023] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0024] The following examples further illustrate the content of the present invention, but should not be construed as limiting the present invention.

[0025] Example 1 Take rice plants in the booting stage, i.e., the stage of panicle blast infection, peel open the panicle, and remove the glumes. Place them in a 50 mL centrifuge tube, add PBS buffer, and elute by sonication. Centrifuge the eluent, discard the supernatant, and resuspend the eluent in 1 mL of PBS buffer. Spread the eluent suspension on the surface of LB agar plates, and after single colonies have grown, pick them and streak them for culture.

[0026] Twenty-one antagonistic biocontrol strains were obtained after isolation and purification. Among them, TR-6 was a pale yellow, glossy Gram-negative bacterium, and scanning electron microscopy showed that the bacterium was short rod-shaped (see appendix). Figure 1The 16S rRNA, gyrB, and rpoB specific sequences of the above strains were amplified by PCR, and the three gene sequences were ligated after Sanger sequencing. A phylogenetic tree was constructed using the maximum likelihood method after alignment. The results are shown in the appendix. Figure 2 The 16S rRNA amplification primers used were: 8F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO.1) and 1492R: GGTTACCTTGTTACGACTT (SEQ ID NO.2).

[0027] The sequence of the forward primer gyrB-F for amplifying the gyrB gene is GGNGTNAARTCNGCNGAYTAYAT (SEQ ID NO.3), and the sequence of the reverse primer gyrB-R is CANGCRTCNGMYTCNARYTCRTC (SEQ ID NO.4). The expected amplification product length is approximately 1,200 bp, and the annealing temperature is 52°C.

[0028] The forward primer rpoB-F used for amplification of the rpoB gene has the sequence AGACCCTACBAACTCTGARA (SEQ ID NO. 5), and the reverse primer rpoB-R has the sequence STGCTCTTTCYCTWGATAAAC (SEQ ID NO. 6). The expected amplification product length is approximately 572 bp, and the annealing temperature is 50°C.

[0029] The degenerate base symbols involved in the above primers are explained as follows: R represents A or G; Y represents C or T; B represents C, G, or T (i.e., not A); S represents G or C; W represents A or T; N represents any one of A, T, G, or C.

[0030] Based on the combined morphological and molecular biological identification results, TR-6 was ultimately identified as *Chlorella vulgaris*, a strain of which was deposited on March 23, 2026, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M2026492, and classified as... Chryseobacterium lecithinasegens TR-6.

[0031] Example 2 1. Antibacterial ability test The inhibitory effect of biocontrol bacteria on rice blast was verified using the plate confrontation method.

[0032] For bacterial activation and concentration adjustment, first add 5 mL of LB liquid culture medium to a sterile glass test tube. Using sterilized forceps, hold a sterile pipette tip, dip it into a small amount of biocontrol bacteria TR-6, transfer it into the LB liquid culture medium, and seal the tube. Incubate at 180 r•min. -1 The culture was incubated with shaking at 28℃ for 10 h. A portion of the activated bacterial solution was then taken out under aseptic conditions, diluted with sterilized ultrapure water, and analyzed using a spectrophotometer at an OD wavelength. 600 To perform the measurement, first use LB liquid culture medium to zero the absorbance of the bacterial culture medium to 0.5.

[0033] Confrontation culture between biocontrol bacteria and pathogenic fungi: Use a 5 mm punch to create mycelial cakes. Inoculate the pathogenic fungi to be tested into the center of CM solid medium. Use a pipette to draw 5 μL of antagonistic bacterial suspension and drop the suspension onto the left and right thirds of the plate. Seal the plate with sealing film and incubate at 28℃ in a biochemical incubator. (The text abruptly ends here, likely due to an incomplete sentence or missing information.) Magnaporthe oryzae After 7 days of cultivation, the size of the fungal growth was measured, and the inhibition rate was calculated compared with the control. Statistical data were then analyzed for significance. The results showed that TR-6 inhibited the rice blast fungus by 47.4% (see appendix). Figure 3 ).

[0034] The formula for calculating the inhibition rate is: Inhibition rate = (Control colony diameter - Treatment colony diameter) / (Control colony diameter - Mycelium cake diameter) × 100%.

[0035] 2. Determination of antibacterial activity of fermentation supernatant TR-6 strain was inoculated into complete medium (CM) and beef extract yeast (BY) medium, respectively, and cultured on a shaker at 28°C for 24 h or 48 h. After filtration using a 0.22 μm bacterial filter, the fermentation supernatant was added to 45°C PDA medium at a ratio of 20%, i.e., 40 mL of fermentation broth was added to 200 mL of medium. After the plates solidified, they were then inoculated with rice blast fungus. Magnaporthe oryzae Mycelial blocks were collected and the inhibition rate was measured and calculated after 7 days of growth. Results showed that the colony diameter after treatment with the supernatant of CM medium for 48 hours was significantly lower than the control, with an inhibition rate of 30.0%. (See appendix) Figure 4 ).

[0036] 3. Determination of the inhibitory effect of fermentation supernatant on conidial germination and appressorium formation TR-6 strain was inoculated onto CM medium and incubated at 28°C for 48 h. The fermentation supernatant was obtained by filtration through a 0.22 μm bacterial filter. The rice blast fungus spore suspension was collected by centrifugation and resuspended in either 5 mL or 10 mL of fermentation supernatant. For the 5 mL supernatant group, 5 mL of deionized water was added, resulting in a final spore concentration of 10 for both groups. 5Systems with cells / mL were designated as 50%FS (Fermentation Supernatant) and 100%FS, respectively.

[0037] Spore germination was assessed at 4 hours and appressorium formation at 24 hours. There was no significant difference in germination inhibition rate, but appressorium formation inhibition rates reached 54.2% and 99.7% respectively (see Appendix). Figure 5 ).

[0038] 4. Indoor testing for disease control in bacterial culture and fermentation supernatant TR-6 strain was inoculated into CM medium and incubated at 28°C for 24 and 48 hours with shaking. The fermentation broth was adjusted to OD. 600 =0.5, to obtain the bacterial solution to be tested; filter the bacterial solution using a bacterial filter to obtain the fermentation supernatant.

[0039] After centrifuging and collecting the rice blast fungus spore suspension, it was resuspended in 5 mL of bacterial culture and fermentation supernatant, respectively, and then brought to a final volume of 10 mL with deionized water to ensure a final spore concentration of 10%. 5 The system was prepared by obtaining a spore suspension of rice blast fungus containing 50% bacterial solution and a spore suspension of rice blast fungus containing 50% fermentation supernatant.

[0040] Leaves of barley (5 days) and the susceptible rice variety Co39 (14 days) were sprayed separately. Disease incidence was assessed in barley and rice at 4 and 5 days later, and lesion area was measured. Barley and rice leaves treated with the same concentration of rice blast fungus spore solution served as controls. The inhibition rates of disease on barley by the fermented inoculum and fermentation supernatant after 24 hours were 64.9% and 54.1%, respectively; the inhibition rates after 48 hours were 91.4% and 87.2%, respectively (see Appendix). Figure 6 The inhibition rates of rice Co39 disease on fermentation broth and fermentation supernatant after 24 hours were 58.3% and 44.9%, respectively; the inhibition rates after 48 hours were 88.9% and 79.0%, respectively (see Appendix). Figure 7 ).

[0041] 5. Safety test of strain TR-6 on rice seed germination and seedling growth Seed germination experiment: Before conducting the seed germination experiment, the bacteria must first be activated. A small amount of a single colony of the biocontrol strain TR-6 is dipped into 5 mL of LB liquid medium and incubated at 180 r•min. -1 Shake at 28℃ for 10 hours. Under aseptic conditions, take a portion of the activated bacterial solution and dilute it with sterilized ultrapure water to adjust the OD. 600=0.5, the control was adjusted to LB liquid culture medium solution, and the dilution ratio was recorded. Seed disinfection involved soaking in 70% ethanol for 1 min, followed by rinsing with sterile water, then soaking in 2% sodium hypochlorite for 20 min. After multiple rinses with sterile water, 25 mL of ultrapure water was added to an Erlenmeyer flask, with 100 mg of carboxymethyl vitamin added to every 25 mL of solution. An appropriate amount of bacterial solution was added according to the previously adjusted ratio, and 300 soaked seeds were poured in. The mixture was incubated at 150 rpm. -1 The seeds were shaken at 28℃ for 10 h, then incubated in a moist glass petri dish. Germination was observed and recorded after 7 days, and significance analysis was performed. The results showed that the TR-6 strain treatment had no adverse effect on rice seed germination.

[0042] Seedling growth promotion experiment: Seedlings that germinated in the seed germination experiment were transplanted into sterilized soil. After growing under suitable conditions for 30 days, their fresh weight, dry weight, plant height, and root length were recorded and significance analysis was performed. The results showed that the TR-6 strain treatment had a significant promoting effect on the dry weight of rice. It had no adverse effects on germination rate, fresh weight, and root length (see Table 1).

[0043] Table 1

[0044] 6. Control effect in field trials In 2025, pesticides were applied to rice (Fengliangyou 4, a blast-susceptible variety) during the seedling stage. The experimental field was located in the blast identification nursery in Wangjia Village, Yuan'an County, Yichang City. Three replicate plots were randomly assigned to each treatment within the same field, allowing for natural disease development. Application was carried out around 16:00. There was no rainfall on the day of application, the temperature was 27℃~37℃, and the southwest wind was at level 2, suitable for application. A second application was conducted one week later. The experiment included three treatments (water control, TR-6 spray treatment, and a combination of TR-6 seed soaking and spraying), with each treatment replicated three times, for a total of nine plots. Isolation rows were set up between different treatments to prevent cross-contamination between different pesticides.

[0045] Leaf blast was investigated at the late tillering stage. A five-point sampling method was used, with five rice clumps sampled at each point in a straight line. One diseased rice plant was randomly selected from each clump, and the total number of green leaves and the number of diseased leaves were determined. The grading criteria for leaf blast are as follows: Grade 0: No disease; Grade 1: Few and small lesions, covering less than 1% of the leaf area; Grade 3: Small and numerous lesions, or large and few lesions, covering 1% to 5% of the leaf area; Grade 5: Large and numerous lesions, covering 5% to 10% of the leaf area; Grade 7: Large and numerous lesions, covering 10% to 50% of the leaf area; Grade 9: Lesions covering more than 50% of the leaf area, the entire leaf will wither and die.

[0046] The results showed that both the TR-6 spray treatment and the combined seed soaking spray treatment could significantly reduce the occurrence of rice blast, with average control efficacy of 69.5% and 76.6%, respectively.

[0047] Table 2. Field trial efficacy survey of biocontrol bacteria TR-6 against rice blast fungus.

[0048] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0049] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A strain of Chlorella vulgaris without phospholipase ( Chryseobacterium lecithinasegens TR-6, characterized in that, The preservation number of the phospholipase-free Chrysophagus TR-6 is CCTCC NO: M 2026492.

2. The lecithinase-free Chrysobacterium TR-6 according to claim 1, characterized in that, The phospholipase-free Chrysophagus TR-6 inhibits the growth of rice blast fungus and / or inhibits the formation of appressorium.

3. A microbial inoculant, characterized in that, Includes the phospholipase-free Chrysophagus TR-6 of claim 1 or its fermentation supernatant.

4. The application of the lecithinase-free Chrysophagus TR-6 of claim 1 or 2 or the microbial agent of claim 3 in the prevention and control of rice blast.

5. A planting method for preventing and controlling rice blast, characterized in that, Rice seeds can be soaked with the microbial agent described in claim 3, and / or rice leaves can be sprayed with the microbial agent described in claim 3 during the rice seedling stage.

6. The application of the phospholipase-free Chrysophagium oryzae TR-6 as described in claim 1 or 2 in increasing the dry weight of rice.

Images