Measurement system

Abstract

To provide a system for performing measurements on a biological subject by breaching a functional barrier of the subject using microstructures.SOLUTION: There is provided a system for performing measurements on a biological subject, the system including: at least one substrate 311 including a plurality of plate microstructures 312, 314 configured to breach a stratum corneum of the subject; at least one sensor 321 operatively connected to at least one microstructure, the at least one sensor being configured to measure response signals from the at least one microstructure; and one or more electronic processing devices. The one or more electronic processing devices are configured to determine measured response signals, and perform at least one of: provision of an output based on measured response signals, at least partial analysis using the measured response signals; and, storage of data at least partially indicative of the measured response signals.SELECTED DRAWING: Figure 3A

Description

[Technical Field]

[0001] The present invention relates to systems and methods for performing measurements on living objects, and in one particular example, to performing measurements on living objects by using microstructures to breach functional barriers in the objects. [Background technology]

[0002] Reference herein to any prior publication (or information derived therefrom) or known matter is not, and should not be taken as, an acknowledgment or admission, or any form of suggestion, that the prior publication (or information derived therefrom) or known matter constitutes part of the common general knowledge in the field of endeavor to which this specification pertains.

[0003] Biological markers, such as proteins, antibodies, cells, small chemicals, hormones, and nucleic acids, the presence of which can indicate a disease state in excess or insufficiency, are found in serum, and their levels are routinely measured for research and clinical diagnostics. Standard tests include antibody assays to detect infections, allergic reactions, and blood-borne cancer markers (e.g., prostate-specific antigen assays to detect prostate cancer). Biological markers can originate from many organ systems in the body, but are extracted from one compartment: venous blood.

[0004] However, this is not suitable for all conditions as blood often does not contain important biological markers of diseases that occur in solid tissues, and although this problem has been partially overcome by performing tissue biopsies, these can be time-consuming, painful, risky, expensive and require highly skilled personnel such as surgeons.

[0005] Another serum-rich fluid is interstitial fluid (ISF), which fills the intercellular spaces of solid tissues and facilitates the passage of nutrients, biomarkers, and waste products through the bloodstream.

[0006] Patent Document 1 describes a device for delivering bioactive materials and other stimuli to living cells, a method for manufacturing the device, and various uses of the device, including several medical applications. The device includes multiple structures that can penetrate the body surface to deliver the bioactive material or stimuli to the required site. The structures are typically solid, and the delivery end section of the structure is sized so that it can be inserted into the target cell to deliver the bioactive material or stimuli without causing significant damage to the target cell or a specific site therein.

[0007] The use of microneedle versions of such arrays in fluid sampling is also known, but these techniques focus on the use of microfluidic techniques such as capillary action or pumping to extract fluids, as described, for example, in U.S. Patent Nos. 5,629,999; 5,729,999; 5,729,999; 5,729,999; and 5,829,090.

[0008] However, these systems suffer from several drawbacks. First, the use of capillary or pumping action can only be achieved using relatively large structures, which typically penetrate the dermis and may result in the sampling of blood rather than interstitial fluid. This may also cause discomfort or irritation to the subject being sampled. Second, the need for capillary or pumping action complicates the construction of the array and requires a power source, resulting in arrays that are difficult to manufacture, expensive, and prone to infection, making them unsuitable for general use.

[0009] Other in vitro diagnostic devices are known, such as arrays containing silicon nanowires for detection or the use of other complex detection mechanisms such as direct radiofrequency detection of nucleotide hybridization. The fabrication of such systems is also complex and expensive, making them unsuitable for practical applications.

[0010] Patent Document 10 describes that a device and system for measuring and / or monitoring an analyte present on the skin are provided. The system includes a skin-wearable device that can be attached to the external skin surface and a reader device. The skin-wearable device includes a substrate, a plurality of microneedles, and a nanosensor. The microneedles are attached to the substrate such that attachment of the substrate to the external skin surface causes the microneedles to penetrate the epidermis, an interlayer of the skin, or the dermis. The nanosensor includes a detectable label and is configured to interact with a target analyte present in interstitial fluid of the epidermis, an interlayer of the skin, or the dermis. The reader device is configured to detect the analyte in the interstitial fluid via interaction with the skin-wearable device.

[0011] Patent Document 11 describes a system and method for revitalizing aging skin using electromagnetic energy delivered using multiple needles that can penetrate the skin to a desired depth. A particular aspect of this invention is the ability to protect zones of tissue from heat exposure. This tissue protection allows new tissue to regenerate while heat treatment can contract collagen and tighten underlying structures. Additionally, this system can deliver therapeutically beneficial substances either through the penetrating needles or through channels created by the needle penetrations.

[0012] Patent Document 12 describes a method for delivering therapeutic or immunological treatment to a subject using an electric field by applying non-invasive, easy-to-use electrodes to the skin surface. Thus, therapeutic or immunological agents can be delivered to skin cells for local and systemic treatment or immunization with optimal gene expression and minimal tissue damage. In particular, therapeutic agents include naked or formulated nucleic acids, polypeptides, and chemotherapeutic agents.

[0013] Patent Document 13 describes a monitoring apparatus including a sensor device and an I / O device in communication with the sensor device that generates derived data using data from the sensor device. The derived data cannot be directly detected by an associated sensor. Alternatively, a device including a wearable sensor device and an I / O device in communication with the sensor device, the I / O device including a means for displaying information and a dial for inputting information. Alternatively, a device for tracking calorie intake and calorie expenditure data including a sensor device and an I / O device in communication with the sensor device. The sensor device includes a processor programmed to generate data regarding calorie expenditure from the sensor data. Alternatively, a device for tracking calorie information of an individual that utilizes multiple classification identifiers to classify meals consumed by the individual, each classification identifier having a corresponding calorie amount.

[0014] Patent Document 14 describes a method, system, and / or device for increasing the conductivity of an electrical signal through a subject's skin using one or more microneedle electrodes. The microneedle electrodes can be applied to the subject's skin by directly contacting the microneedle electrodes with the skin. The microneedles of the microneedle electrodes can be inserted into the skin such that the microneedles penetrate the stratum corneum to or through the dermis. Electrical signals pass or are conducted through or across the microneedle electrodes and the subject's skin, and the impedance of the microneedle electrodes is very small, significantly reduced compared to existing technologies.

[0015] US Patent No. 5,999,949 describes a device for use in detecting an analyte in a subject, the device comprising several structures provided on a patch such that application of the patch to the subject causes at least some of the structures to be inserted into the subject and target one or more analytes, and a reagent for detecting the presence or absence of the analyte.

[0016] Patent Document 16 describes that a device and system for measuring and / or monitoring an analyte present on the skin are provided. The system includes a skin-wearable device that can be attached to the external skin surface and a reader device. The skin-wearable device includes a substrate, a plurality of microneedles, and nanosensors encapsulated in the microneedles. The microneedles are attached to the substrate such that attachment of the substrate to the external skin surface causes the microneedles to penetrate the skin and contact interstitial fluid. The microneedles can include a sacrificial agent and are configured to become porous upon contact with a solvent, such as interstitial fluid, thereby dissolving at least a portion of the sacrificial agent. The nanosensor encapsulated in the microneedles includes a detectable label and is configured to interact with a target analyte present in the interstitial fluid. The reader device is configured to detect the analyte in the interstitial fluid via interaction with the skin-wearable device.

[0017] Patent Document 17 describes a biological information measuring device. The biological information measuring device includes a sensor portion and a needle portion including a plurality of needles protruding from a plurality of openings formed on the surface of the sensor portion. The plurality of needles is configured to penetrate tissue, and includes a biocompatible organic material including an enzyme member that reacts with an analytical material and a conductive polymer for transmitting an electrical signal generated as a result of the reaction of the enzyme member with the analytical material.

[0018] U.S. Patent No. 5,999,234 describes at least one microneedle comprising a hydrogel material containing a substance that fluoresces upon interaction with an analyte. The magnitude of the fluorescence varies as a function of the concentration of the analyte. During use, the hydrogel material is illuminated with illumination light in a first wavelength range while interfacing with the subject's dermal interstitial fluid layer, and a photosensor generates an output corresponding to the amount of light received in a second wavelength range.

[0019] Patent Document 19 discloses a biomedical monitor. The biomedical monitor has an array of movable microneedles coated with a first chemical sensing medium. The biomedical monitor also has an actuator configured to move at least one microneedle in the array of microneedles from a retracted position to an engaged position, thereby causing the at least one microneedle to enter the subject's skin. The biomedical monitor further has an optical system configured to illuminate the at least one microneedle during or after entry into the subject's skin and monitor the first chemical sensing medium from the at least one microneedle, thereby determining at least one biomedical characteristic based on at least one spectral characteristic of the monitored first chemical sensing medium. A method of monitoring at least one biomedical characteristic is also disclosed.

[0020] Patent Document 20 discloses methods, structures, and systems for biosensing and drug delivery technology. In one embodiment, a device for detecting analytes and / or releasing biochemicals into biological fluids may include an array of hollow needles, each needle including a protruding needle structure including an outer wall forming a hollow interior and an opening at the end of the protruding needle structure exposing the hollow interior, and a probe inside the outer wall that interacts with one or more chemical or biological substances that contact the probe through the opening to produce a probe detection signal; and an array of wires respectively connected to the probes of the hollow needle array, each wire being electrically conductive for transmitting the probe detection signal produced by the respective probe.

[0021] Patent Document 21 describes a transdermal microneedle continuous monitor system. This continuous system monitor includes a substrate, a microneedle unit, a signal processing unit, and a power supply unit. The microneedle unit includes at least a first microneedle set used as a working electrode and a second microneedle set used as a reference electrode, and the first and second microneedle sets are provided on a substrate. Each microneedle set includes at least a microneedle. The first microneedle set includes at least a sheet having through-holes with small spikes formed on its edge. One of the sheets provides the through-holes through which the small spikes on the edge of the other sheet pass, and the small spikes are spaced apart.

[0022] Patent Document 22 describes a biometric information measurement sensor that includes a base including a plurality of biomarker measurement areas and a plurality of electrodes. Each of the plurality of electrodes is disposed on a respective one of the plurality of biomarker measurement areas, and each of the plurality of electrodes includes a working electrode and a counter electrode spaced apart from the working electrode. The biometric information measurement sensor also includes a plurality of needles. Each of the needles is disposed on a respective one of the plurality of electrodes. Two or more of the plurality of needles have different lengths.

[0023] Patent document 23 describes a microneedle device (200) comprising at least one microneedle (1) having one or more nanowires (203) on the surface of said at least one microneedle, which is typically used in sensors such as sensors for monitoring glucose levels in the body, and the nanowires may have a membrane (207) covering at least a portion of the nanowire.

[0024] US Patent No. 5,949,999 describes a microneedle skin patch functionalized with carbon nanotubes coated with early diagnostic aptamers for various diseases.

[0025] Patent Document 25 describes a biomedical sensor device that includes a light source, a probe array, and a photodetector. The light source is configured to emit infrared light. The probe array is brought into contact with a user's skin to detect radio signals transmitted from the skin through the probe array. The probe array includes a substrate and a plurality of probes mounted on the substrate. The substrate and the probes are not opaque, allowing infrared light to be transmitted through the probe array into the skin. The photodetector is configured to detect the infrared signal by measuring infrared absorption by the skin.

[0026] Patent Document 26 describes a device for increasing the conduction of electrical signals through a subject's skin using one or more microneedle electrodes. The microneedle electrodes can be applied to the subject's skin by directly contacting the microneedle electrodes with the skin. The microneedles of the microneedle electrodes can be inserted into the skin so that they penetrate the stratum corneum to or through the dermis. Electrical signals pass or are conducted through or across the microneedle electrodes and the subject's skin, and the impedance of the microneedle electrodes is very small, significantly reduced compared to existing technologies.

[0027] Patent Document 27 describes a skin conformal sensor device and a method of using the same. In accordance with one or more embodiments, the sensor device includes an upper portion and a lower portion. The upper portion includes multiple layers including at least one sensor. The lower portion includes a microstructured layer configured and arranged to interface with a subject's skin and engage the skin with the at least one sensor.

[0028] Patent Document 28 describes a device for sampling at least one biological fluid component and measuring at least one target component in the biological fluid. The device has at least one microneedle with an open distal end used to penetrate the skin to a depth that minimizes pain and bleeding. The device further includes a hydrophilic gel within the microneedle for sampling the biological fluid component and an electrochemical cell for measuring the concentration of the target component in the sampled biological fluid component. In some embodiments, the electrochemical cell is integrated within the microneedle, thereby allowing the sampling and measuring steps to occur completely in situ. In other embodiments, the electrochemical cell is located external to the microneedle at the proximal end of the microneedle. Component sampling and measuring systems, methods, and kits are also provided.

[0029] Patent Document 29 describes a method for fabricating a diagnostic skin patch based on aptamer-coated microneedles and the resulting patch. This patch has the advantage of attaching a large number of aptamers, which are much smaller than antibodies, to the surface of a relatively large number of microneedle tips. This patch can simultaneously attach aptamers for various types of biomarkers, allowing for simultaneous detection of various types of materials (multiplexing). Therefore, the microneedle tip-based skin patch can also be used as a protein chip using aptamers. [Prior art documents] [Patent documents]

[0030] [Patent Document 1] International Publication No. 2005 / 072630 [Patent Document 2] U.S. Patent No. 6,923,764 [Patent Document 3] U.S. Patent No. 6,052,652 [Patent Document 4] U.S. Patent No. 6,591,124 [Patent Document 5] U.S. Patent No. 6,558,361 [Patent Document 6] U.S. Patent No. 6,908,453 [Patent Document 7] U.S. Patent Application Publication No. 2005 / 0261632 [Patent Document 8] US Patent Application Publication No. 2006 / 0264782 [Patent Document 9] U.S. Patent No. 6,589,202 [Patent Document 10] U.S. Patent No. 9,974,471 [Patent Document 11] U.S. Patent No. 20070142885 [Patent Document 12] U.S. Patent No. 6,972,013 [Patent Document 13] U.S. Patent No. 7,285,090 [Patent Document 14] U.S. Patent No. 20110295100 [Patent Document 15] International Publication No. 2009140735 [Patent Document 16] U.S. Patent No. 10,098,574 [Patent Document 17] U.S. Patent Application Publication No. 2016 / 0256091 [Patent Document 18] U.S. Patent Application Publication No. 2018 / 0177439 [Patent Document 19] U.S. Patent Application Publication No. 2007 / 0276211 [Patent Document 20] International Publication No. 2013058879A2 [Patent Document 21] U.S. Patent Application Publication No. 20150208984 [Patent Document 22] U.S. Patent Application Publication No. 2016 / 0302687 [Patent Document 23] U.S. Patent Application Publication No. 2016 / 0166184 [Patent Document 24] Korean Patent No. 20170041375 [Patent Document 25] U.S. Patent No. 8,543,179 [Patent Document 26] U.S. Patent No. 8,588,884 [Patent Document 27] U.S. Patent Application Publication No. 2016 / 0051195 [Patent Document 28] U.S. Patent Application Publication No. 2005 / 0261606 [Patent Document 29] International Publication No. 2018 / 124327 Summary of the Invention [Means for solving the problem]

[0031] In one broad form, aspects of the present invention seek to provide a system for performing measurements on a biological subject, the system including at least one substrate including a plurality of plate microstructures configured to penetrate the stratum corneum of the subject; at least one sensor operably connected to the at least one microstructure, the at least one sensor configured to measure a response signal from the at least one microstructure; and one or more electronic processing devices configured to determine the measured response signal and at least one of provide an output based on the measured response signal, perform an analysis at least in part using the measured response signal, and store data at least in part indicative of the measured response signal.

[0032] In one broad form, an aspect of the present invention seeks to provide a method for performing measurements on a biological subject, the method comprising the steps of using at least one substrate including a plurality of plate microstructures to penetrate the stratum corneum of the subject, using at least one sensor operably connected to the at least one microstructure, the at least one sensor being configured to measure a response signal from the at least one microstructure, and performing at least one of the following steps in one or more electronic processing devices: determining the measured response signal; providing an output based on the measured response signal; performing an analysis at least in part using the measured response signal; and storing data at least in part indicative of the measured response signal.

[0033] In one embodiment, the system includes a signal generator operably connected to the at least one microstructure for applying a stimulation signal.

[0034] In one embodiment, the one or more processing devices are configured to at least one of control the signal generator to cause measurements to be taken and control the signal generator according to the measured response signal.

[0035] In one embodiment, the response signal and the stimulus signal comprise electrical signals, and the substrate comprises electrical connections that allow the electrical signals to be applied to and / or received from the respective microstructures.

[0036] In one embodiment, the response signal and the stimulus signal comprise optical signals, and the substrate comprises optical connections that allow the optical signals to be applied to and / or received from the respective microstructures.

[0037] In one embodiment, the system includes one or more switches for selectively connecting at least one of the at least one sensor and the at least one signal generator to one or more of the microstructures.

[0038] In one embodiment, the one or more processing devices are configured to control the switches to at least one of enable at least one measurement to be taken and to control which microstructures are used to measure the response signal / apply the stimulus.

[0039] In one embodiment, the response signal is indicative of at least one of fluid level, visualization, mapping, mechanical properties, force, pressure, muscle movement, blood pulse wave, presence, absence, level or concentration of an analyte, blood oxygen saturation, tissue inflammation state, bioimpedance, biocapacitance, bioconductance, and electrical signals within the body.

[0040] In one embodiment, at least one of the substrate and the microstructure comprises at least one of a metal, a polymer, and silicon.

[0041] In one embodiment, the substrate is at least one of at least partially flexible, configured to conform to an outer surface of the functional barrier, and configured to conform to the shape of at least a portion of the object.

[0042] In one embodiment, the plate microstructure is at least partially tapered and has a substantially rounded rectangular cross-sectional shape.

[0043] In one embodiment, the microstructures include anchor microstructures used to secure the substrate to a subject, the anchor microstructures being at least one of: changing shape; changing shape in response to at least one of a substance in the subject and an applied stimulus; swelling; swelling in response to at least one of a substance in the subject and an applied stimulus; including anchoring structures; having a longer length than other microstructures; being rougher than other microstructures; having a higher surface friction than other microstructures; being blunter than other microstructures; being thicker than other microstructures; and penetrating the dermis.

[0044] In one embodiment, the microstructures are applied to the skin of a subject, and at least some of the microstructures at least one of penetrate the stratum corneum, enter the viable epidermis but not the dermis, and enter the dermis.

[0045] In one embodiment, at least some of the microstructures have at least one of a length that is less than 2500 μm, less than 1000 μm, less than 750 μm, less than 450 μm, less than 300 μm, less than 250 μm, about 250 μm, about 150 μm, greater than 100 μm, greater than 50 μm, and greater than 10 μm; a maximum width that is at least one of less than 2500 μm, less than 1000 μm, less than 750 μm, less than 450 μm, less than 300 μm, less than 250 μm, on the same order of magnitude as the length, greater than the length, greater than the length, about the same as the length, about 250 μm, about 150 μm, and greater than 50 μm; and a maximum thickness that is at least one of less than the width, significantly less than the width, less than the length, less than 300 μm, less than 200 μm, less than 50 μm, about 25 μm, and greater than 10 μm.

[0046] In one embodiment, at least some of the microstructures include at least one of a shoulder configured to abut the stratum corneum to control the depth of penetration, and a shaft extending from the shoulder to a tip, the shaft configured to control the position of the tip within the subject.

[0047] In one embodiment, the microstructure has a density of 5000 / cm 2 Less than 100 / cm 2 Over and about 600 / cm 2 and at least one of a spacing that is at least one of less than 1 mm, about 0.5 mm, about 0.2 mm, about 0.1 mm, and greater than 10 μm.

[0048] In one embodiment, at least some of the microstructures include electrodes.

[0049] In one embodiment, at least one electrode extends the length of a distal portion of the microstructure, extends the length of a portion of the microstructure spaced from the tip, is positioned proximate the distal end of the microstructure, is positioned proximate the tip of the microstructure, extends over at least 25% of the length of the microstructure, extends over less than 50% of the length of the microstructure, extends over approximately 60 μm of the microstructure, is configured to be placed within the living epidermis of a subject in use, and is configured to be placed within 200,000 μm of the living epidermis of a subject. 2 Less than 22,500 μm 2 , and at least 2,000 μm 2 At least one of the following has a surface area:

[0050] In one embodiment, at least some of the microstructures include at least a portion of an active sensor.

[0051] In one embodiment, at least some of the microstructures comprise an electrically conductive material.

[0052] In one embodiment, at least some of the microstructures include an insulating layer extending over at least one of a portion of the surface of the microstructure, the proximal end of the microstructure, at least half the length of the microstructure, approximately 90 μm of the proximal end of the microstructure, and at least a portion of the tip portion of the microstructure.

[0053] In one embodiment, at least some of the microstructures include plates having substantially planar surfaces that include at least one electrode.

[0054] In one embodiment, at least some of the microstructures are arranged in groups, and response signals are measured between the microstructures in the group, and / or stimuli are applied between the microstructures in the group.

[0055] In one embodiment, the groups are pairs of microstructures that include spaced apart plate microstructures having opposing substantially planar electrodes.

[0056] In one embodiment, at least some pairs of microstructures are angularly offset, at least some pairs of microstructures are orthogonal, adjacent pairs of microstructures are orthogonal, pairs of microstructures are arranged in rows and pairs of microstructures in one row are angularly offset relative to pairs of microstructures in another row, and pairs of microstructures are arranged in rows and pairs of microstructures in one row are orthogonal to pairs of microstructures in another row.

[0057] In one embodiment, the spacing between electrodes within each group is at least one of less than 10 mm, less than 1 mm, about 0.1 mm, and greater than 10 μm, and the spacing between groups of microstructures is at least one of less than 50 mm, greater than 20 mm, less than 20 mm, less than 10 mm, greater than 10 mm, less than 1 mm, greater than 1 mm, about 0.5 mm, and greater than 0.2 mm.

[0058] In one embodiment, the one or more microstructures interact with one or more analytes of interest such that the response signal depends on the presence, absence, level or concentration of the analytes of interest.

[0059] In one embodiment, the analyte interacts with a coating on the microstructure to change the electrical and / or optical properties of the coating, thereby allowing the analyte to be detected.

[0060] In one embodiment, the microstructure comprises materials including at least one of a bioactive material, a reagent for reacting with an analyte in a subject, a binder for binding to an analyte of interest, a material for binding one or more analytes of interest, a probe for selectively targeting analytes of interest, an insulator, a material that reduces biofouling, a material that attracts at least one substance to the microstructure, a material that repels or repels at least one substance from the microstructure, a material that attracts at least some analytes to the microstructure, and a material that repels or repels at least some analytes from the microstructure.

[0061] In one embodiment, the substrate comprises a plurality of microstructures, wherein different microstructures are at least one of differentially responsive to the analytes, responsive to different analytes, responsive to different combinations of analytes, and responsive to different levels or concentrations of analytes.

[0062] In one embodiment, at least some of the microstructures are at least one of attracting at least one substance to the microstructure, repelling or excluding at least one substance from the microstructure, attracting at least one analyte to the microstructure, and repelling or excluding at least one analyte from the microstructure.

[0063] In one embodiment, at least some of the microstructures are at least partially coated with a coating.

[0064] In one embodiment, at least some of the microstructures are uncoated, at least some of the microstructures are porous and include an internal coating, at least some of the microstructures are partially coated, different microstructures have different coatings, different portions of the microstructures include different coatings, and at least some of the microstructures include multiple coatings.

[0065] In one embodiment, the stimulus is used to at least one of release material from a coating on the microstructure, disrupt the coating, dissolve the coating, and peel the coating.

[0066] In one embodiment, at least some of the microstructures are coated with a selectively dissolvable coating.

[0067] In one embodiment, the coating is at least one of: interacts with an analyte; changes properties upon exposure to an analyte; changes shape to selectively anchor the microstructure; modifies surface properties to at least one of increase hydrophilicity, increase hydrophobicity, and minimize biofouling; attracts at least one substance to the microstructure; repels or excludes at least one substance from the microstructure; provides a physical structure to at least one of facilitate penetration of a barrier, strengthen the microstructure, and anchor the microstructure in a subject; dissolves to at least one of expose the microstructure, expose further coating, and expose a material; provides a stimulus to a subject; contains a material; selectively releases a material; acts as a barrier to exclude at least one substance from the microstructure; and comprises at least one of polyethylene, polyethylene glycol, polyethylene oxide, zwitterion, peptide, hydrogel, and self-assembled monolayer.

[0068] In one embodiment, the system includes an actuator configured to apply a force to the substrate to at least one of pierce and penetrate the stratum corneum.

[0069] In one embodiment, the actuator is at least one of an electromagnetic actuator, a vibration motor, a piezoelectric actuator, and a mechanical actuator.

[0070] In one embodiment, the actuator is configured to apply at least one of a biasing force, a vibration force, and a continuous force.

[0071] In one embodiment, the force is at least one of: a continuous force greater than 1 N, less than 10 N, and at least one of about 2.5-5 N; an oscillatory force at least one of at least 1 mN, about 200 mN, and less than 1000 mN; and applied at a frequency at least one of at least 10 Hz, about 100-200 Hz, and less than 1 kHz.

[0072] In one embodiment, at least one of the force and frequency varies; varies depending on at least one of the time applied, depth of penetration, extent of penetration, and insertion resistance; increases as depth of penetration increases; decreases as depth of penetration increases; increases up to the point of penetration; and decreases after the point of penetration.

[0073] In one embodiment, one or more electronic processing devices control the actuators.

[0074] In one embodiment, the system includes a housing containing at least one sensor and at least one electronic processing device.

[0075] In one embodiment, the housing selectively couples to the substrate.

[0076] In one embodiment, the housing couples to the substrate using at least one of an electromagnetic coupling, a mechanical coupling, an adhesive coupling, and a magnetic coupling.

[0077] In one embodiment, at least one of the housing and the substrate is at least one of fixed to the subject, fixed to the subject using anchor microstructures, fixed to the subject using an adhesive patch, and fixed to the subject using a strap.

[0078] In one embodiment, the housing includes a housing connector that operably connects to a substrate connector on the substrate for communicating signals with the microstructure.

[0079] In one embodiment, the system is configured to take repeated measurements over a period of time, and the microstructure is configured to remain within the subject over that period of time.

[0080] In one embodiment, the period of time is at least one of at least one minute, at least one hour, at least one day, and at least one week.

[0081] In one embodiment, the system is configured to perform repeated measurements substantially continuously at a frequency of at least one of every second, every minute, every 5-10 minutes, every hour, every day, and every week.

[0082] In one embodiment, the one or more electronic processing devices analyze the measured response signals to determine at least one indicator that is at least partially indicative of a physiological status associated with the subject.

[0083] In one embodiment, the one or more electronic processing devices analyze the measured response signals to determine at least one metric and use the at least one metric to determine at least one indicator, the at least one indicator being at least partially indicative of a physiological status associated with the subject.

[0084] In one embodiment, the one or more electronic devices determine the index by fitting the at least one metric to at least one computational model, the at least one computational model embodying a relationship between the health status and the at least one metric.

[0085] In one embodiment, the at least one computational model is obtained by applying machine learning to reference metrics derived from subject data measured on one or more reference subjects.

[0086] In one embodiment, the one or more electronic devices are configured to determine the indicators by performing at least one of pattern matching, longitudinal analysis, and comparison to a threshold.

[0087] In one embodiment, the one or more processing devices are configured to determine a physiological status indicative of at least one of the presence, absence, or degree of a medical condition, a prognosis associated with a medical condition, the presence, absence, level, or concentration of a biomarker, the presence, absence, level, or concentration of an analyte, a fluid level in the subject, blood oxygenation, and bioelectrical activity.

[0088] In one embodiment, the one or more electronic devices are configured to generate an output that is at least one of an output comprising a notification, an output comprising a warning, an output indicative of the indicator, an output derived from the indicator, and an output comprising a recommendation based on the indicator.

[0089] In one embodiment, the system includes a transmitter that transmits at least one of object data derived from the measured response signal, at least one metric derived from the measured response signal, an indication of the measured response signal, and at least one metric derived from the object data.

[0090] In one embodiment, the one or more electronic processing devices generate subject data indicative of the measured response signals, and at least one of at least partially process the measured response signals, at least partially process the subject data, at least partially analyze the subject data, and store an indication of the subject data.

[0091] In one embodiment, the system includes a monitor device and a patch including a substrate and a microstructure.

[0092] In one embodiment, the monitoring device is at least one of inductively coupled to the patch, attached to the patch, and brought into contact with the patch when a reading is to be taken.

[0093] In one embodiment, the monitor device is configured to perform at least one of: cause a measurement to be taken; at least partially analyze the measurement; control a stimulus applied to at least one microstructure; generate an output; provide an output indicative of an indicator; provide a recommendation based on the indicator; and cause an action to be taken.

[0094] In one embodiment, the system includes a wearable monitor device that performs the measurements and a processing system that receives subject data derived from the measured response signals and analyzes the subject data to generate at least one index, the at least one index being at least partially indicative of a physiological status associated with the subject.

[0095] In one embodiment, the system includes a client device that receives measurement data from a wearable monitor device, generates object data using the measurement data, transfers the object data to a processing system, receives an indicator from the processing system, and displays a representation of the indicator.

[0096] In one embodiment, the system includes a substrate coil disposed on a substrate and operably coupled to one or more microstructure electrodes, and excitation and receive coils positioned proximate to the substrate coil such that changes in drive signals applied to the excitation and receive coils act as response signals.

[0097] In one embodiment, one or more microstructure electrodes interact with one or more analytes of interest such that the response signal depends on the presence, absence, level or concentration of the analyte of interest.

[0098] In one embodiment, the system includes a first substrate coil disposed on the substrate and operably coupled to one or more first microstructure electrodes; a second substrate coil disposed on the substrate and operably coupled to one or more second microstructure electrodes, the second microstructure electrodes configured to interact with an analyte of interest; and at least one excitation and receiving coil disposed proximate to at least one of the first and second substrate coils such that a change in a drive signal applied to the at least one excitation and receiving coil serves as a response signal, and the one or more electronic processing devices use the first and second response signals for the presence, absence, level, or concentration of the analyte of interest.

[0099] In one embodiment, first and second excitation and receiving coils are positioned proximate to the first and second substrate coils, respectively, such that a change in the drive signal applied to each excitation and receiving coil acts as a respective response signal.

[0100] In one embodiment, the system is at least partially wearable.

[0101] It will be understood that the broad aspects of the invention and their respective features can be used together and / or independently, and reference to separate broad aspects is not intended to be limiting. Furthermore, it will be understood that method features can be performed using a system or an apparatus, and system or apparatus features can be implemented using a method.

[0102] Various examples and embodiments of the present invention will now be described with reference to the accompanying drawings. [Brief explanation of the drawings]

[0103] [Figure 1] 1 is a schematic diagram of an example system for performing measurements on a living subject; [Figure 2] 1 is a flowchart of an example process for performing measurements on a living subject. [Figure 3A] FIG. 10 is a schematic side view of a further example of a system for performing measurements on a living subject. [Figure 3B] FIG. 3B is a schematic bottom view of an example patch for the system of FIG. 3A. [Figure 3C] FIG. 3C is a schematic plan view of the patch of FIG. 3B. [Figure 3D] FIG. 3B is a schematic bottom view of an alternative patch for the system of FIG. 3A. [Figure 3E] FIG. 3E is a schematic side view of the patch of FIG. 3D. [Figure 3F] 3B is a schematic side view of an example of a housing arrangement for the system of FIG. 3A. [Figure 3G] FIG. 3F is a schematic plan view of the housing arrangement of FIG. 3F. [Figure 3H] 1 is a schematic side view of an example of a flexible segmented substrate fixture. [Figure 3I] 10 is a schematic side view of a further example of a flexible segmented substrate fixture. FIG. [Figure 3J] 10 is a schematic side view of a further example of a flexible segmented substrate fixture. FIG. [Figure 3K] 10 is a schematic side view of a further example of a flexible segmented substrate fixture. FIG. [Figure 3L] 1 is a schematic side view of an example of an actuator arrangement; [Figure 3M] 10 is a schematic side view of a further example of an actuator arrangement; FIG. [Figure 4A] 1 is a schematic side view of a first example of a microstructure configuration. FIG. [Figure 4B] FIG. 10 is a schematic side view of a second example of the configuration of the microstructure. [Figure 4C] 1 is a graph showing the electric field between closely spaced electrodes. [Figure 4D] 1 is a graph showing the electric field between widely spaced electrodes. [Figure 4E] 1A to 1C are schematic diagrams showing examples of cross-sectional shapes of microstructures. [Figure 4F] 1A to 1C are schematic diagrams showing examples of cross-sectional shapes of microstructures. [Figure 4G]1A to 1C are schematic diagrams showing examples of cross-sectional shapes of microstructures. [Figure 4H] 1A to 1C are schematic diagrams showing examples of cross-sectional shapes of microstructures. [Figure 4I] 1A to 1C are schematic diagrams showing examples of cross-sectional shapes of microstructures. [Figure 4J] 1A to 1C are schematic diagrams showing examples of cross-sectional shapes of microstructures. [Figure 5A] 1 is a schematic side view of an example plate microstructure. FIG. [Figure 5B] FIG. 5B is a schematic front view of the microstructure of FIG. 5A. [Figure 5C] 5B is a schematic bottom view of an example patch including the microstructure of FIG. 5A. [Figure 5D] FIG. 5C is a schematic perspective top view of an example substrate including the pair of blade microstructures of FIGS. 5A and 5B. [Figure 5E] 1 is a schematic front view of an example blade microstructure. FIG. [Figure 5F] 1 is a schematic perspective top view of an example substrate including a blade microstructure. FIG. [Figure 5G] FIG. 1 is a schematic plan view of an example hexagonal lattice microstructure array. [Figure 5H] 10 is a schematic plan view of an alternative example of a grid of microstructure pairs. FIG. [Figure 5I] 5C is a schematic plan view of the grid of FIG. 5H showing examples of connections. FIG. [Figure 5J] 1 is a schematic perspective view of an example grid of microstructure pairs. [Figure 5K] 10 is an image of an example patch containing an array of angularly offset plate microstructure pairs. [Figure 5L] 1 is a schematic side view of an embodiment of a plate microstructure. [Figure 5M] FIG. 5I is a schematic perspective view of the plate microstructure of FIG. 5I. [Figure 5N] 1 is a schematic side view of an example pair of microstructures inserted into a subject for epidermal measurements. FIG. [Figure 5O] 1 is a schematic side view of an example pair of microstructures inserted into a subject for dermal measurements. FIG. [Figure 6A]FIG. 10 is a schematic side view of a second example of a microstructure. [Figure 6B] FIG. 6B is a schematic front view of the microstructure of FIG. 6A. [Figure 7A] FIG. 10 is a schematic diagram of a third example of a microstructure. [Figure 7B] FIG. 7B is a schematic diagram of a modified version of the microstructure of FIG. 7A. [Figure 8A] 1 is a schematic plan view of an example of a microstructure substrate. [Figure 8B] 8B is a schematic side view of the microstructure substrate of FIG. 8A as the microstructures are formed. [Figure 8C] FIG. 8B is a schematic cross-sectional view taken along line AA' in FIG. 8A. [Figure 8D] FIG. 8B is a schematic front view of the microstructure substrate of FIG. 8A. [Figure 8E] 8B is a schematic side view illustrating an example of the construction of a multilayer patch using the microstructure substrate of FIG. 8A. [Figure 8F] 1 is a schematic side view of an example multi-layer patch. [Figure 8G] FIG. 8F is a schematic cross-sectional view of the multilayer patch of FIG. 8F. [Figure 8H] 1 is a schematic cross-sectional view of an alternative arrangement of a multi-layer patch. [Figure 8I] 10A-10C are schematic plan views of alternative examples of microstructure substrates. [Figure 8J] FIG. 8J is a schematic side view of the microstructure configuration of the substrate of FIG. 8I. [Figure 8K] 10A-10C are schematic cross-sectional side views of alternative microstructure configurations. [Figure 8L] FIG. 8K is a schematic cross-sectional side view of a coated version of the microstructure configuration of FIG. 8K. [Figure 8M] 1 is a schematic side view of an example of a first step in a microstructure fabrication technique. [Figure 8N] 1 is a schematic side view of an example of a second step in the microstructure construction technique. [Figure 8O] 10 is a schematic side view of an example of a third step of the microstructure construction technique. [Figure 8P] 8A-8C are schematic side views of a first example of a microstructure configuration made using the construction technique of FIGS. 8M-8O. [Figure 8Q] FIG. 8B is a schematic side view of a second example of a microstructure configuration made using the construction technique of FIGS. 8M-8O. [Figure 9] FIG. 1 is a schematic diagram of an example of a distributed computer architecture. [Figure 10] 1 is a schematic diagram of an example processing system. [Figure 11] FIG. 2 is a schematic diagram of an example client device. [Figure 12A] 1 is a flowchart of an example process for performing measurements on a living subject. [Figure 12B] 1 is a flowchart of an example process for performing measurements on a living subject. [Figure 13] 1 is a flowchart of an example process for creating a subject record. [Figure 14A] 1 is a flowchart of an example process for performing measurements in a living subject. [Figure 14B] 1 is a flowchart of an example process for performing measurements in a living subject. [Figure 15A] 1 is a schematic perspective top view of an example patch including a substrate incorporating a microstructure electrode and a substrate coil. FIG. [Figure 15B] FIG. 15B is a schematic diagram of an equivalent circuit representing the electrical response of the patch of FIG. 15A. [Figure 15C] 15B is a graph showing the response of the patch of FIG. 15A to a drive signal. [Figure 15D] 15B is a graph showing the resonant response of the patch of FIG. 15A. [Figure 15E] FIG. 1 is a schematic perspective top view of an example of a dual patch arrangement. [Figure 15F] 15F is a graph showing an example of drive signal attenuation for the dual patch setup of FIG. 15E. [Figure 16A] 1 is an equivalent circuit for skin-based impedance measurements. [Figure 16B] 1 is an equivalent circuit for skin-based impedance measurements. [Figure 16C] FIG. 1 is a schematic diagram comparing skin- and microstructure-based impedance measurements. [Figure 17A] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 17B] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 17C] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 17D] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 17E] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 17F] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 17G] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 17H] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 17I] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 17J] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 17K] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 17L] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 17M] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 17N] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 17O] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 17P] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 18A] 17A-17P are micrograph images of example microstructures fabricated using the approach of FIGS. [Figure 18B] 17A-17P are micrograph images of example microstructures fabricated using the approach of FIGS. [Figure 18C]17A-17P are micrograph images of example microstructures fabricated using the approach of FIGS. [Figure 18D] 17A-17P are micrograph images of example microstructures fabricated using the approach of FIGS. [Figure 19A] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 19B] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 19C] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 19D] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 19E] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 19F] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 19G] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 19H] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 19I] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 19J] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 19K] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 19L] 1 is a schematic diagram illustrating steps in an example manufacturing process. [Figure 20A] 19A-19L are micrograph images of example microstructures fabricated using the approach of FIGS. 19A-19L. [Figure 20B] 19A-19L are micrograph images of example microstructures fabricated using the approach of FIGS. 19A-19L. [Figure 20C] 19A-19L are micrograph images of further examples of microstructures fabricated using the approach of FIGS. 19A-19L. [Figure 20D]19A-19L are micrograph images of further examples of microstructures fabricated using the approach of FIGS. 19A-19L. [Figure 21A] 1 is a photomicrograph image of an example of a partially coated microstructure. [Figure 21B] 1 is a photomicrograph image of an example of a partially coated microstructure. [Figure 22A] 10 is an image showing an example of penetration of a pig's ear by a microstructure without vibration. [Figure 22B] 10 is an image showing an example of penetration of a pig's ear by a microstructure without vibration. [Figure 22C] 10 is an image showing an example of penetration of a pig's ear by a microstructure without vibration. [Figure 22D] 10 is an image showing an example of penetration of a pig's ear by a microstructure without vibration. [Figure 22E] 10 is an image showing an example of penetration of a pig's ear by a microstructure without vibration. [Figure 22F] 10 is an image showing an example of penetration of a pig's ear by a microstructure without vibration. [Figure 22G] 10 is an image showing an example of penetration of a pig's ear by a vibrating microstructure. [Figure 22H] 10 is an image showing an example of penetration of a pig's ear by a vibrating microstructure. [Figure 22I] 10 is an image showing an example of penetration of a pig's ear by a vibrating microstructure. [Figure 22J] 10 is an image showing an example of penetration of a pig's ear by a vibrating microstructure. [Figure 22K] 10 is an image showing an example of penetration of a pig's ear by a vibrating microstructure. [Figure 23A] 10 is an image showing an example of stratum corneum penetration for a patch with a microstructure density of 188 / cm2. [Figure 23B] 10 is an image showing an example of stratum corneum penetration for a patch with a microstructure density of 300 / cm 2 . [Figure 23C] 10 is an image showing an example of stratum corneum penetration for a patch with a microstructure density of 550 / cm 2 . [Figure 23D]5K is an image showing an example of penetration of the stratum corneum for the patch of FIG. 5K. [Figure 24A] 10 is a graph showing the depth of penetration for different microstructures and force configurations. [Figure 24B] 1 is a graph showing the depth of penetration for applications with and without vibration. [Figure 25A] 1 is a graph showing an example of changes in epidermal impedance with respect to changes in water retention in pig skin. [Figure 25B] 1 is a graph showing an example of changes in epidermal impedance and hematocrit with respect to changes in hydration. [Figure 25C] 1 is a graph showing an example of changes in epidermal and skin impedance with respect to changes in hydration. [Figure 26A] 1 is a graph showing the results of a first experiment to test the application of a negative electrical bias to prevent the passive release of a surrogate drug (methylene blue). [Figure 26B] 10 is a graph showing further results of an experiment to test the application of a negative electrical bias to prevent the passive release of a surrogate drug (methylene blue). [Figure 27A] 10 is a graph showing the results of an experiment to test the pulsatile release of a surrogate drug tunable with electrical bias of alternating polarity. [Figure 27B] 10 is a graph showing further results of an experiment to test tunable pulsed release of a surrogate drug with electrical bias of alternating polarity. [Figure 27C] 10 is a graph showing the results of further experiments to test the pulsatile release of a surrogate drug tunable with electrical bias of alternating polarity. [Figure 27D] 10 is a graph showing further results of a second experiment to test tunable pulsed release of a surrogate drug with electrical bias of alternating polarity. [Figure 28] 10 is a graph showing the results of a third experiment to test the suitability of methylcellulose / sucrose for therapeutic delivery. [Figure 29A]10 is a graph showing the total amount of methylene blue retained on the patch in a fourth experiment to test the electrically tunable release of a surrogate drug into pig skin. [Figure 29B] 10 is a graph showing the amount of methylene blue delivered in the fourth experiment. [Figure 29C] 10 is a graph showing the percentage amount of methylene blue delivered in the fourth experiment. [Figure 30A] 1 is an image of a transparent microstructure patch coated with resazurin. [Figure 30B] 30B is an image of the patch of FIG. 30A after exposure to cell broth. [Figure 30C] 30B is a graph of UV-visible measurements taken through the microstructure of the patch of FIG. 30A before coating, after coating, and after exposure. [Figure 31] 1 is a graph of the change in impedance of a molecularly imprinted polymer upon exposure to Troponin I. [Figure 32A] FIG. 1 is a schematic diagram of an example of an experimental setup for ex vivo detection of troponin I in pig skin. [Figure 32B] 1 is a graph showing the change in impedance at various concentrations of troponin I for a patch coated with molecularly imprinted conductive polypyrrole (MICP). [Figure 32C] 1 is a graph showing the change in impedance with various concentrations of troponin I for patches coated with non-imprinted conductive polypyrrole (NICP). [Figure 32D] 1 is a graph showing a comparison of the change in impedance between an MICP patch and a NICP patch. [Figure 33A] FIG. 1 is a schematic diagram of an example of an experimental setup for ex vivo detection of troponin I in pig skin. [Figure 33B] 33B is a graph showing an example of raw impedance values ​​versus time during perfusion of the pig skin of FIG. 33A. [Figure 33C]33B is a graph showing an example of the change in impedance values ​​over time during perfusion of the pig skin of FIG. 33A. [Figure 34A] FIG. 1 is a schematic diagram showing an example of an aptamer configuration. [Figure 34B] FIG. 1 is a schematic diagram showing an example of the configuration of an aptamer after reaction with an analyte. [Figure 35] 1 is a graph showing the change in cyclic voltammetry readings after exposure of aptamer-functionalized microstructures to an analyte. [Figure 36A] 1 is a graph showing the change in cyclic voltammetry readings after exposure of aptamer-functionalized microstructures to an analyte. [Figure 36B] 1 is a graph showing the change in cyclic voltammetry readings after exposure of aptamer-functionalized microstructures to control solutions. [Figure 37A] FIG. 1 is a schematic diagram showing the fabrication of antibody-functionalized electrodes for analyte sensing. [Figure 37B] FIG. 1 is a schematic diagram showing the fabrication of antibody-functionalized electrodes for analyte sensing. [Figure 37C] FIG. 1 is a schematic diagram showing the fabrication of antibody-functionalized electrodes for analyte sensing. [Figure 38A] 1 is a graph showing the change in capacitance upon exposure to an analyte. [Figure 38B] 1 is a graph showing the change in impedance upon exposure to troponin I. [Figure 39A] 1 is an image of a microstructure patch application site on human forearm skin immediately after removal. [Figure 39B] 1 is a scanning electron micrograph of the microstructures after application to human skin. [Figure 40A] 1 is a graph of an example of qualitative scores for erythema at the site of microstructure patch application on human forearm skin from the first study. [Figure 40B] 10 is a graph of an example of qualitative scores for erythema at the site of microstructure patch application on human forearm skin from a second study. [Figure 41A]1 is a scanning electron micrograph of the microstructures prior to application into human forearm skin. [Figure 41B] 41B is a scanning electron micrograph of the microstructure of FIG. 41A after application into the skin of a human forearm. [Figure 41C] 1 is a scanning electron micrograph of a microstructure patch after application into the skin of a human forearm. [Figure 41D] 1 is a scanning electron micrograph of the microstructures prior to application into human forearm skin. [Figure 41E] 41D is a scanning electron micrograph of the microstructure of FIG. 41D after application into the skin of a human forearm. [Figure 41F] 1 is a scanning electron micrograph of a microstructure patch after application into the skin of a human forearm. [Figure 42] FIG. 42A is a schematic diagram showing an example of a comparison with existing technology, FIG. 42B is a schematic diagram showing an example of a conventional microprojection analyte detection technology, and FIG. 42C is a schematic diagram showing an example of a microstructure measurement system. DETAILED DESCRIPTION OF THE INVENTION

[0104] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods and materials are described. For purposes of the present invention, the following terms are defined below.

[0105] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0106] The terms "about" and "approximately" are used herein to refer to a condition (e.g., amount, level, concentration, time, etc.) that varies by up to 20% (i.e., ±20%) from a specified condition, particularly by 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%.

[0107] As used herein, the term "analyte" refers to a naturally occurring and / or synthetic compound that is a marker of a condition (e.g., substance abuse), a disease state (e.g., infectious disease), a disorder (e.g., neurological disorder), or a normal or pathological process (e.g., drug metabolism) occurring in a subject, or a compound that can be used to monitor the level of an administered or ingested substance in a subject, such as a drug (a substance that treats, prevents, and / or alleviates the symptoms of a disease, disorder, or condition, e.g., a medication, vaccine, etc.), an illicit substance (e.g., illegal drug), a non-illicit abused substance (e.g., alcohol or prescription drugs taken for non-medical reasons), a poison or toxin (including environmental pollutants), a chemical weapon (e.g., nerve agent, etc.) or their metabolites. The term "analyte" can refer to any substance, including chemical and / or biological agents, that can be measured in an analytical procedure, including nucleic acids, proteins, illicit drugs, explosives, toxins, pharmaceuticals, carcinogens, poisons, allergens, and infectious agents that can be measured in an analytical procedure. The analyte can be a compound found directly in a sample, such as biological tissue, including bodily fluids (e.g., interstitial fluid) from a subject, particularly in the dermis and / or epidermis. In certain embodiments, the analyte is a compound found in interstitial fluid. In some embodiments, the analyte is a compound with a molecular weight ranging from about 30 Da to about 100 kDa, particularly from about 50 Da to about 40 kDa. Other suitable analytes are as described herein.

[0108] As used herein, the term "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted as alternatives (or).

[0109] As used herein, the term "aptamer" refers to a single-stranded oligonucleotide (e.g., DNA or RNA) that binds to a specific target molecule, such as an analyte. Aptamers can be of any size suitable for binding such a target molecule, such as a length of about 10 to about 200 nucleotides, particularly a length of about 30 to about 100 nucleotides.

[0110] The term "bind" and variations such as "binding" are used herein to refer to an interaction between two entities, such as an analyte and an aptamer, or an analyte and a molecularly imprinted polymer. The interaction can be a covalent or non-covalent interaction, particularly a non-covalent interaction.

[0111] Throughout this specification and the claims that follow, unless the context dictates otherwise, the word "comprise" and variations such as "comprise" and "comprising" are understood to mean the inclusion of a stated integer or step or group of integers or steps, but not the exclusion of other integers or steps or group of integers or steps. Thus, the use of terms such as "comprising" indicates that the recited integer is required or mandatory, but that other integers are optional and may or may not be present. "Consisting of" means including and limited to what precedes the phrase "consisting of." Thus, the phrase "consisting of" indicates that the recited elements are required or mandatory, and that no other elements may be present. "Consisting essentially of" means including any elements listed before the phrase, and is limited to other elements that do not interfere with or contribute to the activity or function specified in this disclosure for the recited elements. Thus, the phrase "consisting essentially of" indicates that the recited elements are required or mandatory, but that other elements are optional and may or may not be present depending on whether they affect the activity or function of the recited elements.

[0112] The term "plurality" as used herein refers to 2, 10, 100, 1000, 10000, 1 x 10 6 , 1×107 , 1×10 8 , 1×10 9 , 1×10 10 , 1×10 11 , 1×10 12 , 1×10 13 , 1×10 14 , 1×10 15 2 to 1×10, etc. (and all integers in between) 15 (or any integer in between) and more.

[0113] As used herein, the term "predetermined threshold" refers to a value above or below which indicates the presence, absence, or progression of a disease, disorder, or condition, the presence or absence of an illicit or non-illicit substance of abuse, or the presence or absence of a chemical weapon, poison, and / or toxin. For example, for purposes of the present invention, a predetermined threshold can represent the level or concentration of a particular analyte in a corresponding sample from an appropriate control subject, such as a healthy subject, or in a pooled sample from multiple control subjects, or the average or median value of multiple control subjects. Thus, a level or concentration above or below the threshold indicates the presence, absence, or progression of a disease, disorder, or condition, the presence or absence of an illicit or non-illicit substance of abuse, or the presence or absence of a chemical weapon, poison, and / or toxin, as taught herein. In other examples, the predetermined threshold may represent a value greater than or less than the level or ratio determined for a control subject, to incorporate an additional degree of confidence that a level or ratio above or below the predetermined threshold indicates the presence, absence, or progression of a disease, disorder, or condition, the presence or absence of an illicit or non-illicit substance of abuse, or the presence or absence of a chemical weapon, poison, and / or toxin. One of skill in the art can readily determine an appropriate predetermined threshold based on analysis of samples from appropriate control subjects.

[0114] As used herein, the terms "selective" and "selectivity" refer to a molecularly imprinted polymer or aptamer that binds an analyte of interest without exhibiting substantial binding of one or more other analytes. Thus, a molecularly imprinted polymer or aptamer that is selective for an analyte, such as troponin or a subunit thereof, exhibits greater than about 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater than about 500-fold selectivity relative to binding of one or more other analytes.

[0115] As used herein, the term "subject" refers to a vertebrate subject, particularly a mammalian subject, for which monitoring and / or diagnosis of a disease, disorder, or condition is desired. Suitable subjects include, but are not limited to, primates, avians (birds), livestock animals such as sheep, cows, horses, deer, donkeys, and pigs, laboratory animals such as rabbits, mice, rats, guinea pigs, and hamsters, pets such as cats and dogs, bats, and captive wild animals such as foxes, deer, and dingoes. In particular, the subject is a human.

[0116] System for taking measurements An example of a system for performing measurements on a living subject will now be described with reference to FIG.

[0117] In this example, the system includes at least one substrate 111 having one or more microstructures 112. In use, the microstructures are configured to breach a functional barrier associated with a subject. In the current example, the functional barrier is the stratum corneum SC, and the microstructures are configured to breach the stratum corneum SC by penetrating the stratum corneum SC and entering at least the viable epidermis VE. In one particular example, the microstructures are configured not to penetrate the boundary between the viable epidermis VE and the dermis D, although this is not required and structures that penetrate into the dermis can also be used, as described in more detail below.

[0118] While this example is described with respect to breaking through the stratum corneum (SC), it will be understood that this is not required and that the technique can be applied to other functional barriers as well. In this regard, a functional barrier is understood to include any structure, boundary, or feature, physical or otherwise, that prevents the passage of an analyte, such as a signal and / or a biomarker. For example, a functional barrier can include one or more layers, a mechanical discontinuity, such as a discrete change in the mechanical properties of a tissue, a tissue discontinuity, a cellular discontinuity, a nerve barrier, a sensor barrier, a cell layer, a skin layer, a mucosal layer, an internal or external barrier, an inner barrier within an organ, an outer barrier of an organ other than the skin, an epithelial or endothelial layer, etc. Functional barriers can also include light barriers, such as a melanin layer, an electrical barrier, a molecular weight barrier that prevents the passage of certain molecular weight biomarkers, and other internal layers or boundaries, including the basal layer boundary between the viable epidermis and dermis.

[0119] The nature of the microstructures will vary depending on the preferred embodiment, in one example the microstructures may comprise needles, although this is not required and plates, blades and like structures are more commonly used, as described in more detail below.

[0120] The substrate and microstructures can be made from any suitable material, and the material used can depend on the intended use, for example, whether the structures need to be optically and / or electrically conductive, etc. The substrate can form part of a patch 110 that can be applied to a subject, although other arrangements can be used, for example, the substrate forming part of a housing that contains other components.

[0121] In one example, at least one sensor 121 is provided that is operatively connected to at least one microstructure 112, whereby a response signal can be measured from each microstructure 112. In this regard, the term response signal will be understood to encompass signals that are intrinsic in the subject, such as ECG (electrocardiograph) signals, or signals that are induced as a result of application of a stimulus, such as bioimpedance signals.

[0122] The nature of the sensor will vary depending on the preferred embodiment and the nature of the sensing being performed. For example, sensing may involve sensing of an electrical signal, in which case the sensor may be a voltage or current sensor, etc. Alternatively, an optical signal may be sensed, in which case the sensor may be an optical sensor such as a photodiode, CCD (Charge Coupled Device) array, etc., while a temperature signal may be sensed using a thermistor, etc.

[0123] The manner in which the sensor 121 is connected to the microstructure(s) 112 also varies depending on the preferred embodiment. In one example, this is achieved using a connection between the microstructure(s) 112 and the sensor; the nature of the connection varies depending on the signal to be sensed; the connection may include an electrically conductive element to conduct an electrical signal, a waveguide to conduct an electromagnetic signal, an optical fiber or other conductor, or a thermal conductor to conduct a thermal signal. The connection may also include a wireless connection, allowing the sensor to be located remotely. Ionic connections may also be used. Furthermore, the connection may be provided as a separate element, although in other examples, the substrate provides the connection, for example, if the substrate is made from a conductive plate that is further electrically connected to all of the microstructures. As a further alternative, the sensor may be embedded in or formed from part of the microstructure, and may not require a connection.

[0124] The sensors 121 may be operatively connected to all of the microstructures 112 by joint and / or independent connections. For example, one or more sensors may be connected to different microstructures to allow different measurement response signals to be measured from different groups of microstructures 112. However, this is not required and any suitable arrangement may be used.

[0125] In addition to providing sensing, in some examples, the microstructure 112 may additionally and / or alternatively be configured to provide a stimulus. For example, the microstructure may be coupled to a signal generator that generates a stimulus signal, as described in more detail below. Such stimuli may also include electrical stimuli using a voltage or current source, optical stimuli using a visible or non-visible radiation source such as an LED or laser, thermal stimuli, etc., and may be delivered through the same or a different microstructure used to measure the response signal, depending on the preferred embodiment. Additionally and / or alternatively, stimuli may be achieved using other techniques, such as through exposure of the subject to the microstructure and materials thereon or therein. For example, a coating may be applied to the microstructure to allow a material to be delivered across a barrier to the subject, thereby stimulating a response within the subject.

[0126] These options allow for various types of sensing to be performed, including detection of electrical signals within the body such as ECG signals, plethysmographic signals, electromagnetic signals or electrical potentials generated by muscle, nerve tissue, blood etc; detection of photoplethysmographic effects such as fluorescence; detection of electromagnetic effects; detection of mechanical properties such as stress or strain; etc. Sensing may include detection of the body's response to an applied electrical signal to measure, for example, bioimpedance, bioconductance or biocapacitance; detection of the presence, absence, level or concentration of an analyte by detecting, for example, an electrical or optical property, etc.

[0127] The system may further include one or more electronic processing devices 122 which may form part of a measurement device as described in more detail below, and / or may include an electronic processing device which forms part of one or more processing systems, such as a computer system, a server, a client device, etc. In use, the processing device 122 is adapted to receive signals from the sensors 121 and store or process the signals. For ease of explanation, the remainder of the description will refer generally to the processing device, however it will be understood that multiple processing devices may be used, with processing distributed between devices if desired, and that references to the singular encompass plural equipment and vice versa.

[0128] An example of how this can be done will now be described with reference to FIG.

[0129] In particular, in this example, in step 200, a substrate is applied to a subject such that one or more microstructures breach, and in one example, penetrate, a functional barrier. For example, when applied to the skin, the microstructures may penetrate the stratum corneum and enter the viable epidermis, as shown in Figure 1. This may be accomplished manually and / or through the use of an actuator to help ensure good penetration.

[0130] In step 210, a response signal in the subject is measured and a signal indicative of the measured response signal is provided to electronic processing device 121. This may occur after application of the stimulus, but this is not required and will vary depending on the nature of the sensing being performed.

[0131] The one or more processing devices then analyze the resulting measurement data at step 220 and / or store data based on the measurement data for later analysis at step 230 or may provide an output based on the measured response signals. For example, the processing device may display an indicator indicative of the measured response signals and / or values ​​derived therefrom. Alternatively, the processing device may generate intervention recommendations, trigger actions such as alerting a clinician, trainer, or parent, etc.

[0132] The analysis can be performed in any suitable manner, which will vary depending on the nature of the measurements being made. For example, this may involve examining the values ​​of the measured response signals and using them to calculate an index that indicates a health status, including the presence, absence, degree, or prognosis of one or more medical conditions, a prognosis associated with a medical condition, the presence, absence, level, or concentration of a biomarker, the presence, absence, level, or concentration of an analyte, the presence, absence, or grade of cancer, fluid levels in the subject, blood oxygenation, tissue inflammatory state, bioelectrical activity such as nerve, brain, muscle, or heart activity, or various other health conditions. This may be achieved by monitoring changes in values ​​over time and may involve comparison with values ​​measured for reference subjects with known medical conditions. Additionally and / or alternatively, the index may indicate a measured parameter associated with the subject, such as the measured level or concentration of an analyte or other biomarker.

[0133] For example, when measuring fluid levels, this may involve examining the values ​​of the applied stimulation signal and the measured response signal and using these to calculate bioimpedance within the epidermis, which may further derive an index indicative of fluid levels. In this regard, fluids within the body, such as interstitial fluid, contain sodium (Na+), potassium (K+), calcium (Ca+), and argon (Ar+). 2 +), chloride (Cl-), bicarbonate (HCO3-) and phosphate (HPO4 2It will be appreciated that an increase or decrease in fluid level, for example as a subject's hydration level increases or decreases, will result in a corresponding decrease or increase in ion concentration, resulting in a change in the conductivity of the fluid. Accordingly, measurements of the impedance of the fluid can be used to further derive information about the fluid's conductivity, which in turn indicates ion concentration and therefore fluid level. It will be appreciated that this allows changes in impedance to be used to track changes in fluid level and therefore the hydration status of a subject. Such fluid levels may include any one or more of interstitial fluid level, changes in interstitial fluid level, ion concentration in interstitial fluid, changes in ion concentration in interstitial fluid, ion concentration, changes in ion concentration, total body water, intracellular fluid level, extracellular fluid level, plasma water level, fluid volume, or hydration level.

[0134] Fluid level indicators may further be used in monitoring hydration levels and / or health status, such as the presence, absence, degree or prognosis of one or more medical conditions, prognosis related to a medical condition, etc. This may include monitoring changes in values ​​over time, for example to provide a longitudinal hydration measurement, and may include comparison with values ​​measured for a reference subject of known hydration levels, thereby allowing an assessment of whether the subject is under- or overhydrated.

[0135] In any event, it will be appreciated that the above-described systems operate by providing microstructures configured to penetrate a barrier, such as the stratum corneum, and using these to enable measurement of response signals within a subject, such as within the epidermis and / or dermis. These response signals can be further processed and then analyzed to derive specific measurements or various values ​​that may be indicative of one or more aspects of the subject's health.

[0136] For example, the system may be configured to measure the level or concentration of an analyte, such as the level or concentration of a particular biomarker. The response signal may also be used to generate visualization, one-, two-, or three-dimensional spatial mapping, mechanical properties, force, pressure, muscle movement, blood pulse wave details, analyte concentrations, such as the presence, absence, level, or concentration of a particular biomarker, blood oxygen saturation, bioimpedance, biocapacitance, bioconductance, or electrical signals within the body, such as ECG (electrocardiogram) signals.

[0137] In one example, a system can be configured to perform measurements at specific locations within a subject, such as only within the epidermis, only within the dermis, etc. This allows for high accuracy in detecting target analytes and provides higher quality data for more precise measurement of the analyte. Furthermore, limiting the locations at which measurements are performed ensures that measurements are reproducible, allowing for more accurate long-term monitoring.

[0138] In contrast to conventional approaches, breaking through and / or at least partially penetrating a functional barrier such as the stratum corneum allows measurements to be taken from within or below the barrier, particularly within the epidermis and / or dermis, resulting in significantly improved quality and magnitude of the detected response signal. In particular, this ensures that the response signal accurately reflects conditions within the human body, particularly within the epidermis and / or dermis, such as the presence, absence, level or concentration of biomarkers, interstitial fluid impedance, etc., in contrast to conventional external measurements that are overly affected by the environment outside the barrier, such as the material properties of the skin, the presence or absence of hair, sweat, and physical properties of the skin surface, such as the mechanical behavior of an applied sensor. Additionally, penetrating the stratum corneum but not the dermis limits measurements to the epidermis alone, thereby avoiding interference from changes in dermal fluid levels.

[0139] For example, this allows for accurate measurement of high molecular weight biomarkers that would otherwise barely penetrate the skin. A good example is glucose, which, when present externally, such as in sweat, is typically present at low concentrations and often time-delayed, meaning that the concentration in sweat does not necessarily reflect the current glucose level in the body. In contrast, breaking through a barrier, in this case the stratum corneum, allows for much more accurate measurements. It will be appreciated that similar considerations apply to a wide range of different biomarkers or signals and associated barriers that would otherwise prevent accurate measurement of the biomarker or signal.

[0140] For example, in the case of impedance measurements, microstructured electrodes tend to measure a different impedance compared to standard surface electrodes, indicating that microstructured electrodes do not measure the impedance of the skin, and therefore the measured impedance is more indicative of conditions inside the body. Because the impedance contribution of the skin surface is significant, this can lead to changes in the impedance inside the covered body, making skin-based measurements less likely to detect meaningful changes.

[0141] A further problem with skin-based impedance measurements is that the generated fields tend to penetrate the stratum corneum and dermis and are not restricted to the epidermis. An example of this is shown in Figure 16C.

[0142] In this example, skin-based electrode 1601 generates an electric field 1602 that extends into the stratum corneum SC, the viable epidermis VEPiD, and the dermis D. In contrast, microstructure patch 1603 generates a field 1604 that is confined within the viable epidermis VEPiD.

[0143] Examples of equivalent circuits resulting from skin-based and epidermal measurements are shown in Figures 16A and 16B, respectively. In this regard, each equivalent circuit includes three circuits representing the contribution of current flowing through the tissue in orthogonal directions per layer. Thus, in the skin-based measurement shown in Figure 16A, the impedance of the stratum corneum is represented by circuit C SC1 , R SC1 , CSC2 , R SC2 , C SC3 , R SC3 The epidermis is represented by the circuit C VE1 , R VE1 , C VE2 , R VE2 , C VE3 , R VE3 The dermis is represented by circuit C D1 , R D1 , C D2 , R D2 , C D3 , R D3 In this example, R SC1 >>R VE1 , R SC2 >>R VE2 and R SC3 >>R VE3 , i.e., the contribution of the impedance of the epidermal layer is very small compared to the contribution of the impedance of the stratum corneum, so the skin-based measurement is more reflective of the impedance of the stratum corneum.

[0144] In contrast, in the case of epidermal sensing only shown in FIG. 16B, the impedance is VE1 , R VE1 , C VE2 , R VE2 , C VE3 , R VE3 only, and therefore epidermal measurements are more reflective of epidermal fluid levels.

[0145] Additionally, in some instances, the microstructures penetrate the barrier far enough to allow measurements to be taken. For example, in the case of skin, the microstructures are typically configured to enter the viable epidermis but not the dermal layer. This results in several improvements over other invasive techniques, including avoiding problems associated with penetrating the dermis, such as pain, erythema, and petechia caused by nerve exposure. Avoiding penetration of the dermal boundary also significantly reduces the risk of infection and allows the microstructures to remain implanted for extended periods, such as several days, which can further be used for long-term longitudinal monitoring. However, penetration of the dermal barrier may be necessary in some cases, such as when detecting troponin or its subunits.

[0146] It will be appreciated that being able to keep the microstructures in situ is particularly beneficial as it ensures that measurements are taken at the same location within the subject, reducing the inherent variability that arises from inaccuracies in repositioning the measurement device that can occur with conventional techniques. Nevertheless, it will be appreciated that the system may be used in other ways, such as to provide single point in time monitoring.

[0147] In one example, this allows the equipment to be provided as part of a wearable device, providing significantly better measurements than existing surface-based measurement technologies, for example, by providing access to signals or biomarkers that would otherwise be unable to penetrate barriers, while still allowing measurements to be taken while the subject is engaged in normal activities and / or over extended periods of time. This further allows measurements to be obtained that more accurately reflect the subject's health or other status. For example, this allows fluctuations in a subject's condition over the course of a day to be measured, avoiding measurements being taken in artificial settings, such as in a clinic, that may not be representative of the subject's actual situation. This also allows monitoring to be performed substantially continuously, thereby allowing conditions, such as myocardial infarction, cardiovascular disease, vomiting, diarrhea, etc., to be detected as they arise, allowing for more rapid intervention.

[0148] The above-described system can be applied to any part of the body and thus can be used with a wide range of different functional barriers. For example, the functional barrier can be an internal or external barrier, a skin layer, a mucous layer, an inner barrier within an organ, an outer barrier of an organ, an epithelial layer, an endothelial layer, a melanin layer, a light barrier, an electrical barrier, a molecular barrier, a basal layer, or a stratum corneum. Thus, the microstructures can be applied to the buccal mucosa, the eye, or another epithelial layer, an endothelial layer, etc. Although the following examples focus specifically on application to the skin and the functional barrier includes some or all of the stratum corneum, it will be understood that this is intended to be illustrative and not limiting.

[0149] Further variations will become apparent from the following description.

[0150] In one example, the system includes a signal generator operably connected to at least one microstructure to apply a stimulus, typically by applying a stimulus signal to the microstructure. Again, the manner in which the signal generator is connected varies depending on the preferred embodiment, and this may be achieved via a connection, such as a wired or wireless connection, and / or by integrating the signal generator into the substrate and / or the microstructure. Examples of types of connection include mechanical, magnetic, thermal, electrical, electromagnetic, optical, etc.

[0151] The nature of the stimulation signal and the manner in which it is applied vary depending on the preferred embodiment and may include any one or more of biochemical, chemical, mechanical, magnetic, electromagnetic, electrical, optical, thermal, or other signals. The stimulation signal may be used to enable measurement of a response signal and / or to trigger a biological response, which may then be measured. For example, the stimulation signal may be used to cause electroporation to induce local inflammatory mediators, which may further release biomarkers and allow their levels or concentrations to be measured. In this regard, electroporation or electroporation involves applying an electric field to cells to increase the permeability of cell membranes and allow chemicals, drugs, or DNA to be introduced into the cells. In another example, the stimulation may be used to disrupt boundaries within a subject, for example, disrupting the dermal boundary, allowing biomarkers within the dermal layer to be detected in the living epidermis without the need for penetration of the dermal layer by microstructures. In a further example, the stimulation may be used to trigger additional effects. Thus, for example, an electrical or mechanical signal may be used to disrupt a coating on the microstructure to release material, which may then be stimulated by a chemical or other stimulus.

[0152] Stimulation signals can also be applied to the microstructures to alter their form or function: for example, polymeric microstructures can be induced to expand or contract along their length or width by an applied electric field or temperature, while microstructures can be configured to move between a retracted flat position and an extended upright position for penetrating and then retracting the skin or other barrier.

[0153] In one example, the operation of the signal generator is controlled by a processing device, which can control the signal generator to perform measurements, for example, by applying an electrical signal to enable impedance measurements to be taken. Additionally and / or alternatively, the processing device can control the signal generator according to the measured response signal, such as to apply a stimulus to the subject and / or microstructure when certain criteria are met. For example, in a theranostic application, a signal applied to the microstructure can be used to release a therapeutic material. In this example, the processing device can monitor the response signals and use them to assess when intervention is needed, and then control the signal generator to trigger the release. In one example, such control can be performed according to a dosing regimen, specifying, for example, the dose and timing of dose delivery, after determining that a therapy is needed. In this example, the dosing regimen can be predetermined and stored onboard, or can be manually entered by a clinician or other individual as needed.

[0154] As mentioned above, the signal generator and / or sensor can be connected to the microstructure via a connection. The nature of the connection varies depending on the preferred embodiment and the nature of the signal. For example, if the signal is an optical or other electromagnetic signal, a waveguide, fiber optic cable, or other electromagnetic conductor can be used. For electrical signals, the connection can be a conductive connection, such as a wire or a conductive track on a substrate, or can be formed by a conductive substrate. The connection can also include a wireless connection, such as a short-range radio frequency wireless connection, an inductive connection, etc. The connection can also be a mechanical connection, a magnetic connection, a thermal connection, etc.

[0155] In one example, inductive connections can be used to transmit signals and power, so that for example inductive coupling can be used to power electronic circuits mounted on the substrate. This can also be used to allow basic processing such as amplification and processing of impedance changes to be done on the substrate using simple integrated circuits or the like without the need for an on-board power source on the substrate.

[0156] In one example, the system can include response microstructures used to measure response signals and / or stimulus microstructures used to apply stimulus signals to the subject. Thus, the stimulus and response can be measured via different microstructures, in which case the substrate typically incorporates a response connection that allows the response signal to be measured and a stimulus connection that allows the stimulus signal to be applied. In some examples, multiple stimulus and response connections are provided to allow different measurements to be made via different connections. For example, to enable multimodal sensing, different types of measurements can be made via different microstructures or different portions of a given microstructure. Additionally and / or alternatively, the same type of measurement can be made at different locations and / or depths to identify localized problems, such as the presence of skin cancer. In other cases, stimulus and measurement can be made via the same connection, for example, when making bipolar impedance measurements.

[0157] Signals can also be applied to or measured from individual microstructures and / or different portions of the microstructures, which can be useful for distinguishing features at different locations and / or depths within the body. This can be used, for example, for mapping or tomography to produce images in which, for example, the contrast or color of the image is proportional to changes in a physical property such as the level or concentration of one or more analytes or bioimpedance. Additionally and / or alternatively, signals can be applied to or measured from multiple microstructures collectively, which can be used to improve signal quality or to perform measurements such as bipolar, quadripolar, or other multipolar impedance measurements. Additionally and / or alternatively, microstructures can be used for both measurement and stimulation, for example, by applying a signal to a microstructure and then measuring a response therefrom.

[0158] In one particular example, the sensors and / or signal generators may be connected to the microstructures via one or more switching devices, such as multiplexers, to allow signals to be selectively communicated between the sensors or signal generators and different microstructures. A processing device is typically configured to control the switches, allowing a variety of different sensing and stimulation to be achieved under the control of the processing device. In one example, this allows at least some electrodes to be used independently of at least some other electrodes. The ability to selectively interrogate different electrodes in this manner may provide advantages.

[0159] For example, this allows different electrodes to have different functionality, e.g., by functionalizing different electrodes with different coatings and then interrogating or stimulating them as needed, so that different measurements can be taken as needed. Additionally and / or alternatively, this allows different measurements to be taken via different microstructures, e.g., for spatial discrimination and therefore mapping. For example, by interrogating electrodes at different locations on the patch, a measurement map at different locations can be constructed, which can then be used to determine effects such as the presence of an analyte or a particular target, such as a lesion or cancer. Furthermore, this allows stimuli to be delivered to different microstructures. For example, in theranostic embodiments, different therapeutic materials or doses can be associated with different microstructures, so that various interventions can be performed by selectively stimulating different microstructures. In some examples, different microstructures can be used for different purposes, so that some microstructures are used for sensing and others are used for delivering stimulation and / or therapy.

[0160] In another example, when electrodes are provided in pairs, it is possible for some electrode pairs to be used independently of other pairs, as described in more detail below. In one particular example, the electrodes and / or electrode pairs may be provided in columns, allowing measurements to be made row by row, although this is not required and other groupings may be used.

[0161] The nature of the substrate and / or microstructure varies depending on the preferred embodiment. For example, the substrate and / or microstructure can be made of or contain fabric, woven fabric, electronic fabric, natural fiber, silk, organic material, natural composite material, artificial composite material, ceramic, stainless steel, ceramic, stainless steel, metal such as titanium or platinum, polymer such as rigid or semi-rigid plastic including doped polymer, silicon or other semiconductor including doped semiconductor, organosilicate, gold, silver, carbon, carbon nanomaterial, etc. The substrate and microstructure can be made of similar and / or dissimilar materials and can be integrally formed or fabricated separately and bonded together. The microstructure can also be provided on one or more substrates, so that, for example, signals can be measured or applied between microstructures on separate substrates.

[0162] It will be understood that the specific materials used will depend on the intended application, thus, for example, different materials will be used if the microstructures need to be conductive rather than insulating. Insulating materials such as polymers and plastics can also be doped to provide the necessary conductivity, for example, by doping with micro- or nano-sized metal particles, or conductive composite polymers such as PEDOT:PSS (poly(3,4-ethylenedioxythiophene)polystyrene) can be used. When doping is used, it can involve the use of graphite or graphite derivatives, including 2D materials such as graphene and carbon nanotubes, which can also be used as stand-alone materials or blended with polymers or plastics and used as dopants.

[0163] The substrate and microstructure can be fabricated using any suitable technique. For example, in the case of silicon-based structures, this can be done using etching techniques. Polymer or plastic structures can also be fabricated using additive manufacturing or molding, such as 3D printing. In one particular example, a mold is filled with a suitable filler material, such as a solution containing an active compound and / or a sugar-based excipient such as carboxymethylcellulose (CMC), or one or more polymers, which is then cured and removed. As discussed in more detail below, it will be understood that the filler material can also include any necessary probes, reagents, etc. to be contained within the structure. Photoresists, including SU8, or photosensitive polymers, such as polyimides, can be used to directly pattern electrodes on a substrate or to create microstructures. Successive layers of photosensitive resists, polymers, metals, etc. can be deposited and / or selectively removed to yield custom 3D microstructure shapes.

[0164] In one example, the substrate can be at least partially flexible to allow it to conform to the shape of the subject, thereby ensuring penetration of the microstructures into the living epidermis and / or dermis, or other functional barrier. In this example, the substrate could be a textile or fabric into which the electrodes and circuitry are woven, or multiple substrates could be attached to a flexible backing to provide a segmented substrate fitment. Alternatively, the substrate can be molded to conform to the shape of the subject, while remaining rigid and ensuring penetration of the microstructures.

[0165] In a preferred example, the substrate and microstructure are formed from one or more of a metal, a polymer, or silicon.

[0166] The microstructures may have a variety of shapes, including ridges, needles, plates, blades, etc. In this regard, the terms plate and blade are used interchangeably to refer to microstructures whose width is on the same order of magnitude as their length but are significantly thinner. The microstructures may be tapered to facilitate insertion into a subject and may have different cross-sectional shapes, for example, depending on the intended use. The microstructures typically have a rounded rectangular shape and may include shape variations along the length of the microstructure. For example, the microstructures may include a shoulder configured to abut the stratum corneum to control the depth of penetration, and / or a shaft extending to a tip configured to control the position of the tip within the subject and / or provide a surface for an electrode.

[0167] Examples of other shapes include circles, rectangles, cross shapes, squares, rounded squares, rounded rectangles, ovals, etc., which can allow for increased surface area, which is useful in coating microstructures to maximize the coating volume and therefore the amount of payload delivered per microstructure, although it will be understood that various other shapes can also be used. The microstructures can have rough or smooth surfaces or can include surface features such as pores, ridges, or serrations that can increase the surface area and / or help penetrate or engage tissue, thereby anchoring the microstructure within a subject. This can also help reduce biofouling, for example, by preventing biofilm adhesion and therefore accumulation. The microstructures can also be hollow or porous and can include internal structures such as holes, in which case the cross-sectional shape can also be at least partially hollow. In certain embodiments, the microstructures are porous, which can increase the effective surface area of ​​the microstructure. The pores may be of any suitable size that allows the analyte of interest to enter the pore while excluding one or more other analytes or substances, and thus depends on the size of the analyte of interest, hi some embodiments, the pores may be less than about 10 μm in diameter, and preferably less than about 1 μm in diameter.

[0168] In one example, the microstructure has a rounded rectangular shape when viewed in cross section through a plane extending laterally through the microstructure and parallel to but offset from the substrate. The microstructure may include a shape variation along the length of the microstructure. For example, the microstructure may include a shoulder configured to abut the stratum corneum to control the depth of penetration, and / or a shaft extending to a tip configured to control the position of the tip within the subject and / or provide a surface for an electrode.

[0169] Different microstructures can also be provided on a common substrate, for example, microstructures of different shapes can be provided to achieve different functions. In one example, this can include performing different types of measurements. In another example, microstructures can be provided on different substrates, for example, sensing can be performed via microstructures on one patch and therapy delivery can be performed via microstructures on a different patch. In this example, this allows therapy patches to be replaced when they are depleted, while the sensing patch can remain in situ. Additionally, measurements can be made between patches, for example, whole body impedance measurements can be performed between patches provided at different locations on a subject.

[0170] Additionally and / or alternatively, anchor microstructures may be provided that can be used to anchor the substrate to a subject. In this regard, the anchor microstructures will typically be longer in length than the microstructures, which may help hold the substrate in place on the subject and ensure that the substrate does not move or is inadvertently removed during measurement. The anchor microstructures may include anchoring structures, such as raised portions, that can aid in tissue engagement, which may be formed by the shape of the microstructure and / or the shape of the coating. Additionally, the coating may include a hydrogel or other similar material that expands upon exposure to moisture within the subject, thereby further facilitating engagement with the subject. Similarly, the microstructures may undergo a shape change, such as swelling, in response to exposure to substances such as water or moisture within the subject or in response to an applied stimulus. The anchor microstructures may penetrate the dermis when applied to the skin and thus be longer than the other microstructures, helping to hold the substrate in place, although it will be understood that this is not required and depends on the preferred embodiment. In other examples, the anchor microstructures may be rougher than the other microstructures, have more surface friction than the other microstructures, be duller than the other microstructures, or be thicker than the other microstructures.

[0171] In a further example, at least a portion of the substrate can be coated with an adhesive coating to allow the substrate, and therefore the patch, to adhere to a subject.

[0172] As mentioned above, when applied to skin, the microstructures typically penetrate the viable epidermis, and in one example, they do not penetrate the dermis, but in other examples, they may penetrate the dermis. However, this is not required, and in some applications, it may be necessary for the microstructures to penetrate the dermis, for example, to protrude briefly through the viable epidermis / dermis boundary, or to penetrate a significant distance into the dermis, depending primarily on the nature of the sensing being performed. In one example, for skin, the microstructures have a length that is at least one of less than 2500 μm, less than 1000 μm, less than 750 μm, less than 600 μm, less than 500 μm, less than 400 μm, less than 300 μm, less than 250 μm, more than 100 μm, more than 50 μm, and more than 10 μm, although it will be understood that other lengths may also be used. More generally, when applied to a functional barrier, the microstructure typically has a length greater than the thickness of the functional barrier, at least 10% greater than the thickness of the functional barrier, at least 20% greater than the thickness of the functional barrier, at least 50% greater than the thickness of the functional barrier, at least 75% greater than the thickness of the functional barrier, and at least 100% greater than the thickness of the functional barrier.

[0173] In another example, the microstructure has a length that is 2000% greater than the thickness of the functional barrier, 1000% greater than the thickness of the functional barrier, 500% greater than the thickness of the functional barrier, 100% greater than the thickness of the functional barrier, 75% greater than the thickness of the functional barrier, or 50% greater than the thickness of the functional barrier. This avoids deep penetration of potentially undesirable underlying layers within the body, and it will be understood that the length of the microstructure used will vary depending on the intended use and, in particular, the nature of the barrier to be breached and / or the signal to be applied or measured. The length of the microstructure may also be non-uniform, for example, a blade may be taller at one end than the other, thereby facilitating penetration of the target or functional barrier.

[0174] Similarly, the microstructures can have different widths depending on the preferred embodiment. Typically, the width is at least one of less than 25% of the length, less than 20% of the length, less than 15% of the length, less than 10% of the length, or less than 5% of the length. Thus, for example, the microstructures can have a width of less than 50 μm, less than 40 μm, less than 30 μm, less than 20 μm, or less than 10 μm when applied to the skin. However, the microstructures can alternatively comprise blades and be wider than their length. In some examples, the microstructures can have widths of less than 50,000 μm, less than 40,000 μm, less than 30,000 μm, less than 20,000 μm, less than 10,000 μm, less than 5,000 μm, less than 2,500 μm, less than 1,000 μm, less than 500 μm, or less than 100 μm. In the example of a blade, it is also possible to use microstructures with widths substantially up to the width of the substrate.

[0175] Generally, the thickness of the microstructure is fairly small to facilitate penetration, typically less than 1000 μm, less than 500 μm, less than 200 μm, less than 100 μm, less than 50 μm, less than 20 μm, less than 10 μm, at least 1 μm, at least 0.5 μm, or at least 0.1 μm. Generally, the thickness of the microstructure is dictated by mechanical requirements, particularly the need to ensure that the microstructure does not break, fracture, or deform upon penetration. However, this problem can be mitigated by the use of coatings that add additional mechanical strength to the microstructure.

[0176] In one specific example, for epidermal detection, the microstructures have lengths of less than 300 μm, more than 50 μm, more than 100 μm, and about 150 μm, and widths greater than or equal to the length of the microstructures, typically less than 300 μm, more than 50 μm, and about 150 μm. In another example, for dermal detection, the microstructures have lengths of less than 450 μm, more than 100 μm, and about 250 μm, and widths greater than or equal to the length of the microstructures, typically less than 450 μm, more than 100 μm, and about 250 μm, and widths greater than or equal to the length of the microstructures, and at least similar in magnitude to the length. In other examples, longer microstructures can be used, so that, for example, for hyperdermal detection, the length of the microstructures will be longer. The microstructures typically have thicknesses that are less than, significantly less than, or on the order of magnitude smaller than the width. In one example, the thickness is less than 50 μm, more than 10 μm, and about 25 μm, although the microstructures typically include an extended base for additional strength, thus comprising a base thickness close to the substrate that is about three times the thickness, typically less than 150 μm, more than 30 μm, and about 75 μm. The microstructures typically have a tip that is less than 50% of the length of the microstructure, at least 10% of the length of the microstructure, and more typically about 30% of the length of the microstructure. The tip further has a sharpness of at least 0.1 μm, less than 5 μm, and typically about 1 μm.

[0177] In one example, the microstructure is 1000 / cm 2 Less than 500 / cm 2 Less than 100 / cm 2 Less than 10 / cm 2 Less than or even 5 / cm 2 Less than 10000 / cm 2 The density is relatively low, such as less than 50,000 / cm. The use of a relatively low density facilitates penetration of the microstructures through the stratum corneum, particularly avoiding problems associated with skin penetration with high density arrays, which may require higher power actuators to properly apply the array. However, this is not required, and the density may be less than 50,000 / cm. 2 Fine structures less than 30,000 / cm 2Higher density microstructure arrangements can also be used, including microstructures of less than 100 μm. As a result, the microstructures typically have spacings of less than 20 mm, less than 10 mm, less than 1 mm, less than 0.1 mm, or less than 10 μm. It should be noted that in some circumstances, the microstructures are arranged in pairs, with the microstructures within each pair having small spacings, such as less than 10 μm, while the pairs have larger spacings, such as greater than 1 mm, to ensure that a low overall density is maintained. However, it will be appreciated that this is not required, and higher densities may be used in some circumstances.

[0178] In one embodiment, the microstructure has a density of 5000 / cm 2 Less than 100 / cm 2 Over and about 600 / cm 2 with a density of less than 1 mm, greater than 10 μm, and spacing of about 0.5 mm, 0.2 mm, or 0.1 mm.

[0179] In one example, when optical sensing is performed, the substrate connections include waveguides or other electromagnetically conductive pathways, such as optical fibers, that extend through the microstructure to one or more ports in the microstructure, allowing electromagnetic radiation to be emitted from or received through the ports. In one example, this is achieved by having the microstructure made from or contain a polymer or other similar material that is at least partially transparent to the frequencies of the applied or received electromagnetic radiation, which may include visible light, ultraviolet light, infrared light, etc., depending on the preferred application.

[0180] In one example, an at least partially electromagnetically transparent core can be surrounded by an outer electromagnetically opaque layer, with ports extending through the opaque layer and allowing electromagnetic radiation to be emitted or received through the ports. It will be appreciated that in this example, appropriate placement of the ports can allow radiation to be delivered or received in a targeted manner, for example, directing it to a specific depth within the living epidermis or elsewhere. In one example, the transparent core can be made from a waveguide, such as a fiber optic cable, or a portion thereof. For example, the outer layer and / or reflective layer can be removed, allowing the transparent core of the microstructure to be made from an optical fiber core. In a further example, the microstructure includes an electromagnetically reflective layer that allows electromagnetic radiation to be conducted to and from the designated ports.

[0181] Similar provisions are provided for electrical signal transmission, where the microstructure includes an electrically conductive core material and optionally an electrically insulating layer including ports that allow electrical signals to be emitted from or received by the ports, again optionally at different depths so that electrical signals can be measured at different locations and / or depths.

[0182] Thus, the microstructure may comprise an electrically conductive material covered by a non-conductive (insulating) layer, with openings providing access to the conductive material to allow conduction of electrical signals therethrough, thereby defining electrodes. In one example, the insulating layer extends over a portion of the surface of the microstructure, including the proximal end of the microstructure adjacent the substrate. The insulating layer may extend over at least half the length of the microstructure and / or approximately 60 μm, 90 μm, or 150 μm of the proximal end of the microstructure, and optionally over at least a portion of the distal portion of the microstructure. In one specific example, this is done so that the non-insulated portion is provided within the epidermis and / or dermis to apply stimulating signals to and / or receive response signals from the epidermis and / or dermis. The insulating layer may also extend over some or all of the surface of the substrate. In this regard, in some instances, connections are formed on the surface of the substrate, in which case a coating may be used to insulate them from the subject. For example, electrical connections to the electrodes may be provided using electrical tracks on the surface of the substrate, with an insulating layer provided over the connections to ensure that the connections do not make electrical contact with the subject's skin which may further adversely affect the measured response signal.

[0183] In another example, at least some of the microstructures include electrodes. The microstructures can be made from metal or other conductive material such that the entire microstructure constitutes the electrode, or an electrode can be coated or deposited on the microstructure, for example, by depositing a layer of gold to form the electrode. In a further example, the microstructure can include an electrically conductive core covered with a non-conductive layer, with openings providing access to the core and allowing conduction of electrical signals through the openings. The electrode material can include any one or more of gold, silver, colloidal silver, colloidal gold, colloidal carbon, carbon nanomaterials, platinum, titanium, stainless steel, or other metals, or any other biocompatible conductive material.

[0184] The electrodes can be used to apply an electrical signal to a subject and measure an endogenous or exogenous response electrical signal, such as measuring an ECG or impedance, etc. In another example, one or more microstructure electrodes interact with one or more analytes of interest such that the response signal depends on the presence, absence, level, or concentration of the one or more analytes of interest, thereby allowing the level or concentration of the one or more analytes to be quantified.

[0185] In one example, the microstructure comprises a plate having a substantially planar surface with an electrode thereon. The use of a plate shape maximizes the surface area of ​​the electrode while minimizing the cross-sectional area of ​​the microstructure, thereby aiding in the penetration of the microstructure into a target. This also allows the electrode to act as a capacitive plate, enabling capacitive sensing. In one example, the electrode is at least 10 mm 2 , at least 1 mm 2 , at least 100,000 μm 2 , 10,000 μm 2 , at least 7,500 μm 2 , at least 5,000 μm 2 , at least 2,000 μm 2 , at least 1,000 μm 2 , at least 500 μm 2 , at least 100 μm 2 , or at least 10 μm 2 In one example, the electrode has a width or height of at most 2500 μm, at least 500 μm, at least 200 μm, at least 100 μm, at least 75 μm, at least 50 μm, at least 20 μm, at least 10 μm, or at least 1 μm. In the case of electrodes provided on a blade, the width of the electrode can be less than 50,000 μm, less than 40,000 μm, less than 30,000 μm, less than 20,000 μm, less than 10,000 μm, or less than 1,000 μm, including the widths outlined above. In this regard, it should be noted that these dimensions apply to individual electrodes, and that in some instances each microstructure may include multiple electrodes.

[0186] In one embodiment, the electrodes are 200,000 μm 2 Less than, at least 2000 μm 2 and approximately 22,500 μm 2 , the electrode extends the length of the distal portion of the microstructure, optionally spaced from the tip, and optionally positioned proximate the distal end of the microstructure, as well as proximate the tip of the microstructure. The electrode may extend over at least 25% and less than 50% of the length of the microstructure, so that the electrode typically extends over about 60 μm, 90 μm, or 150 μm of the microstructure and thus is positioned within the living epidermis and / or dermis of the subject during use.

[0187] In one example, at least some of the microstructures are arranged in groups, such as pairs, and a response signal or stimulus is measured from or applied to the microstructures within the group. The microstructures within the group can have a specific configuration that enables a particular measurement to be made. For example, when arranged in pairs, the separation distance can be used to affect the nature of the measurement made. For example, when making bioimpedance measurements, if the separation between the microstructures is greater than a few millimeters, this tends to measure the properties of the interstitial fluid located between the electrodes, while decreasing the distance between the microstructures makes the measurement more influenced by surface properties, such as the presence of material bound to the surface of the microstructures. The measurement is also affected by the nature of the stimulus applied; for example, low-frequency currents tend to flow through extracellular fluid, while higher-frequency currents are more influenced by intracellular fluid.

[0188] In one particular example, the plate microstructures are provided in pairs, each pair including spaced apart plate microstructures with opposing, substantially planar electrodes. This can be used to generate a highly uniform field in a subject in the region between the electrodes and / or for capacitive or conductive sensing of materials between the electrodes. However, this is not required, and other configurations, such as spacing multiple electrodes circumferentially around a central electrode, can be used. Typically, the spacing between electrodes within each group is typically less than 50 mm, less than 20 mm, less than 10 mm, less than 1 mm, less than 0.1 mm, or less than 10 μm, although it will be appreciated that larger spacings, including spacings up to and / or greater than the dimensions of the substrates, can also be used when the microstructures are distributed across multiple substrates.

[0189] Thus, in one embodiment, at least some of the microstructures are arranged in pairs, and response signals are measured between the microstructures in the pair and / or stimuli are applied between the microstructures in the pair. Each microstructure pair typically includes spaced apart plate microstructures having opposing substantially planar electrodes and / or spaced apart substantially parallel plate microstructures.

[0190] In one example, at least some pairs of microstructures are angularly offset, and in one particular example, orthogonal. Thus, in the case of plate microstructures, at least some pairs of microstructures extend in different, optionally orthogonal, directions. This also serves to reduce lateral slippage of the patch by distributing stresses associated with patch insertion in different directions and ensuring that the plates at least partially face the direction of any lateral force. Reducing slippage during or after insertion can help reduce discomfort, erythema, etc., and can help make the patch more comfortable to wear over long periods of time. Additionally, this can help account for any electrical anisotropy in the tissue, for example, as a result of fibrin structure in the skin, cellular anisotropy, etc.

[0191] In one embodiment, pairs of adjacent microstructures are angularly offset and / or orthogonally arranged, and additionally and / or alternatively, pairs of microstructures can be arranged in rows, with pairs of microstructures in one row being orthogonal or angularly offset relative to pairs of microstructures in another row.

[0192] In one specific example, when pairs of microstructures are used, the spacing between the microstructures within each pair is typically less than 0.25 mm, greater than 10 μm, and about 0.1 mm, while the spacing between groups of microstructures is typically less than 1 mm, greater than 0.2 mm, and about 0.5 mm. Such arrangements help ensure that electrical signals are applied and measured primarily within pairs, reducing crosstalk between pairs and allowing independent measurements to be recorded for each microstructure / electrode pair.

[0193] To create an array of electrode pairs, this can be done by fabricating a first substrate having first microstructures and corresponding first apertures. Next, an insulating layer is provided on the side of the first substrate opposite the first microstructures, after which a second substrate is provided on the insulating layer. In this example, the second substrate has second microstructures that extend through the insulating layer and the first apertures to form pairs of first and second microstructures, an example of which is described in more detail below. In one example, the first and second apertures are offset to reduce capacitive coupling between the first and second substrates. Alternatively, other mechanisms for capacitive coupling between the substrates can be used.

[0194] The microstructures can be configured to interact with, and in particular bind to, one or more analytes of interest, allowing them to be detected. In particular, in one example, binding of one or more analytes to the microstructure can alter the charge transport capability, resulting in a change in the capacitance of the electrode pair, which can then be monitored to derive the level or concentration of the analyte. Binding of the analyte can be achieved using a variety of techniques, including mechanical properties of the microstructure, such as the presence of pores or other physical structures, the selection of materials from which the microstructure is fabricated, the use of coatings, or otherwise affecting the properties of the microstructure, such as the use of magnetic microstructures.

[0195] Additionally, the microstructures and / or substrates can incorporate one or more materials or other additives, either within the body of the microstructure or through the addition of a coating containing the additive. The nature of the material or additive varies depending on the preferred embodiment and may include bioactive materials, reagents for reacting with analytes in a subject, binders for binding to analytes of interest, materials for binding one or more analytes of interest, probes for selectively targeting analytes of interest, materials for reducing biofouling, materials for attracting at least one substance to the microstructure, materials for repelling or excluding at least one substance from the microstructure, materials for attracting at least some analytes to the microstructure, or materials for repelling or excluding analytes. In this regard, materials may include any one or more of cells, fluids, analytes, etc. Examples of materials include polyethylene, polyethylene glycol, polyethylene oxide, zwitterions, peptides, hydrogels, and self-assembled monolayers.

[0196] The material can be contained within the microstructure itself, for example by impregnating the microstructure during manufacture, can be the material from which the microstructure is formed, or can be provided in a coating. Thus, it will be appreciated that at least some of the microstructures can be coated with a coating, such as a material for binding one or more analytes of interest, which can be used to target specific analytes of interest, allowing those analytes to bind or otherwise attach to the microstructure, so that those analytes can then be detected in situ using an appropriate detection mechanism, such as by detecting a change in optical or electrical properties.

[0197] In some embodiments, the material or additive is a material for binding one or more analytes of interest.

[0198] In certain embodiments, the material is an aptamer, particularly a plurality of aptamers. In certain embodiments, the aptamer is a coating on the microstructure.

[0199] The identity of the aptamer depends on the specific target analyte and detection method.Those skilled in the art can easily identify and use the aptamer suitable for each target analyte and detection method.The aptamer interacts or binds with the target analyte, and changes its conformation when the analyte binds.For example, in some embodiments, the aptamer has a first conformation when the analyte is not bound, and a second conformation when the analyte is bound.

[0200] In some embodiments, the second conformation results in a portion of the aptamer (e.g., a first end of the aptamer, such as the 3' or 5' end) being closer to the microstructure (and electrode) than in the first conformation (i.e., the distance between the portion of the aptamer and the microstructure is decreased in the second conformation). In alternative embodiments, the second confirmation results in a portion of the aptamer being farther from the microstructure (and electrode) than in the first conformation (i.e., the distance between the portion of the aptamer and the microstructure is increased in the second confirmation). This change in proximity between the portion of the aptamer and the microstructure can be further detected using a label moiety, such as a redox moiety or fluorescent label, attached to or proximate to the relevant portion of the aptamer, e.g., the first end. In certain embodiments, the portion of the aptamer is preferably the first end (e.g., the 5' end) of the aptamer when the second end (e.g., the 3' end) of the aptamer is conjugated or otherwise attached, directly or indirectly, to the microstructure. Thus, in some embodiments, the second conformation results in the first end of the aptamer being closer to the microstructure than the first conformation, or alternatively, the first end of the aptamer being farther from the microstructure than the first conformation, so that, for example, a first signal is generated when the aptamer is in the first conformation and a second signal is generated when the aptamer is in the second conformation, where the first signal is other than the second signal (i.e., the first signal and the second signal are different).

[0201] Although aptamers of any structure are contemplated, in certain embodiments, the aptamer comprises or consists of a stem-loop hairpin structure.

[0202] Suitable aptamers are known in the art or can be identified using a variety of methods known in the art of aptamer selection.

[0203] For example, suitable aptamers are described in Negahdary et al. (2018) J Biomed Phys Eng, 8(2):167-178, Jo et al. (2015) Anal Chem, 87:9869-9875, U.S. Patent Application Publication No. 2012 / 0316326(A1), Chinese Patent No. 102703455(A), Korean Patent No. 20160021488(A), U.S. Patent Application Publication No. 2019 / 0219595(A1), Pfefiffer and Mayer (2016) Frontiers in Chemistry. Chem), 4:25, International Publication No. 2017 / 210683(A1), Chinese Patent No. 102660547(A), International Publication No. 2017 / 210683(A1), Chinese Patent No. 105136754(A), International Publication No. 2012 / 130948(A1), U.S. Patent No. 5582981, U.S. Patent No. 5595877, U.S. Patent Application Publication No. 2018 / 0327746 (A1), European Patent No. 2532749(B1), U.S. Patent Application Publication No. 2012 / 0135540(A1), Chinese Patent No. 105349545(A), U.S. Patent Application Publication No. 2011 / 0318846(A1), Chinese Patent No. 104745585(A), Stojanovic et al. (2000) J Am Chem Soc, 122:11547-11548, International Publication No. 2015 / 197706(A1), International Publication No. 2019 / 094315(A1), or U.S. Patent Application Publication No. 2017 / 0233738(A1), the entire contents of which are incorporated herein by reference.

[0204] In some embodiments, the aptamer is a troponin-selective aptamer, representative examples of which include those described in Negahdary et al. (2018) J Biomed Phys Eng, 8(2):167-178, Jo et al. (2015) Anal Chem, 87:9869-9875, U.S. Patent Application Publication No. 2012 / 0316326(A1), Chinese Patent No. 102703455(A), Korean Patent No. 20160021488(A), and U.S. Patent Application Publication No. 2019 / 0219595(A1), the entire contents of which are incorporated herein by reference.

[0205] In some embodiments, the aptamer is selected from the group consisting of AGTCTCCGCTGTCCTCCCGATGCACTTGACGTATGTCTCACTTTCTTTTCATTGACATGGGATGACGCCGTGACTG [SEQ ID NO: 1], CGTGCAGTACGCAACCTTTCTCATGCGCTGCCCCTCTTA [SEQ ID NO: 2], AGTCTCCGCTGTCCTCCCGATGCACTTGACGTATGTCTCACTTTCTTTTCATTGACATGGGATGACGCCGTGACTG [SEQ ID NO: 3], CGTGCAGTACGCAACC TTTCTCATGCGCTGCCCCTCTTA [SEQ ID NO: 4], CGCATGCCAAACGTTGCCTCATAGTTCCCTCCCCGTGTCC [SEQ ID NO: 5], TCACACCCTCCCTCCCACATACCGCATACACTTTCTGATT [SEQ ID NO: 6], CCCGACCACGTCCCTGCCCTTTCCTAACCTGTTTGTTGAT [SEQ ID NO: 7], ATGCGTTGAACCCTCCTGACCGTTTATCACATACTCCAGA [SEQ ID NO: 8], CGTGCAGTACGCAACCTTTCTCATGC GCTGCCCCTCTTA [SEQ ID NO: 9], CAACTGTAATGTACCCTCCTCGATCACGCACCACTTGCAT [SEQ ID NO: 10], CGCATGCCAAACGTTGCCTCATAGTTCCCTCCCCGTGTCC [SEQ ID NO: 11], and AGTCTCCGCTGTCCTCCCGATGCACTTGACGTATGTCTCACTTTCTTTTCATTGACATGGGATGACGCCGTGACTG [SEQ ID NO: 12], TCACACCCTCCCTCCCACATACCGCATACACTTTCTGATT [SEQ ID NO: 13]. No. 13], CCCGACCACGTCCCTGCCCTTTCCTAACCTGTTTGTTGAT [SEQ ID NO: 14], ATGCGTTGAACCCTCCTGACCGTTTATCACATACTCCAGA [SEQ ID NO: 15], CGTGCAGTACGCAACCTTTCTCATGCGCTGCCCCTCTTA [SEQ ID NO: 16], CAACTGTAATGTACCCTCCTCGATCACGCACCACTTGCAT [SEQ ID NO: 17], CGCATGCCAAACGTTGCCTCATAGTTCCCTCCCCGTGTCC [SEQ ID NO: 18],TCACACCCTCCCTCCCACATACCGCATACACTTTCTGATT [SEQ ID NO: 19], CCCGACCACGTCCCTGCCCTTTCCTAACCTGTTTGTTGAT [SEQ ID NO: 20], ATGCGTTGAACCCTCCTGACCGTTTATCACATACTCCAGA [SEQ ID NO: 21], CAACTGTAATGTACCCTCCTCGATCACGCACCACTTGCAT [SEQ ID NO: 22], CGTGCAGTACGCAACCTTTCTCATGCGCTGCCCCTCTTA [SEQ ID NO: 23], CGCATGCCAAACGTTGCCTCATAGTTCCCTCCCCGTGTCC [SEQ ID NO: 24], GGGATGGGGTGGGTGGCCAGCGATT [SEQ ID NO: 25], and TTAGGGGTGGTGTGGTTGGCAATTC [SEQ ID NO: 26], particularly SEQ ID NO: 1.

[0206] The present invention also contemplates variants of the sequences provided herein. Thus, in some embodiments, the aptamer comprises, consists of, or consists essentially of a nucleotide sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1-26, particularly SEQ ID NO: 1.

[0207] To determine the percentage of sequence identity between two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced into one or both of the first and second nucleic acid sequences for optimal alignment, and non-homologous sequences can be ignored for comparison purposes). In some embodiments, the length of the reference sequence aligned for comparison purposes is at least 40%, more usually at least 50% or 60%, and even more usually at least 70%, 80%, 90%, or 100% of the length of the reference sequence. Next, the nucleotides at corresponding nucleotide positions are compared. If a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, the molecules are identical at that position.

[0208] Comparison of sequences and determination of percent identity between sequences can be accomplished using a mathematical algorithm. In one embodiment, percent identity between nucleic acid sequences is determined using the Needleman and Wuensch (1970, J. Mol. Biol., 48:444-453) algorithm incorporated into the GAP program of the GCG software package (Devereaux et al. (1984) Nucleic Acids Research, 12:387-395), using either a Blosum62 matrix or a PAM250 matrix, and gap weights of 16, 14, 12, 10, 8, 6, or 4 and length weights of 1, 2, 3, 4, 5, or 6. In some embodiments, percent identity between nucleic acid sequences may be determined using the algorithm of Meyers and Miller (1989, Cabios, 4:11-17) as incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4.

[0209] Alternatively, suitable aptamers can be identified and prepared using various methods known in the art of aptamer selection, including Systematic Evolution of Ligands by Exponential Enrichment (SELEX) techniques (e.g., as described in U.S. Pat. Nos. 5,475,096 and 5,270,163) and methods described in International Publication Nos. WO 2019 / 067383(A1), U.S. Pat. No. 5,582,981, U.S. Pat. No. 5,595,877, and U.S. Pat. No. 5,637,459, the entire contents of which are incorporated herein by reference. In certain embodiments, aptamers can be identified and prepared using SELEX techniques. Briefly, this method can involve systematically subjecting a large random pool of oligonucleotides to negative and positive selection rounds against a target, e.g., an analyte such as a protein, to remove low-affinity or nonspecific binders. The remaining aptamers can be collected, expanded, e.g., PCR-amplified, and used in subsequent selection rounds.

[0210] In some embodiments, it may be desirable to improve the stability of aptamers. Several approaches are known in the art, including capping the ends of aptamers, substituting naturally occurring nucleotides with non-natural nucleotides (e.g., 2'-F, 2'-OCH3, 2'-H, 2'-OH, or 2'-NH2 modified nucleotides, such as 2'-fluorine-substituted pyrimidines, 2'-aminopyrimidines, and 2'-O-methylribose purines and pyrimidines), using non-natural internucleotide linkages, such as phosphorothioate, methylphosphonate, or triazole linkages, using modified sugar moieties, conjugating molecules such as biotin to the 3' end, capping the 3' end with inverted thymidine (dT), conjugating protein-like side chains to nucleotides, such as the 5-position of deoxyuridine (dU) (e.g., 5-(N-benzylcarboxamido)-2-deoxyuridine), and developing "spiegelmers" composed entirely of non-natural L-ribonucleic acid backbones. Further approaches are described, for example, in Shuaijian et al. (2017) Int J Mol Sci, 18(8):1683, the contents of which are incorporated herein by reference in their entirety.

[0211] Aptamers may be modified to increase the sensitivity and binding kinetics of the aptamer to the analyte of interest. It should be noted that one or more approaches to improving aptamer stability, particularly conjugating a protein-like side chain to a nucleotide such as the 5-position of deoxyuridine (dU) (e.g., 5-(N-benzylcarboxamido)-2-deoxyuridine), can achieve this result. Further modifications to increase the sensitivity and binding kinetics of the aptamer to the analyte of interest can be achieved using methods described in Ricci et al. (2016) Acc Chem Res, 49(9):1884-1892, including population shift, allostery, matched receptor set, intracellular invagination, and cooperativity. Further approaches contemplated by the present invention may include retaining structures that hold the aptamer in the second configuration to extend the recovery time of the aptamer, such as complementary primers attached to the ends of the aptamer that bind together upon analyte binding to hold the aptamer in the second configuration beyond the recovery interval, and at least one blocker attached to the aptamer that prevents the primers from binding together prior to analyte binding, or attaching functional groups that interact with each other upon analyte binding to hold the aptamer in the second configuration beyond the recovery interval. Such approaches are described in WO 2018 / 031559 A1, the entire contents of which are incorporated herein by reference.

[0212] In some embodiments, the aptamer comprises a moiety, such as a functional group or compound, for attaching or immobilizing the aptamer onto the surface of the microstructure, preferably via a covalent bond. Suitable moieties for attaching or immobilizing the aptamer onto the surface of the microstructure include, but are not limited to, thiols, amines, carboxylic acids, alcohols, carbodiimides, Nafion, avidin, biotin, azides, and the like, particularly thiols. While the moiety can be attached directly to the aptamer, in some embodiments, the moiety can be a C1-C 20 Alkyl, especially C6 or C 11The aptamer is attached via a linker such as an alkyl chain, including alkyl, particularly a C6 alkyl linker (i.e., a (CH2)6 linker), a polymer such as polyethylene glycol (PEG), or a nucleic acid sequence, including DNA and RNA sequences. In certain embodiments, the linker is a C1-C 20 Alkyl, especially C6 or C 11 Alkyl, particularly alkyl chains such as C alkyl linkers (i.e., (CH) linkers). Suitable linkers and synthetic routes to producing such linkers are known in the art, such as Lai et al. (2006) Langmuir, 22:10796-10800, the entire contents of which are incorporated herein by reference.

[0213] Aptamers can be prepared using standard oligonucleotide synthesis techniques in the art, such as chemical synthesis (see, e.g., Itakura et al. (1984) Ann Rev Biochem 53:323-356). Aptamers can also be prepared by amplification (e.g., PCR) of aptamers prepared using SELEX technology as described in U.S. Pat. Nos. 5,475,096 and 5,270,163, as well as the methods described in WO 2019 / 067383(A1), U.S. Pat. No. 5,582,981, U.S. Pat. No. 5,595,877, and U.S. Pat. No. 5,637,459. Aptamers are also commercially available from several sources, including Bioneer Pacific, Bio-synthesis Inc., and TriLink Biotechnologies.

[0214] Aptamers are selective for binding one or more analytes of interest. Preferably, the aptamer is selective for binding one or more analytes of interest, such as troponin or a subunit thereof, particularly troponin I, relative to at least one other substance present in the sample, preferably a majority of other substances present in the sample.

[0215] In some embodiments, the aptamer comprises a label or labeling moiety, such as a redox moiety, a fluorescent label, etc. Such moieties are useful for detecting conformational changes in the aptamer upon binding of an analyte, as discussed herein.

[0216] In some embodiments, the aptamer comprises a redox moiety. Suitable redox moieties include any chemical moiety capable of redox reaction that can be conjugated or otherwise attached to the aptamer. For example, suitable redox moieties include, but are not limited to, methylene blue, ferrocene, vinylferrocene, anthraquinone, Nile blue, thionine, anthraquinone-C5, dabcyl, 2,6-dichlorophenal-indophenol, gallocyanine, ROX, pentamethylferrocene, ferrocene-C5, neutral red, and horseradish peroxidase, particularly methylene blue, ferrocene, anthraquinone, or Nile blue, especially methylene blue.

[0217] The redox moiety may be attached at any suitable point on the aptamer, so long as the conformational change that occurs upon binding of an analyte to the aptamer results in a detectable change in the spacing between the redox moiety and the electrode of the microstructure on which the aptamer is immobilized. In some embodiments, the redox moiety is closer to the electrode of the microstructure on which the aptamer is immobilized in the second conformation (i.e., upon analyte binding) compared to the first conformation (i.e., the spacing is decreased in the second conformation). In alternative embodiments, the redox moiety is farther from the electrode of the microstructure on which the aptamer is immobilized in the second conformation (i.e., upon analyte binding) compared to the first conformation (i.e., the spacing is increased in the second conformation). For example, in some embodiments, the redox moiety is attached to the 3'-end or 5'-end of the aptamer, particularly the 3'-end of the aptamer, and the aptamer is attached to the microstructure through the opposite end, such as the 5'-end or vice versa, preferably the 5'-end. Without wishing to be bound by theory, it is proposed that decreasing the spacing between the redox moiety and the electrode increases electron transfer from the redox moiety to the electrode of the microstructure on which the aptamer is immobilized, and vice versa, thereby producing a detectable change that can be correlated with the presence, absence, level or concentration of the analyte.

[0218] In some embodiments, the aptamer comprises a fluorescent label. Suitable fluorescent labels include fluorescein, 6-carboxyfluorescein (FAM), coumarin, rhodamine, 5-TMRIA (tetramethylrhodamine-5-iodoacetamide), (9-(2(or 4)-(N-(2-maleimdylethyl)-sulfonamidyl)-4(or 2)-sulfophenyl)-2,3,6,7,12,13,16,17-octahydro-(1-H,5H,11H,15H-xantheno(2,-3,4-ij:5,6,7-i'j')diquinolizine-18-ium salt) (Texas Red), 2-(5-(1-(6 -(N-(2-maleimdylethyl)-amino))-6-oxohexyl)-1,3-dihydro-3,3-dimethyl-5-sulfo-2H-indol-2-ylidene)-1,3-propyldienyl)-1-ethyl-3,3-dimethyl-5-sulfo-3H-indolium salt (Cy3), N,N'-dimethyl-N-(iodoacetyl)-N'-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)ethylenediamine (IANBDamide), N-((2-(iodoacetoxy)ethyl)-N-methyl)amino-7-nitrobenz-2 -oxa-1,3-diazole (IANBD ester), 6-acryloyl-2-dimethylaminonaphthalene (acrylodan), pyrene, 6-amino-2,3-dihydro-2-(2-((iodoacetyl)amino)ethyl)-1,3-dioxo-1H-benz(de)isoquinoline-5,8-disulfonate (Lucifer Yellow), 2-(5-(1-(6-(N-(2-maleimidoethyl)amino)-6-oxohexyl)-1,3-dihydro-3,3-dimethyl-5-sulfo-2H-indol-2-ylidene)-1,3-pentadiene enyl)-1-ethyl-3,3-dimethyl-5-sulfo-3H-indolium salt (Cy5), 4-(5-(4-dimethylaminophenyl)oxazol-2-yl)phenyl-N-(2-bromoacetamidoethyl)sulfonamide (Dapoxyl® (2-bromoacetamidoethyl)sulfonamide)), (N-(4,4-difluoro-1,3,5,7-tetramethyl-4-bora-3a,4a-diaza-s-indacen-2-yl)iodoacetamide (BODIPY507 / 545IA), N-(4,4-difluoro-5,Fluorescent quantum dots are also contemplated, including, but not limited to, 7-diphenyl-4-bora-3a,4a-diaza-s-indacene-3-propionyl)-N'-iodoacetylethylenediamine (BODIPY530 / 550IA), 5-((((2-iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (1,5-IAEDANS), carboxy-X-rhodamine, 5 / 6-iodoacetamide (XRIA5,6), BODIPY-FL-hydrazide, 6-carboxytetramethylrhodamine (TAMRA), cyan fluorescent protein, green fluorescent protein, and yellow fluorescent protein. Other suitable fluorescent labels include those described in ThermoFisher Scientific (2019) The Molecular Probes Handbook - A Guide to Fluorescent Probes and Labeling Technologies, accessed September 29, 2019;<https: / / www.thermofisher.com / au / en / home / references / molecular‐probes‐the‐handbook.html> This includes those described in

[0219] The fluorescent label may be attached at any suitable point on the aptamer, for example, in some embodiments, the fluorescent label is attached at the 3' or 5' end of the aptamer, particularly at the 3' end of the aptamer.

[0220] Those skilled in the art will be familiar with suitable methods for attaching labeling moieties to aptamers, including chemical means such as reduction, oxidation, conjugation and condensation reaction.For example, a labeling moiety, such as a fluorescent label or a redox moiety, can be attached to the natural or engineered thiol group present in aptamers using a thiol reactive group.In another example, the reactive group present in aptamers can be labeled using the succinimide ester derivative of a fluorescent label.For example, an amine can be introduced at the desired position of the aptamer for attaching a labeling moiety, and an NHS-labeled redox moiety (such as NHS-labeled methylene blue) can be conjugated to the aptamer, for example, using succinimide ester coupling. Suitable methods are known in the art, such as Liu et al. (2010) Anal Chem 82(19):8131-8136, Xiao et al. (2005) Angewandte Chem Int Ed 44:5456-5459, and U.S. Patent Application Publication No. 2016 / 0278638 A1, the entire contents of which are incorporated herein by reference.

[0221] The labeling moiety may be an autofluorescent or luminescent label.

[0222] While the label moiety can be attached directly to the aptamer, in some embodiments, the label moiety is attached to the aptamer via a linker. For example, in some embodiments, the moiety is 20 Alkyl, especially C6 or C 11 The aptamer is attached via a linker such as an alkyl chain, including alkyl, particularly a C6 alkyl linker (ie, a (CH2)6 linker), a polymer such as polyethylene glycol (PEG), or a nucleic acid sequence, including DNA and RNA sequences.

[0223] In some embodiments, the fluorescent label may be the only label moiety attached to the aptamer. Without wishing to be bound by theory, it is proposed that in such embodiments, analyte binding results in a conformational change in the aptamer, which in turn causes a detectable change in the fluorescence of the fluorescent label (e.g., due to a change in the conjugation of the fluorescent label), such as an increase in fluorescence, a wavelength shift, and / or an increase in fluorescence lifetime. Alternatively, the fluorescent label may interact with the bound analyte, resulting in a decrease in the fluorescence of the fluorescent label.

[0224] In alternative embodiments, the aptamer includes two label moieties, such as two fluorescent labels. Such embodiments are particularly suited to generating light output, such as through Förster resonance energy transfer (FRET). Such embodiments can utilize a pair of label moieties (e.g., a pair of fluorescent labels) attached at different points on the aptamer, with one label acting as a donor molecule (first label moiety) and the other as an acceptor molecule (i.e., a quencher) (second label moiety), where the absorption spectrum of the acceptor molecule overlaps with the fluorescence emission spectrum of the donor molecule. Without wishing to be bound by theory, it is proposed that analyte binding results in a conformational change in the aptamer, which alters the proximity of the first and second label moieties and thus alters the fluorescence intensity of the first label moiety and the emission intensity of the second label moiety. In some embodiments, the first and second label moieties can be closer to each other (i.e., are spaced apart less in the second conformation) than in the first conformation (i.e., upon analyte binding). In such embodiments, the fluorescence intensity of the first labeling moiety decreases and the emission intensity of the second labeling moiety increases in the second conformation compared to the first conformation. In alternative embodiments, the first and second labeling moieties can be farther apart (i.e., are spaced apart more in the second conformation) in the second conformation (i.e., upon analyte binding) compared to the first conformation. In such embodiments, the fluorescence intensity of the first labeling moiety increases and the emission intensity of the second labeling moiety decreases in the second conformation compared to the first conformation.

[0225] In certain embodiments, both labeling moieties are preferably fluorescent labels, suitable examples of which are described above. Exemplary combinations include cyan fluorescent protein and yellow fluorescent protein, Cy3 and Cy5, FAM and TAMRA, etc. In alternative embodiments, the first labeling moiety (i.e., the donor molecule) is a fluorescent label and the second labeling moiety (i.e., the acceptor molecule) is a non-fluorescent moiety. Non-limiting examples of suitable non-fluorescent moieties include 4-([4-(dimethylamino)phenyl]-azo)-benzoic acid (DABCYL), Iowa Black RQ, 4-(4-dimethylaminophenylazo)benzenesulfonic acid (DABSYL), Iowa Black FQ, IRDye QC-1, QXL quenchers, black hole quenchers including BHQ-1, BHQ-2 and BHQ-3, and the like, including those described in Le Reste et al. (2012) Biophysical Journal, 11(6):2658-2668, and Crisalli and Kool (2011) Bioconj Chem, 22(11):2345-2354, the entire contents of which are incorporated herein by reference.

[0226] The first and second label moieties can be attached at any point on the aptamer, with the spacing between the first and second label moieties being different between the first and second aptamer conformations. In some embodiments, the spacing between the first and second label moieties is 10 nm or less in the first conformation and greater than 10 nm in the second conformation. In other embodiments, the spacing between the first and second label moieties is greater than 10 nm in the first conformation and less than 10 nm in the second conformation. For example, the first and second label moieties can be attached at or near each end of the aptamer, e.g., at or near the 3' and 5' ends. In some embodiments, the first label moiety is attached at the 3' end and the second label moiety is attached at the 5' end, or the first label moiety is attached at the 5' end and the second label moiety is attached at the 3' end.

[0227] The present invention also contemplates embodiments in which the receptor molecule is a material that forms the microstructure, or a coating on the microstructure, such as graphene, graphene oxide, or the like.

[0228] In preferred embodiments, the aptamers are a coating on the microstructure (also referred to herein as an aptamer coating). The number of aptamers in the coating and / or aptamer density will depend on the analyte of interest (including the size of the analyte and the level or concentration expected to be detected), the application of the system of the present invention, and the detection method. The aptamer density in the coating should be such that it produces a measurable response, such as a change in impedance or fluorescence, upon binding of the analyte, particularly upon binding of the analyte at the analyte concentration or level of interest. In some embodiments, the aptamer density in the coating is about 1×10 10 ~Approx. 1×10 14 Aptamer molecules / cm 2 , about 5×10 10 ~Approx. 5×10 13 Aptamer molecules / cm 2 , about 1×10 11 ~Approx. 1×10 13 Aptamer molecules / cm 2 , about 5×10 11 ~Approx. 5×10 12 Aptamer molecules / cm 2 (and all integers between them).

[0229] When applied as a coating on a microstructure, the aptamer can be coated using any suitable technique conventional in the art, such as chemical adsorption or chemical crosslinking. For example, this technique can include contacting the surface of the microstructure with the aptamer for a period of time sufficient to allow a moiety for attaching or immobilizing the aptamer to the surface of the microstructure to attach, for example, via a covalent bond. Suitable non-limiting methods can include chemical adsorption of thiolated aptamers onto gold microstructures, attachment of biotinylated aptamers to avidin-modified microstructures, immobilization of azide-terminated aptamers to alkyne-modified microstructures, covalent immobilization of amine-terminated aptamers by amine coupling to carboxyl groups on functionalized microstructures, covalent immobilization of amine-terminated aptamers to functionalized microstructures containing amine groups using glutaraldehyde, and the like. Exemplary methods are described in Xiao et al. (2007) Nat Protocols, 2(11):2875-2880, Negahdary et al. (2018) J Biomed Phys Eng, 8(2):167-178, and Mishra et al. (2018) Biosensors, 8(2):28. The aptamer can be attached to the microstructure at any suitable point on the aptamer, particularly the 3' or 5' end of the aptamer, especially the 5' end.

[0230] In other embodiments, the material is a molecularly imprinted polymer.

[0231] The identity of the molecularly imprinted polymer depends on the specific analyte of interest and the detection method. Those skilled in the art will be able to easily identify and use a molecularly imprinted polymer suitable for each analyte of interest. For example, suitable molecularly imprinted polymers include those formed from monomers containing one or more functional groups for binding or interacting with the analyte of interest, such as amine, sulfide, sulfhydryl, amide, carbonyl, or carboxyl groups. In some embodiments, the molecularly imprinted polymer is formed from one or more monomers containing one or more amine and / or carboxyl groups.

[0232] For example, suitable monomers include, but are not limited to, aminothiophenols (including p-aminothiophenol and o-aminothiophenol), methacrylic acid, vinylpyridine, acrylamide, aminophenols (including o-aminophenol and p-aminophenol), 1,2-dimethylimidazole, dimetridazole, o-phenylenediamine, 4-amino-5-hydroxy-2,7-naphthalenedisulfonic acid, pyrrole, aminobenzenethiol-co-p-aminobenzoic acid, vinylpyrrolidone, vinylferrocene, bis(2,2'-bithien-5-yl)methane, pyridine, chitosan, 3,4-ethylenedioxythiophene, 1-mercapto-1-undecanol, dopamine, methacrylates such as methyl methacrylate and dimethyl methacrylate, carboxylated pyrrole, aniline, thiopheneacetic acid (e.g., 3-thiopheneacetic acid), and thiophene.

[0233] Molecularly imprinted polymers can be conducting polymers (eg, polymers with conjugated pi bonds along the polymer backbone) or insulating polymers.

[0234] When the molecularly imprinted polymer is an insulating polymer, the polymer is a coating on the microstructure. Suitable insulating polymers include, but are not limited to, poly-o-phenylenediamine, poly-o-aminophenol, polymethacrylates such as polymethylmethacrylate and polydimethylmethacrylate, polyacrylamide, non-conductive polypyrrole, polypyridine, polyvinylpyrrolidone, poly-p-aminothiophenol, and polydopamine, especially non-conductive polypyrrole.

[0235] In some embodiments, the insulating polymer can be a copolymer. Thus, the polymer can be a polymer or copolymer formed from one or more monomers selected from the group consisting of pyrrole, dopamine, methacrylates such as methyl methacrylate and dimethyl methacrylate, methacrylic acid, acrylamide, carboxylated pyrrole, o-aminophenol, phenol, p-aminothiophenol (including p-aminothiophenol and o-aminothiophenol), pyridine, vinylpyrrolidone, and o-phenylenediamine. In some embodiments, the insulating polymer is a copolymer formed from a methacrylate such as methyl methacrylate or dimethyl methacrylate, and an acrylamide, particularly methyl methacrylate and acrylamide, or pyrrole and carboxylated pyrrole.

[0236] When the molecularly imprinted polymer is a conductive polymer, the polymer may be a coating on the microstructure or may be the material that forms the microstructure. Without wishing to be bound by theory, in some embodiments, it is believed that the conductive polymer undergoes a conformational change upon binding of an analyte, causing the polymer to become more structurally distorted. The conformational change results in a decrease in the conductivity of the polymer, which can be quantified and correlated with the presence, absence, level, or concentration of the analyte. In other embodiments, it is proposed that binding of an analyte to the conductive polymer causes a change in impedance, which can be quantified and correlated with the presence, absence, level, or concentration of the analyte.

[0237] In some embodiments, the molecularly imprinted polymer is a conductive polymer and is the material from which the microstructure is formed. In such embodiments, the microstructure is preferably porous.

[0238] Suitable conductive polymers include, but are not limited to, polypyrrole, polyaniline, poly(3,4-ethylenedioxythiophene) and polythiophenes, especially polypyrrole.

[0239] In some embodiments, the conductive polymer can be a copolymer. Thus, the polymer can be a polymer or copolymer formed from one or more monomers selected from the group consisting of pyrrole, carboxylated pyrrole, aniline, 3,4-ethylenedioxythiophene, thiopheneacetic acid (e.g., 3-thiopheneacetic acid), and thiophene. In some embodiments, the conductive polymer is a copolymer formed from 3,4-ethylenedioxythiophene and thiopheneacetic acid, or pyrrole and carboxylated pyrrole.

[0240] While the molecularly imprinted polymer may be the only component of the coating or forming the microstructure, in some embodiments the polymer includes a dopant, for example to increase the conductivity of the polymer. Suitable dopants include, but are not limited to, sodium nitrate (NaNO), lithium perchlorate (LiClO), p-toluenesulfonate, chondroitin sulfate, dodecylbenzenesulfonate, and tetrabutylammonium hexafluorophosphate (TBAPF), preferably lithium perchlorate and dodecylbenzenesulfonate.

[0241] In some embodiments, the conductivity of the polymer can be increased by varying the solvent of the polymerization solution (i.e., varying the solvent during polymerization). Suitable solvents include, but are not limited to, water, phosphate buffered saline, acetate buffer, acetonitrile, and dichloromethane, particularly acetonitrile or dichloromethane.

[0242] In a particular embodiment, the polymer is a conductive polypyrrole molecularly imprinted polymer doped with LiClO 4 that is selective for troponin I binding.

[0243] The molecularly imprinted polymer is formed using one or more analytes of interest, or fragments or subunits thereof, as templates as discussed herein, and is therefore selective for binding of one or more analytes of interest. Preferably, the molecularly imprinted polymer is selective for binding of one or more analytes of interest, such as troponin or a subunit thereof, particularly troponin I, relative to at least one other substance present in the sample, and preferably a majority of other substances present in the sample.

[0244] In some embodiments, the polymer further comprises a redox moiety, particularly when the molecularly imprinted polymer is an insulating polymer. Suitable redox moieties include, but are not limited to, methylene blue, vinylferrocene, and horseradish peroxidase. Those skilled in the art will be familiar with suitable methods for incorporating a redox moiety into a polymer. For example, the redox moiety may be attached to a monomer prior to polymerization, or may be copolymerized with the monomer.

[0245] The analyte can be any compound that can be detected in the epidermis and / or dermis. In certain embodiments, the analyte is a marker of a condition, disease, disorder, or normal or pathological process occurring in a subject, or a compound that can be used to monitor the level of an administered substance in a subject, such as a drug (e.g., a medication, a vaccine), an illicit substance (e.g., an illegal drug), a non-illicit substance of abuse (e.g., alcohol or a prescription drug taken for non-medical reasons), a poison or toxin, a chemical weapon (e.g., a nerve agent, etc.) or a metabolite thereof. Suitable analytes include: Nucleic acids, including DNA and RNA, including short RNA species, including microRNA, siRNA, snRNA, shRNA, etc. antibodies, or antigen-binding fragments thereof, allergens, antigens or adjuvants, chemokines or cytokines, ·hormone, Parasites, bacteria, viruses, or virus-like particles, or compounds therefrom, such as surface proteins, endotoxins, etc. epigenetic markers such as DNA methylation status or chromatin modifications of specific genes / regions, ·peptide, Polysaccharides (glycans), Polypeptides, Protein, and ·Small molecules These include, but are not limited to:

[0246] In certain embodiments, the analyte of interest is selected from the group consisting of nucleic acids, antibodies, peptides, polypeptides, proteins and small molecules, particularly polypeptides and proteins, especially proteins.

[0247] The analyte can be a biomarker, which is a biochemical characteristic or feature that can be used to measure the progression of a disease, disorder, or condition, or the effectiveness of a treatment for a disease, disorder, or condition. A biomarker can be, for example, a virus or a compound from a virus, a bacterium or a compound from a bacterium, a parasite or a compound from a parasite, a cancer antigen, an indicator of heart disease, an indicator of stroke, an indicator of Alzheimer's disease, an antibody, an indicator of mental health, etc.

[0248] Alternatively, the analyte can be a compound that can be used to monitor the level of an administered or ingested substance in a subject, such as a drug (e.g., a medication, a vaccine), an illicit substance (e.g., an illegal drug), a non-illicit substance of abuse (e.g., alcohol or a prescription drug taken for non-medical reasons), a poison or toxin, a chemical weapon (e.g., a nerve agent), or a metabolite thereof.

[0249] In some embodiments, the analyte is a troponin or a subunit thereof, an enzyme (e.g., amylase, creatinine kinase, lactate dehydrogenase, angiotensin II converting enzyme), a hormone (e.g., follicle-stimulating hormone or luteinizing hormone), cystatin C, C-reactive protein, TNFα, IL-6, ICAM1, TLR2, TLR4, presepsin, D-dimer, a viral protein (e.g., nonstructural protein 1 (NS1)), a bacterial protein, a parasitic protein (e.g., histone-rich protein 2 (HRP2)), an antibody (e.g., influenza and a protein selected from the group consisting of a botulinum toxin or a metabolite or subunit thereof, particularly troponin or a subunit thereof, amylase, creatine kinase, lactate dehydrogenase, angiotensin II converting enzyme, follicle-stimulating hormone, luteinizing hormone, cystatin C, C-reactive protein, TNFα, IL-6, ICAM1, TLR2, TLR4, presepsin, D-dimer, a botulinum toxin or a metabolite or subunit thereof. In certain embodiments, the analyte is a troponin or a subunit thereof, particularly troponin I, troponin C, or troponin T, especially troponin I.

[0250] The analyte may be a small molecule, non-limiting examples of which include hormones (e.g., cortisol or testosterone), neurotransmitters (e.g., dopamine), amino acids, creatinine, aminoglycosides (e.g., kanamycin, gentamicin, and streptomycin), anticonvulsants (e.g., carbamazepine and clonazepam), illicit substances (e.g., methamphetamine, amphetamine, 3,4-methylenedioxymethamphetamine (MDMA), N-ethyl-3,4-methylenedioxyamphetamine (MDEA), 3,4-methylenedioxy- Cyanphetamine (MDA), cannabinoids (e.g., delta-9-tetrahydrocannabinol, 11-hydroxy-delta-9-tetrahydrocannabinol, 11-nor-9-carboxydelta-9-tetrahydrocannabinol), cocaine, benzoylecgonine, ecgonine methyl ester, cocaethylene, ketamine, and opiates (e.g., heroin, 6-monoacetylmorphine, morphine, codeine, methadone, and dihydrocodeine), anticoagulants (e.g., warfarin), blister agents (e.g., cantharidin, furanocoumarins, sulfur Mustards (e.g., 1,2-bis(2-chloroethylthio)ethane, 1,3-bis(2-chloroethylthio)-n-propane, 1,4-bis(2-chloroethylthio)-n-butane, 1,5-bis(2-chloroethylthio)-n-pentane, 2-chloroethylchloromethyl sulfide, bis(2-chloroethyl) sulfide, bis(2-chloroethylthio)methane, bis(2-chloroethylthiomethyl) ether, bis(2-chloroethylthioethyl) ether), nitrogen mustards (e.g., bis(2-chloroethyl)ethylamine, bis(2-chloroethyl)ethylamine, tris(2-chloroethyl)methylamine and tris(2-chloroethyl)amine and phosgene oxime), arsenicals (e.g., ethyldichloroarsine, methyldichloroarsine, phenyldichloroarsine and 2-chlorovinyldichloroarsine) and nettle agents (e.g., phosgene oxime), blood agents (e.g., cyanogen chloride, hydrogen cyanide and arsine), asphyxiants (e.g., chlorine, chloropicrin, diphosgene and phosgene), nerve agents (e.g., tabun, sarin, soman, cyclosarin, novichok agents, 2-(dimethylamino)ethyl-N,N-dimethyl phosphoramidofluoridate (GV), (S)-(ethyl {[2-(diethylamino)ethyl]sulfanyl}(ethyl)phosphinate) (VE), O,O-diethyl-S-[2-(diethylamino)ethyl]phosphorothioate (VG), S-[2-(diethylamino)ethyl]-O-ethylmethylphosphonothioate (VM), ethyl ({2-[bis(propan-2-yl)amino]ethyl}sulfanyl)(methyl)phosphinate (VX), tetrodotoxin and saxitoxin, These include chemical weapons, poisons, or toxins such as animal venom components (e.g., tetrodotoxin and saxitoxin), cyanide, arsenic, tropane alkaloids (e.g., atropine, scopolamine, and hyoscyamine), piperidine alkaloids (e.g., coniine, N-methylconiine, conhydrin, pseudoconhydrin, and gammaconicein), curare alkaloids (e.g., tubocurarine), nicotine, caffeine, quinine, strychnine, brucine, and aflatoxin), or their metabolites. In some embodiments, the small molecule is selected from the group consisting of cortisol, testosterone, creatinine, dopamine, kanamycin, gentamicin, streptomycin, carbamazepine, clonazepam, methamphetamine, amphetamine, MDMA, MDEA, MDA, delta-9-tetrahydrocannabinol, 11-hydroxy-delta-9-tetrahydrocannabinol, 11-nor-9-carboxydelta-9-tetrahydrocannabinol, cocaine, benzoylecgonine, ecgonine methyl ester, cocaethylene, ketamine, heroin, 6-monoacetylmorphine, morphine, codeine, methadone, dihydrocodeine, warfarin, cantharidin, furanocoumarin, 1,2-bis(2-chloroethylthio)ethane, 1,3-bis(2-chloroethylthio)-n-propane, 1,4-bis(2-chloroethylthio)-n-butane, 1,5-bis(2-chloroethylthio)-n-pentane, 2-chloroethylchloromethyl sulfide, bis(2-chloroethyl) sulfide, bis(2-chloroethylthio)methane, bis(2-chloroethylthiomethyl) ether, bis(2-chloroethylthioethyl) ether, bis(2-chloroethyl)ethylamine, bis(2-chloroethyl)methylamine and tris(2-chloroethyl)amine), phosgene oxime, ethyldichloroarsine, methyldichloroarsine, phenyldichloroarsine, 2-chlorovinyldichloroarsine, phosgene oxime, cyanogen chloride, hydrogen cyanide, arsine, chlorine, chloropicrin, diphosgene, phosgene, tabun, sarin, soman, cyclosarin, novichok agents, 2-(dimethylamino)ethyl-N,N-dimethylphosphoramid dofluoridate (GV), (S)-(ethyl{[2-(diethylamino)ethyl]sulfanyl}(ethyl)phosphinate) (VE), O,O-diethyl-S-[2-(diethylamino)ethyl]phosphorothioate (VG), S-[2-(diethylamino)ethyl]-O-ethylmethylphosphonothioate (VM), ethyl ({2-[bis(propan-2-yl)amino]ethyl}sulfanyl)(methyl)phosphinate (VX), tetrodotoxin, saxitoxin, cyanide, arsenic, atropine, scopolamine, hyoscyamine, coniine, N-methylconiine, conhydrin, pseudoconhydrin, gammaconicein, tubocurarine, nicotine, caffeine, quinine, strychnine, brucine, aflatoxin, and their metabolites.

[0251] In some embodiments, the analyte is a peptide, non-limiting examples of which include hormones (e.g., oxytocin, gonadotropin-releasing hormone, and adrenocorticotropic hormone), B-type natriuretic peptide, N-terminal pro-B-type natriuretic peptide (NT-proBNP), and animal venom components (e.g., peptidic components of spider, snake, scorpion, bee, wasp, ant, tick, cone snail, octopus, fish (e.g., stonefish), and jellyfish venoms) or their metabolites. In particular embodiments, the peptide is oxytocin, gonadotropin-releasing hormone, adrenocorticotropic hormone, B-type natriuretic peptide, or NT-proBNP.

[0252] In some embodiments, the analyte is a polysaccharide (glycan), suitable non-limiting examples of which include inulin, endotoxin (lipopolysaccharide), anticoagulants (e.g., heparin) and their metabolites.

[0253] In some embodiments, the analyte is an illicit or non-illicit substance of abuse or a metabolite thereof. Suitable illicit substances include, but are not limited to, methamphetamine, amphetamine, 3,4-methylenedioxymethamphetamine (MDMA), N-ethyl-3,4-methylenedioxyamphetamine (MDEA), 3,4-methylenedioxyamphetamine (MDA), cannabinoids (e.g., delta-9-tetrahydrocannabinol, 11-hydroxy-delta-9-tetrahydrocannabinol, 11-nor-9-carboxydelta-9-tetrahydrocannabinol), cocaine, benzoylecgonine, ecgonine methyl ester, cocaethylene, ketamine, and opiates (e.g., heroin, 6-monoacetylmorphine, morphine, codeine, methadone, and dihydrocodeine), or metabolites thereof. Non-illicit substances of abuse include, but are not limited to, alcohol, nicotine, prescription or over-the-counter drugs taken for non-medical reasons, and substances taken for medical effects but taken in excess or inappropriately (e.g., painkillers such as opiates, sleep aids, anti-anxiety drugs, methylphenidate, erectile dysfunction drugs), or their metabolites.

[0254] In some embodiments, the analyte is a drug or a component or metabolite thereof. A wide variety of drugs and their metabolites are suitable analytes, including, but not limited to, cancer therapeutics, vaccines, analgesics, antipsychotics, antibiotics, anticoagulants, antidepressants, antivirals, sedatives, antidiabetics, contraceptives, immunosuppressants, antifungals, antiparasitics, stimulants, biological response modifiers, nonsteroidal anti-inflammatory drugs (NSAIDs), corticosteroids, disease-modifying antirheumatic drugs (DMARDs), anabolic steroids, antacids, antiarrhythmics, thrombolytics, anticonvulsants, antidiarrheals, antiemetics, antihistamines, antihypertensives, anti-inflammatory agents, antineoplastics, antipyretics, barbiturates, beta-blockers, bronchodilators, antitussives, cytotoxic agents, decongestants, diuretics, expectorants, hormones, laxatives, muscle relaxants, vasodilators, sedatives, and vitamins. Various examples of these agents are described herein and are well known in the art.

[0255] In some embodiments, the analyte is a poison, toxin, chemical weapon, or a metabolite thereof. Suitable poisons, toxins, and chemical weapons include blister agents (e.g., cantharidin, furanocoumarins, sulfur mustards (e.g., 1,2-bis(2)-chloroethylthio)ethane, 1,3-bis(2-chloroethylthio)-n-propane, 1,4-bis(2-chloroethylthio)-n-butane, 1,5-bis(2-chloroethylthio)-n-pentane, 2-chloroethylchloromethyl sulfide, bis(2-chloroethyl)sulfide, bis(2-chloroethylthio)methane, bis(2-chloroethylthiomethyl)ether, bis(2-chloroethylthioethyl)ether), nitrogen mustards (e.g., bis(2-chloroethyl)ethylamine, bis(2-chloroethyl)methylamine), and tris(2-chloroethyl)amine) and phosgene oxime), arsenicals (e.g., ethyldichloroarsine, methyldichloroarsine, phenyldichloroarsine, and 2-chlorovinyldichloroarsine) and nettle agents (e.g., phosgene oxime), blood agents (e.g., cyanogen chloride, hydrogen cyanide, and arsine), asphyxiants (e.g., chlorine, chloropicrin, diphosgene, and phosgene), nerve agents (e.g., tabun, sarin, soman, cyclosarin, novichok agents, 2-(dimethylamino)ethyl-N,N-dimethylphosphoramidofluoridate (GV), (S)-(ethyl{[2-(diethylamino)ethyl]sulfanyl}(ethyl)phosphinate) (VE), O,Atropa such as O-diethyl-S-[2-(diethylamino)ethyl]phosphorothioate (VG), S-[2-(diethylamino)ethyl]-O-ethylmethylphosphonothioate (VM), ethyl ({2-[bis(propan-2-yl)amino]ethyl}sulfanyl)(methyl)phosphinate (VX), tetrodotoxin, saxitoxin, and botulinum toxins, animal venom components (e.g., tetrodotoxin, saxitoxin, and other components of spider, snake, scorpion, bee, wasp, ant, tick, cone snail, octopus, fish (e.g., stonefish), and jellyfish venoms), cyanide, arsenic, tropane alkaloids (e.g., atropine, scopolamine, and hyoscyamine). In some embodiments, the analyte may be a compound selected from the group consisting of: Belladonna components, Hemlock components such as piperidine alkaloids (e.g., coniine, N-methylconiine, conhydrin, pseudoconhydrin, and gammaconicein), curare alkaloids (e.g., tubocurarine), nicotine, caffeine, alcohol, quinine, atropine, strychnine, brucine, aflatoxin, and their metabolites. In some embodiments, the analyte may be a compound selected from the group consisting of blister agents (e.g., cantharidin, furanocoumarins, sulfur mustards (e.g., 1,2-bis(2)-chloroethylthio)ethane, 1,3-bis(2-chloroethylthio)-n-propane, 1,4-bis(2-chloroethylthio)-n-butane, 1,5-bis(2-chloroethylthio)-n-pentane, 2-chloroethylchloromethyl sulfide, bis(2-chloroethyl) sulfide, bis(2-chloroethylthio)methane, bis(2-chloroethylthiomethyl) ether or bis(2-chloroethylthioethyl) ether), nitrogen mustards (e.g. bis(2-chloroethyl)ethylamine, bis(2-chloroethyl)methylamine or tris(2-chloroethyl)amine) or phosgene oxime), arsenicals (e.g. ethyldichloroarsine, methyldichloroarsine, phenyldichloroarsine or 2-chlorovinyldichloroarsine) or nettle agents such as phosgene oxime), blood agents (e.g. cyanogen chloride, hydrogen cyanide or arsine), asphyxiants (e.g. Chemical warfare agents, such as chlorine, chloropicrin, diphosgene, or phosgene, nerve agents (e.g., tabun, sarin, soman, cyclosarin, Novichok agents, 2-(dimethylamino)ethyl-N,N-dimethylphosphoramidofluoridate (GV), (S)-(ethyl{[2-(diethylamino)ethyl]sulfanyl}(ethyl)phosphinate) (VE), O,O-diethyl-S-[2-(diethylamino)ethyl]phosphorothioate (VG), S-[2-(diethylamino)ethyl]-O-ethylmethylphosphonothioate (VM), ethyl({2-[bis(propan-2-yl)amino]ethyl}sulfanyl)(methyl)phosphinate (VX), tetrodotoxin, and saxitoxin or botulinum toxin), or their metabolites.

[0256] Suitable analytes, diseases, disorders or conditions, or their associated uses, and known clinically relevant minimum serum concentration ranges are provided in Tables 1-3.

[0257] [Table 1]

[0258] [Table 2]

[0259] [Table 3]

[0260] In some embodiments, the analyte is a metabolite of any one of the above exemplary analytes.

[0261] Although it is preferred that the analyte bind directly to the binding agent, the present invention also contemplates detecting a substance that is indicative of the analyte of interest, such as a specific binding pair member complementary to the analyte of interest, the presence of which is detected only if the particular analyte of interest is present in the sample. Thus, the substance that is indicative of the analyte becomes the analyte that is detected.

[0262] In some embodiments, the microstructures are coated with a material that reduces absorption of non-target analytes. Examples of materials include alkyl groups coated with BSA (bovine serum albumin), bifunctional polyethylene glycol (PEG) polymers, etc. Such materials reduce adsorption of non-specific analytes, effectively repelling them from the microstructures.

[0263] For example, it will be appreciated that multiple coatings can be used in combination to repel or repel non-specific analytes and bind analytes of interest, thereby allowing for selective capture of specific analytes of interest while leaving non-specific analytes uncaptured.

[0264] Polymer coatings, including molecularly imprinted polymer coatings, can be applied using a variety of techniques commonly used in the art. For example, microstructures can be coated with polymers using a variety of techniques, including dip coating, spray coating, deposition coating, electropolymerization, drop casting, electrospinning, inkjet coating, spin coating, and the like, particularly electropolymerization. In one example, a coating solution is applied to the microstructure and optionally dried in situ using a gas jet. When the coating is a polymer coating, the polymer can be synthesized prior to coating, in some embodiments, for example, using bulk polymerization. In alternative embodiments, the polymer is synthesized and coated simultaneously, such as when synthesized and coated using electropolymerization. Those skilled in the art will be familiar with suitable techniques.

[0265] Molecularly imprinted polymers can be prepared using a variety of techniques, non-limiting examples of which include bulk polymerization and electropolymerization, particularly electropolymerization, in the presence of a template (i.e., one or more analytes of interest or fragments or subunits thereof).

[0266] For example, a molecularly imprinted polymer can be prepared by (a) preparing a polymerization solution containing one or more monomers of interest and a solvent (e.g., phosphate-buffered saline), (b) adding one or more template compounds (e.g., one or more analytes of interest or fragments or subunits thereof) to the prepared polymerization solution, (c) polymerizing the template / polymerization solution, optionally in the presence of one or more additives (e.g., dopants, redox moieties, etc.), to form a molecularly imprinted polymer, and (d) separating the molecularly imprinted polymer from the one or more template compounds. The properties of the molecularly imprinted polymer can be optimized using techniques common in the art, such as varying the concentrations of one or more monomers and / or template compounds.

[0267] The polymer may be coated in any form suitable for detecting one or more analytes of interest, such as a film, particle, fiber or nanotube, particularly a film.

[0268] The coating may be of a thickness appropriate for determining the presence, absence, level or concentration of an analyte, such as, but not limited to, 1 nm to 100 nm, particularly 10 nm to 20 nm, and especially about 15 nm.

[0269] Although the polymer coating may be the only coating applied to the electrode, in some embodiments it may be desirable to enhance the bonding (adhesion) of the polymer coating to the electrode. Thus, in such embodiments, an agent that enhances the bonding of the polymer coating to the electrode may be applied prior to applying the coating. Suitable agents include, but are not limited to, organosilanes, silicones, siloxanes, amide- and amine-containing compounds, organophosphorus compounds, self-assembled monolayers, or other coupling agents.

[0270] To optimize the coating, the properties of the coating can be controlled by the addition of one or more other agents, such as thickeners, detergents or other surfactants, and adjuvants. These components can be provided in various concentrations. For example, the thickener or surfactant can form between 0% and 90% of the coating solution.

[0271] A variety of viscosity-increasing agents can be used, examples include methylcellulose, carboxymethylcellulose (CMC), gelatin, agar, and agarose, as well as any other viscosity-adjusting agent. The viscosity of the solution is typically 10 -3 Pa·s~10 -1 In one example, a coating solution containing 1-2% methylcellulose provides a reasonably uniform coating, yielding a viscosity in the range of 0.011 (1%) to 0.055 (2%) Pa·s.

[0272] Similarly, the surface tension of the coating solution can be adjusted using various surfactants, such as any detergent or any suitable agent that reduces surface tension and is biocompatible at low concentrations. The solution properties are typically similarly controlled by the addition of one or more other agents, such as thickeners, detergents, other surfactants, or any other suitable materials. These components can be provided in various concentrations. For example, the thickener or surfactant can form between 0% and 90% of the coating solution.

[0273] Instead of using coating techniques, reagents can also be embedded within the microstructure. Thus, for example, in the case of a molded patch manufactured using a polymeric material, the reagent can be introduced into the mold along with the polymeric material so that the reagent is dispersed throughout the structure. In this example, the polymer can be provided such that pores are formed within the structure during the curing process.

[0274] The use of affinity surface coatings on each structure also allows for reduced nonspecific adsorption of ISF and / or blood components while facilitating specific extraction of molecular targets of interest.

[0275] Thus, in one example, the one or more microstructures interact with one or more analytes of interest such that the response signal depends on the presence, absence, level, or concentration of the analytes of interest. In one particular example, the analytes interact with a coating on the microstructures to change the electrical and / or optical properties of the coating, thereby allowing the analytes to be detected.

[0276] For example, measurements can be made by passing a current between electrodes, and measurement of the resulting signal between the electrodes is used to detect a change in an electrical property and, therefore, the presence, absence, level, or concentration of an analyte. In this regard, the electrical output signal may be indicative of any one or more of voltage, current, resistance, capacitance, conductance, or impedance, or a change in any of these variables. Thus, the signal may be potentiometric, amperometric, voltammetric, impedimetric, etc.

[0277] Impedance measurements, such as those in electrochemical impedance spectroscopy (EIS), probe the dynamics of analyte binding or charge transfer in the bulk or interfacial regions of MIPs and / or aptamers. In this regard, when an MIP (especially a conductive MIP) captures a target analyte, the cavities of the MIP are filled, preventing ion diffusion in the bulk polymer. In addition, the captured analyte can distort the structure of the conductive MIP, causing increased charge transfer in the polymer. Similarly, when an aptamer captures a target analyte, the captured analyte can alter the structure of the aptamer, changing its electrical properties. Measurements require only ions in the sample and can be performed without the use of redox moieties.

[0278] In this example, the electrodes may be provided in pairs, although the system may alternatively measure the impedance between different groups of electrodes, for example, with one group acting as working electrodes and the other group acting as counter electrodes.

[0279] In further examples, voltammetric / amperometric techniques can be used, including cyclic voltammetry (CV), linear sweep voltammetry (LSV), differential pulse voltammetry (DPV), square wave voltammetry (SWV), and chronoamperometry (CA).

[0280] In this example, a current output is generated from a redox reaction of an electroactive species (redox moiety) occurring on a conductive material (e.g., a gold microstructure). When an analyte of interest is captured by a MIP (e.g., an insulating MIP coating), the cavities of the MIP are filled, thereby blocking / preventing diffusion of the redox moiety to the gold surface. This reduces analyte penetration, resulting in a reduced current output. Similarly, when an analyte of interest is captured by an aptamer, the conformation of the aptamer changes, resulting in movement of the redox moiety relative to the microstructure surface, thereby altering the current output.

[0281] Because this type of transformation requires a redox reaction, some researchers incorporate redox moieties into the polymer matrix.

[0282] In this example, it is also conceivable that a reference electrode is also provided, in which case the electrodes may be arranged in groups of three including a working electrode, a counter electrode, and a reference electrode. The reference electrode only needs to be close to the working electrode and the counter electrode. Thus, for example, an electrode may be provided in a pair of working and counter electrodes, and a row of the electrode pair may be used as a reference electrode.

[0283] In a further example, potentiometric measurements can be made, generating an electrical output in response to binding of a target analyte at the MIP and / or aptamer. Here, a change in voltage corresponding to the amount of analyte bound to the MIP and / or aptamer is measured. Potentiometric technology is found in sensors such as ion selective electrodes (ISEs) and field-effect transistors (FETs).

[0284] Other measurement techniques include mass-sensitive acoustic transducers such as surface acoustic wave (SAW) oscillators, Love wave oscillators, or quartz crystal microbalances (QCMs). Analyte binding can be quantified via a change in vibration frequency caused by a change in mass at the oscillator surface.

[0285] In a further example, one or more of the microstructures contain a treatment material and at least one treatment delivery mechanism is provided that controls the release of the treatment material, hi one preferred example, the release of the treatment material is controlled by applying a stimulus to the microstructure(s), for example, by applying light, heat, or an electrical stimulus to release the treatment material.

[0286] In one preferred example, the treatment material is contained in a coating on at least one microstructure, and a stimulus is used to dissolve the coating on the microstructure, thereby delivering the treatment material. It will be appreciated that this technique is applicable to any treatment material that can be incorporated into a coating and selectively released using a stimulus, such as a mechanical, magnetic, thermal, electrical, electromagnetic, or optical stimulus.

[0287] The nature of the treatment material will vary depending on the preferred embodiment and / or the nature of the treatment being performed, including whether the treatment is cosmetic or therapeutic. Examples of treatment materials include, but are not limited to, nanoparticles, nucleic acids, antigens or allergens, parasites, bacteria, viruses, or virus-like particles, metals or metal compounds, molecules, elements or compounds, DNA, proteins, RNA, siRNA, sfRNA, iRNA, synthetic biomaterials, polymers, drugs, etc.

[0288] However, it will be appreciated that the use of a coating is not required, and that the treatment material may additionally and / or alternatively be incorporated into the microstructure itself.

[0289] Regardless of how the treatment material is provided, the substrate can include multiple microstructures, with different microstructures having different treatment materials and / or different treatment dosages. In this case, a processing device can control the therapy delivery mechanism to release the treatment material from selected microstructures, thereby enabling different treatments and / or differential dosing depending on the results of measurements made on the subject. In particular, as described in more detail below, the processing device typically performs an analysis using, at least in part, the measured response signal and controls at least one therapy delivery mechanism using the results of the analysis, thereby enabling personalized treatments to be performed substantially in real time.

[0290] It will be appreciated that the microstructures may be differentially coated, for example, by coating different microstructures with different coatings and / or by coating different portions of the microstructures with different coatings. This can be used to allow different analytes to be detected at different depths, such that, for example, different coatings are used for portions of the microstructures that enter the dermis compared to the living epidermis. This can also be used to allow for the detection of different analytes, or different levels or concentrations of the same analyte. In addition, at least some of the microstructures can be left uncoated, for example, so that they can be used as controls, while some may be partially coated or may include a porous structure with an internal coating. It will be appreciated that multiple coatings can be provided. For example, an outer coating can be provided that provides mechanical strength during insertion and dissolves once in situ, allowing, for example, an underlying functional coating to be exposed so that an analyte can be detected.

[0291] The nature of the coating and the manner in which it is applied will vary depending on the preferred embodiment, and techniques such as dip coating, spray coating, jet coating, etc., as described above, may be used. The thickness of the coating will also vary depending on the situation and the intended functionality provided by the coating. For example, thicker coatings may be used if the coating is used to provide mechanical strength or contains payload materials to be delivered to the target, while thinner coatings may be required if the coating is used for sensing other applications.

[0292] In one example, a stimulus such as a chemical, biochemical, electrical, optical, or mechanical stimulus can be used to release material from, disrupt, dissolve, or otherwise ablate a coating on a microstructure.

[0293] In another example, the microstructure can be coated with a selectively dissolvable coating. The coating can be adapted to dissolve after a defined period of time, such as after the microstructure has been present in a subject for a set length of time, in response to the presence, absence, level, or concentration of one or more analytes in the subject, upon breaching or penetration of a functional barrier, or in response to application of a stimulus signal, such as an electrical signal, an optical signal, etc. Dissolution of the coating can be used to trigger the measurement process, for example, by exposing a binding agent or other functional feature, such that the analyte is detected only after the coating has dissolved.

[0294] In a further example, dissolution of the coating can be detected, for example, through a change in an optical or electrical property, and measurements can be taken after the coating has dissolved, and thus dissolution of the coating can be detected based on a change in the response signal.

[0295] In one example, the coating can be used to provide mechanical properties. For example, the coating can provide a physical structure that can be used to facilitate penetration of a barrier, such as by providing the microstructure with a smoothly tapered outer profile. The coating can reinforce the microstructure to prevent it from breaking, crushing, buckling, or otherwise being damaged during insertion, or can be used to help anchor the microstructure within a subject. For example, the coating can include a hydrogel, which expands when exposed to moisture, causing the microstructure and coating to increase in size upon insertion into a subject, thereby making the microstructure more difficult to remove.

[0296] Coatings can also be used to modify the surface properties of the microstructure, for example, to increase or decrease hydrophilicity, increase or decrease hydrophobicity, and / or minimize biofouling. Coatings can also be used to attract, repel, or repel at least one substance, such as an analyte, cell, or fluid. Coatings can also dissolve to expose the microstructure, additional coatings, or materials, which can be used to control the detection process. For example, a sustained-release coating can be used to allow measurements to be taken a set time after application of the patch. This can also be used to provide a stimulus to a subject, for example, by releasing a treatment or therapeutic material.

[0297] Thus, in one example, the system includes a plurality of microstructures, where different microstructures respond differentially to the analytes, e.g., different microstructures may respond to different analytes, different combinations of analytes, different levels or concentrations of analytes, etc.

[0298] In one example, at least some of the microstructures attract at least one substance to the microstructure and / or repel or repel at least one substance from the microstructure. The nature of the substance varies depending on the preferred embodiment and may include one or more analytes or may include other substances that contain analytes, such as ISF, blood, etc. This can be used to attract, repel, or repel analytes, for example, to attract analytes of interest so that they can be concentrated and / or detected, or to repel or repel analytes other than those of interest.

[0299] The ability to repel or exclude substances can also help prevent biofouling. For example, microstructures can contain or include a coating of a material such as polyethylene glycol (PEG), which generally repels substances from the surface of the microstructure. Biofouling reduction can also be achieved based on the selection of microstructure materials or the structure of the microstructure, for example, a binder coating within the pores of a porous microstructure, a surface coating that peels off to expose the sensing surface when sensing is to occur, a permeable coating such as a porous polymer, for example, a nylon membrane, a polyvinylidene fluoride coating, a polyphenylenediamine coating, a polyethersulfone coating, or a hydrogel coating such as poly(hydroxyethyl methacrylate) or PEG coating, an isoporous silica micelle membrane, a protein membrane such as a fibroin membrane, a polysaccharide membrane such as a cellulose membrane or a chitosan membrane, or a diol or silane membrane, a strippable coating that interferes with biofouling substances, and / or a porous coating. In certain embodiments, the microstructure is porous and a binder is coated within the pores of the microstructure.

[0300] In another example, a control can be used to account for biofouling. For example, a patch can include functionalized microstructures for analyte detection as well as non-functionalized microstructures that act as controls. Assuming both sets of microstructures are exposed to similar levels of biofouling, changes in the response signal measured through the non-functionalized microstructures can be used to quantify the extent of biofouling occurring. This can be further accounted for when processing the signal from the functionalized microstructures, for example, by removing any changes in the response signal resulting from biofouling.

[0301] In one example, the system includes an actuator configured to apply a force to the substrate, which in one example is used to assist the microstructure in breaking through the barrier. The actuator can also and / or alternatively be used for other purposes.

[0302] For example, the movement of the microstructure can be used to sense mechanical properties of tissue. For example, the response of the actuator, such as the amount of current required to cause movement of the microstructure, can be used to sense mechanical properties such as elastic modulus, which may further indicate a health problem, such as a disease. This can also be used in conjunction with the mechanical response signal to monitor the transmission of actuator movement, for example, by measuring stress or strain on the microstructure using an appropriate sensing modality. Other external mechanical stimuli can also be used, such as providing a ring or other structure around the patch that generates pressure waves in the tissue, allowing the response to be measured.

[0303] Actuators can be used to provide mechanical stimuli to trigger biological responses, such as inflammation, or to attract, repel, or repel substances. Additionally, physical movement can be used to release material from a coating on at least some of the microstructures, or to disrupt, dissolve, remove, or otherwise ablate a coating on at least some of the microstructures. This can be used to trigger a measurement process, for example, ablation of a coating or material to trigger a reaction with an analyte, allowing the analyte to be detected.

[0304] Actuators can also be used to cause the microstructure to penetrate a barrier or retract the microstructure from a barrier and / or a subject. In one example, this allows the microstructure to be inserted and removed from a subject as needed, so that the microstructure can be removed when measurements are not being taken. This can be used to alleviate pain, reduce the chance of infection, reduce biofouling, etc.

[0305] Because the microstructures are provided in a low-density configuration, the required force is typically very small, which can be achieved using actuators that provide small forces, such as piezoelectric actuators or mechanical actuators, such as offset motors, vibration motors, etc. However, other actuators can also be used, including any one or more of electric actuators, magnetic actuators, polymer actuators, cloth or textile actuators, pneumatic actuators, thermal actuators, hydraulic actuators, chemical actuators, etc. For example, chemical or biochemical reactions involving exposure to air, light, water, or other substances can trigger an exothermic release of energy, which can be used to provide a mechanical impulse to press the substrate and, therefore, the microstructure against a target. It will be appreciated that actuation can also be achieved manually by applying force to a patch or by pressing the patch against a target using a strap or the like.

[0306] In one embodiment, this is achieved using a biasing force, such as provided by a spring or electromagnetic actuator, in conjunction with an oscillatory, cyclic, or repetitive force, which can aid penetration by, for example, perturbing microstructures to overcome the elasticity of the stratum corneum and / or reducing friction to penetrate the epidermis and / or dermis, and reducing the force required to penetrate the barrier. This reduces the overall force required to penetrate the stratum corneum. However, this is not required, and a single continuous or instantaneous force can also be used.

[0307] The frequency of vibration used varies depending on the preferred embodiment and, in some cases, the type of skin to which the microstructures are applied, and may include any one or more of at least 0.01 Hz, 0.1 Hz, 1 Hz, at least 10 Hz, at least 50 Hz, at least 100 Hz, at least 1 kHz, at least 1 kHz, or at least 100 kHz, and in some cases, up to several MHz. In one example, a varying frequency may be used. The frequency may vary depending on various factors, such as the application time and, in particular, the length of time the application process is taking place, the depth or extent of penetration, and the degree of resistance to insertion. In one example, the system uses a response signal measured through the microstructure to detect when a barrier has been breached, such as when the microstructures have penetrated the stratum corneum. Thus, the frequency may be continuously varied, either increasing or decreasing, until successful penetration is achieved or depending on the depth of penetration, which may be detected using the response signal, at which point the actuator may be stopped. In another example, the frequency may start at a high frequency and gradually decrease as the microstructures penetrate the barrier, in particular the stratum corneum.

[0308] In another example, the magnitude of the applied force can also be controlled. The force used will vary depending on various factors, such as the structure of the patch, the manner in which the patch is applied, the location of application, and the depth of penetration. For example, a patch with a large number of microstructures will typically require a higher overall force to ensure penetration, while a very small number of microstructures, such as 10 or so, may require a higher force to account for attenuation or loss by the substrate / skin. Similarly, the force required to penetrate the stratum corneum will typically be greater than the force required to penetrate the buccal mucosa. In one example, the applied force can be any one or more of at least 0.1 μN, at least 1 μN, at least 5 μN, at least 10 μN, at least 20 μN, at least 50 μN, at least 100 μN, at least 500 μN, at least 1000 μN, at least 10 mN, or at least 100 mN per microstructure and / or collectively. For example, if there are 1000 microstructures, the force can be 100 mN in total, or 100 mN per projection, resulting in an overall force of 100 N.

[0309] Again, the force may be varied, either increasing or decreasing, depending on the time it is applied, the depth or extent of penetration which may be determined based on the response signal to examine the change in measured impedance, or the insertion resistance, etc. In one embodiment, the force is gradually increased up to the point of penetration, at which point the force is decreased.

[0310] As noted above, the force can be applied as a single continuous or instantaneous force. More commonly, however, the force is periodic. In this case, the nature of the periodic motion can vary and it can have any waveform, including, for example, square waves, sine waves, triangular waves, variable waveforms, etc. In this case, the force can be an absolute magnitude, or it can be a peak-to-peak or root mean square (RMS) force.

[0311] Similarly, the magnitude of microstructure movement can also be controlled. The magnitude depends on factors such as the length of the microstructure and the degree of penetration required. The magnitude can include any one or more of: greater than 0.001 times the length of the microstructure; greater than 0.01 times the length of the microstructure; greater than 0.1 times the length of the microstructure; greater than the length of the microstructure; greater than 10 times the length of the microstructure; greater than 100 times the length of the microstructure; or greater than 1000 times the length of the microstructure. The magnitude can also vary, either increasing or decreasing, depending on the applied time, depth of penetration, degree of penetration, or insertion resistance. Again, the magnitude can increase up to the point of penetration and then decrease thereafter.

[0312] In the above examples, the system can be configured to detect aspects of the insertion process. In one example, this can be achieved by monitoring the actuator, for example the current required by the actuator to achieve a particular movement, which can be further used to detect depth of penetration, degree of penetration, insertion resistance, etc., which can be further used to control the actuator.

[0313] The actuators can also be used to apply mechanical stimuli that can be used for a variety of purposes, for example, the actuators can be configured to physically break or remove a coating on a microstructure, physically stimulate an object, cause a microstructure to penetrate a barrier, cause a microstructure to retract from a barrier, or cause a microstructure to retract from an object.

[0314] The actuator is typically operably coupled to the substrate, which may be achieved using any suitable mechanism, such as a mechanical mechanism, an electromechanical mechanism, or the like.

[0315] In one embodiment, the actuator includes a spring or electromagnetic actuator for providing a constant bias and at least one of a piezoelectric actuator and a vibration motor for applying a vibration force. The vibration force is applied at a frequency of at least 10 Hz, less than 1 kHz, and about 100-200 Hz. The continuous force is typically greater than 1 N, less than 10 N, and about 5 N, while the vibration force is at least 1 mN, less than 1000 mN, and about 200 mN. The actuator is typically configured to induce movement of the microstructure of at least 10 μm, less than 300 μm, and about 50 μm-100 μm.

[0316] In one example, the system includes a housing that contains at least the sensor and one or more electronic processing devices, and optionally other components such as a signal generator, actuator, power source, wireless transceiver, etc. In one particular example, the housing provides a reader function that can be used to interrogate the microstructure, and can be provided within an integrated device or can be provided remotely of the substrate and engaged when a reading is to be taken, or provided in close proximity to the substrate.

[0317] In an integrated configuration, the reader is typically mechanically connected / integrated with the patch during normal use, allowing measurements to be taken automatically. For example, continuous monitoring can occur, with readings taken every second to daily or weekly, typically every 2-60 minutes, and more typically every 5-10 minutes. The timing of readings can vary depending on the nature of the measurements being taken and the specific circumstances. Thus, for example, an athlete may wish to be monitored more frequently while competing in a sport and less frequently while recovering from a sport. Similarly, for individuals undergoing medical monitoring, the frequency of monitoring can vary depending on the nature and / or severity of the condition. In one example, the frequency of monitoring can be selected based on user input and / or a defined user profile, etc.

[0318] In an integrated setup, the reader is connected to the patch using a conventional resistive bridge circuit and measurements can be made using analog-to-digital conversion.

[0319] Alternatively, the reader can be separate, allowing it to be removed when not in use, allowing the user to wear the patch without the integrated electronics, making it less intrusive. This is particularly useful for applications such as sports, geriatrics, and pediatrics, where the presence of a bulkier device can interfere with activity. In this situation, the reader is typically brought into contact with or proximity to the patch, and a reading can be taken as needed. It will be appreciated that this requires the user / person to initiate interrogation. However, the reader can also include an alert feature to prompt interrogation.

[0320] Readings can be taken wirelessly, optionally using inductive coupling to power the patch and take readings as described in more detail below, although direct physical contact can alternatively be used. In this example, the microstructure and tissue form part of a resonant circuit with respective inductances or capacitances, and frequency can be used to determine impedance and therefore fluid level, or analyte level or concentration. Additionally and / or alternatively, ohmic contact can be used, where the reader makes electrical contact with a connector on the patch.

[0321] In either case, some analysis and interpretation of the hydration signal or analyte level or concentration can be performed in the reader, and the reader can optionally display the indication using outputs such as LED indicators, LCD screens, etc. Additionally and / or alternatively, an audible alarm may be provided to provide an indication, for example, if the subject is under- or over-hydrated or if the analyte level or concentration is outside of an acceptable range. The reader may also incorporate wireless connectivity, such as Bluetooth, Wi-Fi, etc., to allow reading events to be triggered remotely and / or to allow data, such as impedance values, hydration or analyte level or concentration indicators, to be transmitted to a remote device, such as a client device, computer system, or cloud-based computing equipment.

[0322] In use, the housing typically couples to the substrate, allowing the housing and substrate to be attached and detached as needed. In one example, this can be achieved using any suitable mechanism, such as an electromagnetic coupling, a mechanical coupling, an adhesive coupling, or a magnetic coupling. This allows the housing, and in particular the sensing device, to be connected to the substrate only when needed. Thus, the substrate can be applied to the object and secured, and the sensing system can be attached to the substrate only when a measurement is to be taken. However, it will be appreciated that this is not required, and the housing and substrate can instead be secured together to the object using, for example, an adhesive patch, an adhesive coating on the patch / substrate, a strap, an anchor microstructure, or the like. In a further example, the substrate can form part of the housing, such that the substrate and microstructure are integrated into the housing.

[0323] When the housing is configured to be attached to a substrate, the housing typically includes a connector that operably connects to a substrate connector on the substrate, thereby communicating signals between the signal generator and / or sensor and the microstructure. The nature of the connector and connection will vary depending on the preferred embodiment and the nature of the signal, and may include conductive contact surfaces that engage corresponding surfaces on the substrate, or may include wireless connections such as tuned induction coils, wireless communication antennas, etc.

[0324] In one example, the system is configured to perform repeated measurements over a period of hours, days, weeks, etc. To achieve this, the microstructures can be configured to remain within the subject during that period, or can be removed when measurements are not being taken. In one example, the actuator can be configured to trigger the insertion of the microstructures into the skin and also enable the removal of the microstructures after measurements are taken. In that case, the microstructures can be inserted and retracted as needed to perform measurements over an extended period of time without continuing to penetrate the skin. However, this is not required; instead, short-term measurements can be performed, in which case the period can be less than 0.01 seconds, less than 0.1 seconds, less than 1 second, or less than 10 seconds. It will be appreciated that other intermediate time frames can also be used.

[0325] In one example, once measurements are taken, one or more electronic processing devices analyze the measured response signals to determine indicators indicative of the subject's health and / or physiological status.

[0326] In one example, this is accomplished by deriving at least one metric that can be further used to determine the indicator. For example, the system may be configured to perform impedance measurements, with the metric corresponding to impedance parameters such as impedance at a particular frequency, phase angle, etc. The metric may be further used to derive an indicator, such as an indication of fluid level, such as extracellular or intracellular fluid level.

[0327] The manner in which this is done varies depending on the preferred embodiment. For example, the electronic processing device may apply the metrics to at least one computational model to determine the index, where the computational model embodies a relationship between the health status and one or more metrics. In this case, the computational model may be obtained by applying machine learning to reference metrics derived from subject data measured for one or more reference subjects with known health status. In this case, the health status may be indicative of organ function, tissue function, or cellular function, may include the presence, absence, degree, or severity of a medical condition, or may include one or more measures otherwise related to the health status, such as measurements of the presence, absence, level, or concentration of one or more analytes or other biomarkers.

[0328] The model and the nature of the training performed can be of any suitable type and can include any one or more of decision tree learning, random forests, logistic regression, association rule learning, artificial neural networks, deep learning, inductive logic programming, support vector machines, clustering, Bayesian networks, reinforcement learning, representation learning, similarity and metric learning, genetic algorithms, rule-based machine learning, learning classifier systems, etc. These approaches are known and will not be described in further detail. In one example, this can include training a single model to determine the index using metrics from reference subjects with a combination of different health states, although this is not required and other approaches can be used.

[0329] The measured signals can also be used in other ways. For example, changes in a metric over time can be used to track changes in a subject's health or medical condition. The measured signals can also be analyzed to generate images or perform mapping. For example, tomography can be used to establish 2D or 3D images of a region of interest based on impedance measurements, etc. The signals can also be used for contrast imaging, etc.

[0330] In one example, the system may include a transmitter that transmits measured object data, metrics, or measurement data, such as response signals or values ​​derived from measured response signals, allowing them to be analyzed remotely.

[0331] In one particular example, the system includes a wearable patch including a substrate and microstructures, and a monitoring device (also called a "reader") that performs the measurements. The monitoring device can be attached to or integrally formed with the patch, for example, with the necessary electronics mounted on the backside of the substrate. Alternatively, the reader can be brought into contact with the patch when a reading is to be taken. In either case, the connection between the monitoring devices can be a conductive (ohmic) contact, or alternatively, can be a commanding connection, allowing the reader to wirelessly interrogate and / or power the patch.

[0332] The monitoring device can be configured to cause measurements to be taken and / or at least partially process and / or analyze the measurements. The monitoring device can control the stimulation applied to at least one microstructure, for example, by controlling a signal generator and / or a switch as needed. This allows the monitoring device to selectively interrogate different microstructures, thereby allowing different measurements to be taken and / or measurements to be taken at different locations. This also allows the microstructures to be selectively stimulated, for example, allowing different therapies to be administered to a subject. Thus, the microstructures can be selectively stimulated, thereby selectively releasing therapeutic materials, and can be used to provide dosage control or deliver different therapeutic materials.

[0333] The monitoring device can also be used to generate an output, such as an output indicative of an indicator or a recommendation based on the indicator, and / or to cause an action to be taken. Thus, the monitoring device can be configured to generate an output including a notification or alert, which can be used to trigger an intervention, for example, to indicate to the user that action is needed. This can be a simple indication of a problem, such as telling the user that they are dehydrated or that their troponin level is high, and / or can include a recommendation, such as telling the user to hydrate or seek medical attention. The output can also and / or instead include an indication of an indicator, such as a measurement, or information derived from the indicator. Thus, hydration levels or analyte levels or concentrations can be presented to the user.

[0334] The monitor device may also be configured to trigger other actions.

[0335] The output can also be used to alert a caregiver that intervention is needed, e.g., forward a notification to the caregiver's client device and / or computer. In another example, it can be used to control remote equipment. For example, it can be used to trigger a drug delivery system, such as an electronically controlled syringe infusion pump, allowing an intervention to be triggered automatically. In a further example, a semi-automated system can be used, e.g., a notification including the indication and recommended intervention is provided to a clinician, who can approve the intervention, after which the intervention can be performed automatically.

[0336] In one example, the monitoring device is configured to interface with a separate processing system, such as a client device and / or computer system. In this example, this allows processing and analysis tasks to be distributed between the monitoring device and the client device and / or computer system. For example, the monitoring device may perform partial processing, such as filtering and / or digitizing, of the measured response signals and provide an indication of the processed signals to a remote process system for analysis. In one example, this is accomplished by generating subject data including the processed response signals and transferring this to the client device and / or computer system for analysis. This thus allows the monitoring device to communicate with a computer system that generates, analyzes, or stores subject data derived from the measurement data, which may further be used to generate an indicator at least partially indicative of a health status associated with the subject.

[0337] It will also be appreciated that this allows additional functionality to be implemented, including forwarding notifications to a clinician or other caregiver, and also allows for remote storage of data and / or metrics. In one example, this allows recorded measurements and other information, such as derived metrics, details of applied stimulation or therapy, and / or details of other resulting actions, to be incorporated directly into an electronic record, such as an electronic medical record.

[0338] In one example, this allows the system to augment telemedicine systems with high-fidelity, accurate clinical data, providing data to support the growing telemedicine sector, enabling remote clinicians to obtain the information they need, which will be highly valued both in centralized hospitals and in rural areas far from centralized laboratories and regional hospitals. Because time to treatment is a strong predictor of improved clinical outcomes for heart attack patients, dispersed populations cannot rely solely on access to traditional large hospitals. Thus, the system could provide a low-cost, robust, and accurate monitoring system capable of diagnosing heart attacks, for example, that could be offered at any local medical facility and be as simple as applying a patch device. In this example, for patients who test positive for troponin I, resources could be quickly dispatched without delay for cardiac troponin clinical blood testing. Similarly, patients determined to be low-risk could be released with earlier, less invasive testing or redirected to other channels, such as through their family doctor.

[0339] In a further example, a client device such as a smartphone, tablet, etc. is used to receive measurement data from the wearable monitor device, generate target data, and forward it to a processing system, which returns indicators that may then be displayed on the client device and / or monitor device depending on the preferred implementation.

[0340] However, it will be appreciated that this is not required and that some or all of the steps of analyzing the measurements, generating the indicators, and / or displaying a representation of the indicators may be performed on the monitor device.

[0341] Again, it will be appreciated that similar outputs may also be provided to or by a remote processing system or client device, for example, alerting a clinician or trainer that a subject or athlete needs attention and that intervention should be performed, controlling equipment such as a drug delivery device, etc.

[0342] The reader may be configured to take measurements automatically when integrated into the patch or permanently / semi-permanently attached, or if the reader is separate, may take measurements when brought into contact with the patch, in this latter example the reader may be inductively coupled to the patch.

[0343] Thus, functionality such as processing measured response signals, analyzing results, generating output, controlling measurement procedures, and / or delivering therapy may be performed by an on-board monitor device and / or by a remote computer system, with it being understood that the specific distribution of tasks and resulting functionality may vary depending on the preferred implementation.

[0344] In one example, the system includes a substrate coil disposed on a substrate and operably coupled to one or more microstructure electrodes, which may include microstructures that are electrodes or that include electrodes thereon. Excitation and receive coils are typically provided within the housing of the measurement device, with the excitation and receive coils positioned proximate to the substrate coil during use. This is done to inductively couple the excitation and receive coils to the substrate coil, such that an excitation signal applied to the drive coil induces a signal in the substrate coil, which may form a resonant circuit in conjunction with the electrodes and other reactive components on the substrate. The signal frequency, amplitude, and attenuation (Q) of the resonant circuit on the substrate are reflected in the signals observed at the excitation and receive coils, which in turn allow the drive signal applied to the excitation and receive coils to be modified, e.g., by changing the signal's frequency, phase, or magnitude, which can serve as a response signal, e.g., to measure bioimpedance or biocapacitance.

[0345] While this can be used in a variety of ways, in one example, one or more microstructure electrodes are configured to bind one or more analytes of interest such that the response signal is dependent on the presence, absence, level, or concentration of the analytes of interest. This can be achieved in a variety of ways, such as coating the microstructure with a binding agent or forming the microstructure from a material that includes the binding agent, as discussed above, so that the analytes interact with the microstructure electrodes and change their electrical properties, thereby changing the characteristics of the response signal. For example, this can include binding the analyte to a coating or material forming the microstructure, such as a molecularly imprinted polymer.

[0346] Detection of the analyte can be done in any manner, including, for example, by examining the change in response signal over time as the level or concentration of the analyte near the microstructure electrodes changes. Alternatively, in another example, two sets of microstructure electrodes are used, which are independently driven, one acting as a control and the other selectively responsive to one or more analytes, so that differences in the measured signals indicate changes in the analyte level or concentration.

[0347] In this example, the system typically includes a first substrate coil disposed on the substrate and operably coupled to one or more first microstructure electrodes, and a second substrate coil disposed on the substrate and operably coupled to one or more second microstructure electrodes, the second microstructure electrodes configured to interact with an analyte of interest. At least one drive coil is positioned proximate to at least one of the first and second substrate coils such that a modification, such as attenuation or a phase or frequency shift, of the applied drive signal serves as a response signal. In this case, one or more electronic processing devices use the first and second response signals, particularly the difference between the first and second response signals, to determine the presence, absence, level, or concentration of the analyte of interest.

[0348] Where multiple substrate coil and electrode combinations form resonant circuits, each may be intentionally designed to have a different resonant frequency by selection of either inductive or capacitive fixed reactive components, thereby allowing a means of frequency-based multiplexing of the entire array using a single excitation and receiving coil.

[0349] Further examples of systems for performing measurements on living subjects will now be described with reference to Figures 3A to 3K.

[0350] In this example, the system includes a monitor device 320 that includes a sensor 321 and one or more electronic processing devices 322. The system further includes a signal generator 323, a memory 324, an external interface 325 such as a wireless transceiver, an actuator 326, and an input / output device 327 such as a touch screen or display and input buttons connected to the electronic processing device 322. The components are typically provided within a housing 330, which is described below.

[0351] The nature of the signal generator 323 and sensor 321 depends on the measurements to be made and may also include current and voltage sensors, other electromagnetic radiation sources such as lasers or LEDs, and photodiode or CCD sensors, etc. The actuator 326 is typically a spring or electromagnetic actuator combined with a piezoelectric actuator or vibration motor coupled to the housing, which urges the substrate to vibrate against the underside of the housing, thereby pressing the microstructure into the skin, while the transceiver is typically a short-range wireless transceiver such as a Bluetooth system on a chip (SoC).

[0352] The processing device 322 executes software instructions stored in memory 324 to enable various processes to take place, including controlling the signal generator 323, receiving and interpreting signals from the sensor 321, generating and transmitting measurement data to a client device or other processing system via the transceiver 325. Thus, the electronic processing device is typically a microprocessor, a microcontroller, a microchip processor, a logic gate configuration, firmware optionally associated with a logic implementation such as an FPGA (Field Programmable Gate Array), or any other electronic device, system, or equipment.

[0353] In use, the monitoring device 320 is coupled to a patch 310 comprising a substrate 311 and microstructures 312 coupled to a sensor 321 and / or signal generator 323 via a connection 313. The connection may comprise a physical conductive connection such as a conductive track, although this is not required; instead, an inductive connection or a wireless connection such as a radio frequency wireless connection may be provided. In this example, the patch further comprises anchor microstructures 314 configured to penetrate into the dermis, thereby helping to anchor the patch to the subject.

[0354] An example of patch 310 is shown in more detail in Figures 3B and 3C. Notably, in this example, substrate 311 is generally rectangular with rounded corners to avoid discomfort when the substrate is applied to a subject's skin. Substrate 311 includes anchor microstructures 314, which are provided proximate corners of substrate 311 to help secure the substrate, while measurement microstructures 312 are provided in an array on the substrate. In this example, the array has a regular grid organization, with microstructures 312 provided in equally spaced rows and columns, although this is not required and alternative spacing configurations can be used, as described in more detail below.

[0355] 3D and 3E, three anchor microstructures 314.1, 314.2, 314.3 are provided, surrounded by respective circumferentially spaced microstructures 312.1, 312.2, 312.3. This can be useful to maximize anchor effectiveness, providing the microstructures 312 particularly close to the anchor microstructures 314 to avoid movement of the microstructures 312 within the subject. Additionally, in this example, the anchor microstructures 314 can also be used in measuring or applying signals, such as by acting as a ground connection.

[0356] In this example, the substrate is also formed from multiple substrate layers 311.1, 311.2, which may be useful for creating internal structures such as connections to microstructures, coils, etc. In a similar manner as described below with respect to the backing, the substrate may also include different regions or layers having different material properties, etc.

[0357] In this example, the anchor microstructure 314.1 is circular and includes one peripheral group of circumferentially spaced microstructures 312.1. However, this is not required, and in the case of the anchor microstructure 314.2, it will be understood that the anchor microstructure 314.2 is surrounded by two or more concentric groups of microstructures 312.2, with the outer groups including more microstructures. This allows measurements to be taken over a wider range. It will be understood that other arrangements are possible, such as providing additional concentric groups, providing different numbers of microstructures in each group, etc. Additionally, while a circular group is shown, this is not intended to be limiting, and other shapes or distributions may be used, including elliptical shapes, square shapes, etc.

[0358] In the case of the anchor microstructure 314.3, which is hexagonal, there are six plate microstructures 312.3, each positioned radially outward from a respective face of the hexagonal anchor microstructure 314.3. In this way, measurements can be taken between each face of the anchor microstructure 314.23 and each microstructure 312.3, which can be useful for maximizing the surface area of ​​the electrodes on each face and plate while maintaining an equidistance separation between the anchor microstructure and the surrounding microstructures.

[0359] While the above configurations are described with respect to anchor microstructures, it will be appreciated that this is not required and similar arrangements may be used with any drive or sense microstructure. Thus, in one example, one drive microstructure may be used with multiple peripheral sense microstructures, or one sense microstructure may be used with multiple peripheral drive microstructures. This provides an effective master-slave arrangement in which one master drive / sense microstructure is used with multiple sense / drive microstructures.

[0360] Such a master / slave relationship can be used in a wide range of applications, for example, to induce responses in multiple sense microstructures using a single drive signal. In this example, it can also be used for mapping, for example, to identify different responses at different locations and thereby determine the effects of, for example, the presence of an analyte or a particular target such as a lesion or cancer. Alternatively, it can be used with sense microstructures used to detect different analytes, for example, using different coatings, so that a single stimulus signal can trigger the detection of different analytes.

[0361] 3B and 3C, four connectors 315 are provided that connect to respective microstructures 312 via connections 313 so that stimulus and response signals can be applied to and measured from the two sets of respective microstructures. This can be used to allow for symmetric or differential application and detection of signals, as opposed to asymmetric or single-ended application or detection, which is typically done relative to a ground reference and is generally noisier. However, it will be appreciated that for some detection modalities, such as optical detection, this is not important and a single connection 315 can be provided.

[0362] The substrate also includes a coupling member 316 , such as a magnet, that can be used to attach the substrate to the housing 330 .

[0363] In the example of Figures 3F and 3G, the housing 330 is a generally rectangular housing. The measurement device can optionally have a form factor similar to a watch or other wearable device, in which case it includes a strap 331 that allows the housing to be secured to the user. However, this is not required, and other securing mechanisms can be used. Alternatively, the housing can simply engage with the patch and hold it in place each time a measurement is taken. In this example, the housing includes a connecting member 332, such as a magnet, that can engage with a corresponding connecting member 316 on the substrate, allowing the substrate to be secured to the housing. While any form of connecting member can be used, the use of a magnet is particularly advantageous because the magnet can be contained within the housing 330, thereby sealing the housing and also serving to ensure proper alignment of the substrate 310, for example, by allowing the polarity of the magnet to guide the relative orientation of the substrate 310 and the housing 330.

[0364] However, it will be understood that this configuration is for illustrative purposes only and that other arrangements can be used. For example, the substrate can form part of an adhesive patch that is applied to a subject and held in place. Alternatively, an adhesive can be provided on a surface of the substrate for directly adhering the substrate to the subject. The housing 330 can then be selectively attached to the patch, for example, using a magnetic coupling, thereby allowing measurements to be taken as needed.

[0365] In this example, the substrate may be a flexible substrate, which may be achieved using a woven or nonwoven fabric or other suitable material to which the microstructures are directly attached. More commonly, however, flexibility is achieved by forming a segmented substrate using several individual substrates 311 attached to a flexible backing 319, as shown in Figure 3H. It will be appreciated that such an arrangement may be used in a wide variety of situations, including attaching the substrate to a strap or the like for attaching it to an object.

[0366] Some further variations are shown in Figures 3I-3K.

[0367] In particular, in the example of Figure 3I, the backing 319 is formed from multiple backing layers 319.1, 319.2, two of which are shown in the example for illustrative purposes only. The use of multiple layers can be beneficial in achieving desired properties, such as to provide adhesive or waterproof layers.

[0368] In the example of Figure 3J, the backing layer has a plurality of interspersed regions 319.3 that can be used for specific purposes such as to allow easier attachment of the substrate 311, to provide connectivity to the measurement device 320, to increase flexibility between the substrates 311, etc. In this example, the interspersed regions are substantially aligned with the substrate, although it will be appreciated that this is not required and they can be provided in other locations.

[0369] A further example is shown in Figure 3K, which includes several geometric modifications, including thinner regions 319.4 located between the substrates that may be used to enhance flexibility, or thicker regions 319.5 between the substrates that may enhance strength. Similarly, thinner or thicker regions 319.5, 319.6 may also be provided along the substrate to enhance, for example, strength, flexibility, connection to a measurement device, etc.

[0370] Although these features are described with respect to the backing layer, it will be understood that a similar approach can also be used for the substrate itself.

[0371] An example of an actuator configuration to aid in patch application will now be described with reference to FIG. 3L.

[0372] In this example, housing 330 includes a mount 333 to which an actuator 326, such as a piezoelectric actuator or vibration motor, is attached. The actuator 326 is aligned with an opening 334 in the underside of housing 330, through which an arm 326.1 connected to the actuator 326 extends, and opening 334 may be sealed using an O-ring 334.1 or other similar equipment.

[0373] The patch substrate 311 is positioned adjacent to the underside of the housing 330, and magnets 316, 332 are provided to urge the substrate 311 towards the housing 330. The arm 326.1 engages the substrate, thereby transferring force from the actuator 326 to the substrate 311, allowing the substrate, and therefore the microstructures 312, 314, to be vibrated to assist in inserting the microstructure into a target. In particular, this arrangement transfers force directly to the substrate 311, allowing force at the substrate to be maximized while vibration of the housing 330 is minimized.

[0374] A further example of an actuator arrangement will now be described with reference to FIG. 3M.

[0375] In this example, the actuator arrangement includes an actuator housing 335 having a base 335.1 with an opening 335.2. The housing includes a spring 336 and a mount 337, which supports the patch 310 (and any integrated reader) during use. The mount also optionally includes a piezoelectric actuator or offset motor 338.

[0376] In use, the actuator housing 335 is positioned so that the base 335.1 of the housing 335 abuts the subject's skin, with the patch at least partially protruding through the opening 335.2. In one example, this is achieved by having an operator hold the actuator housing. However, this is not required, and the actuator housing may additionally and / or alternatively be integrated into and / or form part of the monitoring device, as described above.

[0377] In use, spring 336 is configured to apply a continuous biasing force to attachment 337, thereby pressing patch 310 against the subject's skin. Additionally, a piezoelectric actuator or offset motor 338 can vibrate attachment 337 and thus patch 310, thereby facilitating the microstructures to pierce and / or penetrate the stratum corneum.

[0378] Next, an example of the microstructure equipment will be described in more detail with reference to FIGS.

[0379] In the example of Figure 4A, microstructures of different lengths are shown, with first microstructures 412.1 penetrating the stratum corneum and viable epidermis but not breaking through the dermis, second microstructures 412.2 entering the dermis but only just passing the dermal boundary, and third microstructures 412.3 penetrating the dermal layer a greater distance. It will be appreciated that the length of the structures used will vary depending on the intended use of the device, particularly the nature of the barrier to be breached.

[0380] In the example of Figure 4B, pairs of microstructures are provided, with a first pair of microstructures 412.4 having a closer spacing and a second pair of microstructures 412.5 having a relatively larger spacing, which can be used to detect different properties or to provide different forms of stimulation.

[0381] For example, larger electrode spacing can be used to make impedance measurements of interstitial fluid and other tissues and fluids between the electrodes, while closer spaced electrodes are better suited to capacitive sensing to detect different analytes present on the surface of the electrodes.

[0382] Additionally, the electric field strength generated by applying a signal to the first and second microstructure pairs is shown in Figures 4C and 4D, highlighting that as the spacing increases, the field strength between the electrodes decreases, which further impacts the ability to stimulate. For example, by providing an array of closely spaced microstructures, this can be used to generate a very uniform field within a subject without the need for a large applied field. This can be used to enable the field to be used for stimulation, such as for electroporation.

[0383] The microstructures can have a variety of shapes, examples of which are shown in Figures 4E-4J. In particular, these show circular, rectangular, octagonal, cross, and star shapes. The shape used will vary depending on the intended application. For example, a larger number of microstructures may be useful to provide multiple different electrode surfaces, while a larger overall surface area may be useful to maximize the amount of coverage. Similarly, sharp surfaces, such as cross and star features, may allow the coverage to provide a generally circular profile with varying depths of coverage around the microstructure.

[0384] A specific example of a plate microstructure is shown in Figures 5A-5C.

[0385] In this example, the microstructure is a plate having a body 512.1 and a tip 512.2, which is tapered to facilitate penetration of the microstructure 512 into the stratum corneum. In this example, electrode plates 517 are provided on both sides of the microstructure, and these are coupled via a single connection 513 to a connector 515, which is further connected to a sensor 321 and / or a signal generator 323. This allows signals to be measured or applied collectively from or to the electrode plates. However, it will be appreciated that this is not required, and separate connections can be provided to allow each electrode to be independently driven or sensed. Additionally, each electrode 517 can be subdivided into multiple separate segments 517.1, 517.2, 517.3, 517.4, with each side containing multiple electrodes.

[0386] 5C and 5D, different setups can be used, but typically pairs of microstructures are formed so that the microstructures face each other to apply signals between them or measure signals between them. Again, different separations between the electrodes within an electrode pair can be used to make different measurements and / or change the profile of stimulation of the tissue between the electrodes.

[0387] Further examples of blade microstructures are shown in Figures 5E and 5F.

[0388] In this example, the microstructure has an elongated body 512.1 and a tip 512.2 that is tapered to facilitate penetration of the microstructure 512. It has a generally similar profile to the plate feature described above, but in this example is much wider and, in one particular example, can extend substantially the entire distance across the substrate. In this example, the microstructure includes multiple electrode plates 517 on either side of the microstructure. In this case, the substrate can include multiple spaced-apart parallel blades, allowing signals to be applied across or measured between electrodes on different blades. However, it will be appreciated that other configurations can be used, such as providing a single electrode, providing segmented electrodes, or having the entire microstructure act as an electrode.

[0389] In the example shown, the blade tip is parallel to the substrate, but this is not required and other configurations can be used, such as having a beveled tip so that as the blade is inserted it penetrates gradually along its length, thereby further facilitating penetration. The tip may also include serrations or the like to further enhance penetration.

[0390] As noted above, in one example, the microstructures are provided in a regular lattice arrangement. However, in another example, the microstructures are provided in a hexagonal lattice arrangement, as shown in Figure 5G. This is particularly advantageous because each microstructure is equally spaced relative to all of its nearest neighboring microstructures, as indicated by the arrows, meaning that measurements can be made without having to modify the response or stimulus signal to account for different spacings relative to any neighboring microstructures.

[0391] A further example implementation is shown in Figures 5H-5K, in which the microstructures 512 are arranged in pairs 512.3, and the pairs are arranged in offset rows 512.4, 512.5. In this example, the pairs in different rows are arranged orthogonally, so that the microstructures extend in different directions. This aligns all of the microstructures, further avoiding potential vulnerability of the patch to lateral slippage in the direction aligned with the microstructures. Additionally, orthogonal pairing reduces interference, such as crosstalk, between different electrode pairs, improving measurement accuracy, especially when performing simultaneous measurements via multiple microstructure pairs, and accounting for tissue anisotropy.

[0392] In one example, each row of microstructure pairs may be provided with respective connections 513.41, 513.42; 513.51, 513.52 to allow an entire row of microstructure pairs to be interrogated and / or stimulated simultaneously while allowing different rows to be interrogated and / or stimulated independently.

[0393] A scanning electron microscopy (SEM) image showing an array of offset plate microstructure pairs is shown in Figure 5K.

[0394] Examples of microstructures for making measurements in the epidermis are shown in Figures 5L and 5M.

[0395] In this example, the microstructure is a plate or blade having a body 512.1 with an flared base 512.11 where the body joins with the substrate, enhancing the strength of the microstructure. The body narrows at a waist 512.12 to define a shoulder 512.13, which in this example extends via a non-tapered shaft 512.14 to a tapered tip 512.2. Typical dimensions are shown in Table 4 below.

[0396] [Table 4]

[0397] An example pair of the microstructures of Figures 5L and 5M upon insertion into a subject is shown in Figure 5N.

[0398] In this example, the microstructure is configured so that the tip 512.2 penetrates the stratum corneum SC and enters the viable epidermis VE. The waist 512.12, and particularly the shoulder 512.13, abuts the stratum corneum SC, preventing the microstructure from penetrating further into the subject and preventing the tip from entering the dermis. This helps to avoid contact with nerves that could lead to pain.

[0399] In this configuration, the body 512.1 of the microstructure can be covered with a layer of insulating material (not shown) with only the tip exposed. As a result, a current signal applied across the microstructure generates an electric field E within the subject, particularly within the living epidermis VE, and the resulting measurements reflect the fluid level within the living epidermis VE.

[0400] However, it will be appreciated that other configurations can be used, for example, in the setup of Figure 5O, the shaft 512.14 is extended so that the tip 512.2 enters the dermis, allowing measurements to be taken of the dermis (and optionally the epidermis).

[0401] In this example, typical dimensions are shown in Table 5 below.

[0402] [Table 5]

[0403] Examples of inter-pair and intra-pair spacing for these configurations are shown in Table 6 below.

[0404] [Table 6]

[0405] A further example of an arrangement is shown in Figures 6A and 6B, where the microstructure again comprises a generally similar plate-like arrangement, with the microstructure including spaced apart prongs 612.2 each having an electrode 617 thereon such that the electrode is on a surface between the prongs 612.2, again allowing for the application of a very uniform field or for capacitive sensing to take place.

[0406] 7A and 7B, which includes a body 512.1 including a conductive core 513 covered by an insulating layer 512.1, which in one example may be a polymer or other material. In this case, the core 513 terminates in an opening 513.2, allowing an electrical signal to be transmitted through the opening. Additionally and / or alternatively, a port 513.3 extending through the insulating layer may also be provided to allow an electrical signal to be transmitted partway along the structure, as shown in FIG. 7B, allowing measurements to be taken at a target depth within the living epidermis and / or dermis.

[0407] It will also be appreciated that when pairs of microstructures are used, electrodes may be provided only on the inner surfaces of the pairs, for example by insulating the outer surfaces of the pairs, thereby reducing electrical interference between different pairs of microstructures.

[0408] Further construction of the patch arrangement will now be described with reference to Figures 8A-8L.

[0409] In this example, substrate 810 is formed from a metal, particularly stainless steel, plate 811, into which a U-shaped cutout 815 is made, and the interior section can be bent downward as indicated by arrow 812.1 to form structures 812 adjacent to each aperture 816. This process is repeated to form identical first and second substrates 810.1, 810.2, which are then combined with an intervening insulating layer 810.3. In one example, insulating layer 810.3 is made of plastic or other similar material and attached to the backside of first substrate 810.1, after which microstructures 812 on the second substrate are punched through the insulating layer and apertures 811.2 of first substrate 810.1 to form a patch including a pair of electrically isolated microstructures. As a result, a signal can be measured across or applied between substrates 810.1, 810.3, and thus the pair of microstructures.

[0410] It will thus be appreciated that this provides a mechanism for quickly and inexpensively constructing arrays of spaced apart microstructure pairs that can be used in applying and / or measuring signals.

[0411] Providing a pair of substrates 811 separated by an insulating layer can result in significant capacitive coupling, which can further affect readings. In one example, this can be addressed by creating additional openings in the first and second substrates 811.1, 811.2, thereby reducing the amount of overlapping substrate material. In an alternative example, shown in Figure 8H, the second substrate is rotated 180° so that openings 816.1, 816.2 are offset, thereby creating a similar effect.

[0412] A further alternative configuration is shown in Figures 8I and 8J, where one substrate 811.3 has back-to-back cutouts 815.3 to allow for pairs of microstructures 812.3.

[0413] A further example configuration is shown in Figures 8K and 8L. In this example, two substrates 811.4, 811.5 are provided, with the first substrate 811.4 including individual first microstructures 812.4 that can be positioned between pairs of second microstructures 812.5 on the second substrate 811.5. The first and second substrates 811.4, 811.5 and the first and second microstructures 812.4, 812.5 are typically held apart by insulating spacers 817. This configuration allows the first microstructures to act as interrogators of the conditions between the second microstructures 812.5. For example, a field can be applied between the second microstructures 812.5, and the first microstructures can be used to measure similar field strengths. In one example, a coating 818 can be applied to the microstructures 812.4, 812.5 to strengthen the microstructures during insertion through a barrier.

[0414] An alternative technique for fabricating microstructures will now be described with reference to Figures 8M-8Q.

[0415] In this example, a carrier wafer 891 is provided and spin-coated with a photopolymer layer 892. The photopolymer layer 892 is selectively exposed to UV radiation and cross-linked to create structural regions 892.1, which in this example form the substrate. A second photopolymer layer 893 is spin-coated over the first layer 891, exposed to UV radiation and cross-linked to create second structural regions 893.1, which in this example form the microstructures extending from the substrate. The carrier wafer and uncross-linked polymer are removed to create the microstructures shown in FIG. 8P.

[0416] It will be appreciated that a wide range of different microstructure configurations can be created using this layering technique, and an alternative design is shown in Figure 8Q.

[0417] In one example, the monitor device operates as part of a distributed architecture, an example of which will now be described with reference to FIG.

[0418] In this example, one or more processing systems 910 are coupled to several client devices 930 and monitor devices 920 via a communications network 940 and / or one or more local area networks (LANs). The monitor devices 920 may be directly connected to the network, or may be configured to connect to the client devices 930, with the client devices 930 providing further connectivity to the network 940. It will be appreciated that the configuration of the network 940 is for example purposes only, and that in practice the processing systems 910, client devices 930, and monitor devices 930 may communicate via any suitable mechanism, such as via wired or wireless connections, including, but not limited to, mobile networks, private networks such as 802.11 networks, the Internet, LANs, WANs, etc., as well as via direct connections or point-to-point connections such as Bluetooth.

[0419] In one example, each processing system 910 is configured to receive subject data from a monitor device 920 or a client device 930 and analyze the subject data to generate one or more health status indicators, which may then be provided to the client device 930 or the monitor device 920 for display. While the processing system 910 is shown as a single entity, it will be appreciated that the processing system 910 may be distributed across several geographically separated locations, for example, by using a processing system 910 and / or database provided as part of a cloud-based environment. However, the above arrangement is not required, and other suitable configurations may be used.

[0420] An example of a suitable processing system 910 is shown in FIG.

[0421] In this example, processing system 910 includes at least one microprocessor 1000, memory 1001, optional input / output devices 1002 such as a keyboard and / or display, and an external interface 1003, interconnected via a bus 1004 as shown. In this example, external interface 1003 can be utilized to connect processing system 910 to peripheral devices such as a communications network 940, a database 1011, other storage devices, etc. Although one external interface 1003 is shown, this is for illustrative purposes only, and in practice multiple interfaces using various methods (e.g., Ethernet, serial, USB, wireless, etc.) may be provided.

[0422] In use, the microprocessor 1000 executes instructions in the form of application software stored in memory 1001 to perform the necessary processes. The application software may include one or more software modules and may be executed in a suitable execution environment, such as an operating system environment.

[0423] It will therefore be appreciated that processing system 910 may be formed from any suitable processing system, such as a suitably programmed client device, a PC, a web server, a network server, etc. In one particular example, processing system 910 is a standard processing system, such as, but not required to be, an Intel™ architecture-based processing system that executes software applications stored on non-volatile (e.g., hard disk) storage. However, it will also be appreciated that the processing system may be any electronic processing device, such as a microprocessor, a microchip processor, a logic gate configuration, firmware optionally associated with a logic implementation such as an FPGA (Field Programmable Gate Array), or any other electronic device, system, or equipment.

[0424] An example of a suitable client device 930 is shown in FIG.

[0425] In one example, client device 930 includes at least one microprocessor 1100, memory 1101, input / output devices 1102 such as a keyboard and / or display, and an external interface 1103, interconnected via a bus 1104 as shown. In this example, external interface 1103 can be utilized to connect client device 930 to peripheral devices such as a communications network 940, databases, other storage devices, etc. Although one external interface 1103 is shown, this is for illustrative purposes only, and in practice multiple interfaces using various methods (e.g., Ethernet, serial, USB, wireless, etc.) may be provided.

[0426] In use, the microprocessor 1100 executes instructions in the form of application software stored in the memory 1101 to enable communication with the processing system 910 and / or the monitor device 920 .

[0427] It will therefore be appreciated that client device 1130 may be formed from any suitable processing system, such as a suitably programmed PC, Internet terminal, laptop or handheld PC, and in one preferred example, a tablet, smartphone, etc. Thus, in one example, client device 1130 is a standard processing system, such as, but not necessarily, an Intel™ architecture-based processing system, executing software applications stored on non-volatile (e.g., hard disk) storage. However, it will also be appreciated that client device 1130 may be any electronic processing device, such as a microprocessor, a microchip processor, a logic gate configuration, firmware optionally associated with a logic implementation such as an FPGA (Field Programmable Gate Array), or any other electronic device, system, or equipment.

[0428] Examples of processes for taking measurements and generating indicators will now be described in more detail. For purposes of these examples, it will be assumed that one or more processing systems 910 operate to analyze received object data and generate resulting indicators. Measurements are taken by monitor device 920, and the object data is transferred to processing system 910 via client device 230. In one example, to provide this in a platform-agnostic manner and make it easily accessible using client devices 930 with different processing capabilities using different operating systems, input data and commands are received from client device 930 via a web page, and the resulting visualization is rendered locally by a browser application or other similar application executed by client device 930. Thus, processing system 910 is typically a server (hereinafter referred to as server) that communicates with client device 930 and / or monitor device 920 via communication network 940, etc., depending on the particular network infrastructure available.

[0429] To accomplish this, the server 910 typically executes application software for hosting web pages and performing other necessary tasks, including storing, retrieving, and processing data, and actions performed by the processing system 910 are performed by the processor 1000 according to instructions stored as application software in memory 1001 and / or input commands received from a user via the I / O device 1002 or commands received from the client device 1030.

[0430] It is also envisioned that a user may interact with server 910 via a GUI (Graphical User Interface) presented on client device 930, such as, in one particular example, a browser application that displays web pages hosted by server 910 or an app that displays data provided by server 910. Actions performed by client device 930 are performed by processor 1100 according to instructions stored as application software in memory 1101 and / or input commands received from a user via I / O device 1102.

[0431] However, it will be understood that the above configuration assumed for purposes of the following examples is not required, and that many other configurations may be used. It will also be understood that the division of functionality between monitor device 920, client device 930, and server 910 may vary depending on the particular implementation.

[0432] An example of a process for taking measurements on a subject will now be described in more detail with reference to Figures 12A and 12B.

[0433] In this example, the process for applying a patch including a substrate and microstructures is shown in steps 1200-1230, while the measurement process is shown in steps 1235-1260. In this regard, it will be understood that for a patch used to make multiple measurements over a period of time, steps 1200-1230 are performed only once, and steps 1235-1260 are repeated as necessary.

[0434] Additionally, for purposes of this example, the system is assumed to include a reader formed by housing 330 and associated signal generator, sensor, and processing electronics. The reader may be integral with patch 310 and / or separate from patch 310 depending on the preferred embodiment.

[0435] In step 1200, the substrate is provided in a desired position with the substrate and microstructure in place relative to the subject. In step 1205, assuming a reader is not integrated into patch 310, housing 330 is attached to substrate 311, for example, by magnetically or otherwise coupling the housing and substrate, or by holding the housing in contact with patch 310.

[0436] In step 1210, the processing device 322 selects the frequency / magnitude of the actuator, which may be a standard value and / or may depend on the barrier being breached, and therefore different values ​​may be selected for different locations on the object and / or different objects.

[0437] In step 1215, the actuator 326 is controlled to initiate vibration of the microstructure, thereby facilitating movement of the microstructure within the object.

[0438] A stimulus is optionally applied in step 1220 and a response signal is measured in step 1225 so that processing device 322 can monitor the depth of breach and / or penetration of the functional barrier. The mechanism for achieving this depends on the nature of the response signal and any stimulus. For example, impedance can also be derived using the stimulus and response, as impedance values ​​change as the microstructures penetrate the stratum corneum and into the living epidermis.

[0439] At step 1230, processing device 322 optionally determines whether the breach or penetration is complete; if not, the process returns to step 1210 to select a different frequency and / or magnitude. This process therefore allows for continuous adjustment of the frequency and / or magnitude of the force applied as the substrate and microstructure are applied, particularly as the microstructure breaches and optionally penetrates the functional barrier. In one example, this can be used to gradually increase the force while decreasing the frequency during insertion until the barrier is breached, at which point the force is reduced. In this regard, it has been found that this can facilitate penetration of the barrier.

[0440] Once the patch is applied, measurements can begin. In this regard, if a reader is integrated into the patch, measurements can be taken as needed. Alternatively, if the reader is separate, it may be necessary to bring the reader into proximity and / or contact with the patch so that measurements can be taken.

[0441] In this example, in step 1235, the monitoring device 920 applies one or more stimulus signals to the subject and then measures a response signal in step 1240. The response signal is measured by the sensor 321, which generates measurement data, which is provided to the processing device 322 in step 1245. In this example, the monitoring device 920 then forwards the measurement data to the client device 930 for further processing. In particular, the client device 930 could also perform preliminary pre-processing of the data, for example, adding additional information derived from on-board sensors such as GPS, thereby adding time or location information, etc. This information could be useful in situations such as tracking the spread of infectious diseases.

[0442] The resulting data may be collated, for example by creating target data, and then transferred to server 910 for further analysis in step 1250. However, it will be appreciated that the analysis may also be performed on the reader and that metrics derived from performing the analysis may also be displayed on the reader.

[0443] The nature of the analysis will vary depending on the preferred embodiment, and a wide range of options is anticipated.

[0444] When measuring fluid levels, an alternating current signal is applied to the subject through a pair of microstructures, and the resulting voltage signal is measured through the same microstructures. The magnitude and phase of the applied current and the resulting voltage can be further used to calculate an impedance value that depends on the fluid level in the subject. The measured impedance value can thus be correlated with fluid level, allowing for a determination of hydration in the subject, an example of which is described in more detail below.

[0445] It will be further appreciated that different information can be derived depending on the frequency at which the measurement is made. For example, the system can employ bioimpedance analysis (BIA), in which a single low-frequency signal is injected into the subject S and the measured impedance is used directly to determine a biological parameter. In one example, the applied signal has a relatively low frequency, such as less than 100 kHz, more typically less than 50 kHz, and more preferably less than 10 kHz. In this case, such a low-frequency signal can be used as an estimate of the impedance at zero applied frequency, which is indicative of extracellular fluid level.

[0446] Alternatively, the applied signal can have a relatively high frequency, such as above 200 kHz, more typically above 500 kHz, or even 1000 kHz, in which case such a high frequency signal can be used as an estimate of the impedance at infinite applied frequency, which is further indicative of the combined extracellular and intracellular fluid levels.

[0447] Additionally and / or alternatively, the system may use bioimpedance spectroscopy (BIS), in which impedance measurements are made at multiple frequencies, which may be further used to derive information about both intracellular and extracellular fluid levels, for example, by fitting the measured impedance values ​​to a Cole model.

[0448] When measuring the level or concentration of an analyte, an alternating electrical stimulation signal is applied to the subject through the pair of microstructures, and the resulting electrical response signal is measured through the same microstructures. The magnitude and / or phase of the applied signal and the voltage of the resulting response signal can be further used to calculate an impedance or capacitance value that depends on the level or concentration of the analyte in the subject. Thus, the measured impedance value can be correlated with the level or concentration of the analyte, thereby making it possible to monitor the progression of a disease, disorder, or condition, or to diagnose a disease, disorder, or condition, or to determine the presence, absence, level, or concentration of a drug, an illicit or non-illicit substance of abuse, or a chemical weapon, poison, or toxin.

[0449] For example, the subject data can be used in conjunction with previously collected subject data to perform longitudinal analyses to examine changes in measurements over time. Additionally and / or alternatively, the subject data can be analyzed using machine learning models, etc.

[0450] One or more indices are generated in step 1255, the nature of the indices and the manner in which they are generated will vary depending on the preferred embodiment and the nature of the analysis being performed.

[0451] In step 1260, data such as object data, metrics, or measurement data is recorded so that it can be accessed later as needed. Metrics may be provided to the client device 930 and / or the monitor device 920 for display.

[0452] In one example, a monitoring device is assigned to each user and this assignment is used to track measurements of the subject. An example process for assigning monitoring devices 920 to subjects will now be described with reference to Figure 13.

[0453] In this example, the subject first undergoes an assessment in step 1300, a process performed by a clinician. The clinician uses the assessment to guide the type of monitoring that needs to be performed and to identify specific biomarkers to be measured, which may further depend, for example, on any symptoms or medical diseases, disorders, or conditions from which the subject suffers. As part of this process, the clinician will typically obtain subject attributes, such as weight, height measurements, age, sex, details of medical interventions, etc., in step 1310. This may be done using a combination or techniques such as querying medical records, questioning, and taking measurements.

[0454] Once the evaluation is complete, a type of monitoring device can be selected at 1320, based on the measurements required. In this regard, it will be appreciated that various combinations of microstructure equipment and sensing modalities can be used to enable various measurements to be made, and therefore making the correct selection is important to enable measurements to be collected. A particular monitoring device 920 is then assigned to the subject at step 1330. In this regard, each device typically includes a unique identifier, such as a MAC (Media Access Control) address or other identifier, that can be used to uniquely associate the monitoring device with the subject.

[0455] At step 1340, the monitoring device 920 can optionally be configured to, for example, update firmware or instruction sets necessary to perform each measurement. At step 1350, a subject record is created that is used to store details related to the subject, including subject attributes, subject data, metrics, or any other relevant information. In addition, the subject record will typically also include an indication of the monitoring device identifier, thereby associating the monitoring device with the subject.

[0456] An example of a process for taking measurements using the device will now be described with reference to Figures 14A and 14B.

[0457] In this example, one or more measurements are taken in step 1400. The measurements are taken, for example, by having the monitoring device apply a stimulus signal and measure a response signal, using the process described above. Measurement data based on the response signals is recorded and uploaded to the client device 930 in step 1405, enabling the client device 930 to generate subject data in step 1410. The subject data may simply be the measurement data, but may also include additional information provided by the client device 930. This allows user input to be provided via the client device 930, providing, for example, symptom details, attribute changes, etc. Next, the subject data is uploaded to the server 910 in step 1415. Next, in step 1420, the server 910 retrieves another subject attribute, for example, from the subject's record, after which the server 910 calculates one or more metrics in step 1425.

[0458] At step 1430, the server 910 analyzes the metrics. The manner in which this is done varies depending on the preferred embodiment. For example, this can be accomplished by fitting the metrics to a computational model that embodies the relationship between the associated health status and one or more metrics. Alternatively, the metrics can be established from a population of reference subjects and compared to defined thresholds that are used to indicate a disease, disorder, or condition, such as the presence or absence of a medical condition. As a further option, the metrics can be compared to the subject's previous metrics, for example, to determine changes in the metrics that may further indicate a change in health status. The results of the analysis can be used to generate one or more indices at step 1435. In one example, the indices can be in the form of a score that represents the health status, or can indicate the presence, absence, or degree of a disease, disorder, or condition.

[0459] At step 1440 the indicator may be stored, at step 1445 an indication of the indicator may be forwarded to the client device 930 , and at step 1450 the indicator may be displayed by either the client device 930 or the monitor device 920 .

[0460] Additionally and / or alternatively, the indicator can be used to determine whether action is needed, e.g., whether intervention should be performed, in step 1455. The assessment of whether action is needed can be done in any of several ways, but typically involves comparing the indicator to criteria that define a predetermined threshold or acceptable range of indicator values, such as comparing a water retention indicator to a range indicative of normal water retention, or comparing an analyte indicator indicative of a normal level or concentration of the analyte.

[0461] The evaluation criteria can also specify the necessary action if the indicator falls outside of an acceptable range, and any steps necessary to implement the action, allowing the action to be taken in step 1460. For example, if an analyte is detected, this may indicate a medical condition, in which case the processing system or monitoring device can generate a notification that is provided to a clinician or other designated person or system to alert them. The notification can also include any determined indicators and / or measured response signals, allowing the clinician to quickly identify any necessary intervention. In theranostic applications, the action can also include causing the application monitoring device to apply a stimulation signal to the electrodes, thereby releasing one or more therapeutic agents. This can be done according to a dosing regimen that can be specified as part of the evaluation criteria or manually defined by the clinician in response to a notification provided, for example, as described above. Alternatively, the action can include notifying the user, thus, for example, if the subject is dehydrated, causing the monitoring device to provide hydration recommendations to the user.

[0462] It will therefore be appreciated that this allows actions to be triggered as required.

[0463] The above process describes the transfer of data to a remote system for analysis, which can have several advantages. For example, this allows for more complex analyses to be performed using existing processing power. It also enables remote supervision, for example, allowing clinicians to access records related to multiple patients in real time, allowing them to respond quickly if necessary. For example, if measurement data indicates an adverse health condition, clinicians can be alerted or notified, allowing intervention to be triggered. Additionally, population monitoring provides public health benefits, allowing for the tracking of infectious diseases, for example. Furthermore, centralized analysis allows for the use of data mining to refine the analysis process, making it more accurate as more data is collected.

[0464] However, it will be appreciated that a distributed implementation is not required, and that additionally or alternatively, the analysis can be performed in situ, for example by having the monitor device 920 and / or the client device 930 perform steps 1425-1460, with the resulting information being displayed locally, for example using the client device 930 or an integrated display.

[0465] Further examples of microstructure instrumentation and analysis techniques will now be described with reference to Figures 15A-15F.

[0466] In this example, a patch 1510 is provided that includes a substrate 1511 having several microstructures 512 thereon. It will be understood that the form and configuration of the microstructures is not important for the purposes of this example, and various configurations may be used, as discussed above.

[0467] In this example, the substrate 1511 includes a substrate coil 1515 disposed on the substrate 1511, typically on its back surface. The coil is operably coupled to one or more microstructure electrodes, which may be electrodes provided on the microstructure or the conductive microstructure itself. Typically, the substrate coil includes two ends, each coupled to a different microstructure electrode, as shown by the dotted lines, so that a signal from the substrate coil 1511 is applied between the microstructure electrodes. Excitation and receive coils (not shown) are typically provided within the housing of the measurement device so that they are aligned and proximate to the substrate coil when a measurement is to be taken, e.g., when the housing is attached to the substrate. This is done to inductively couple the excitation and receive coils to the substrate coil, so that when an excitation signal is applied to the excitation and receive coils by the signal generator, this induces a corresponding signal in the substrate coil 1515, which is then applied across the microstructure electrodes.

[0468] As shown, the microstructure electrode and the tissue and / or fluid surrounding the electrode act as a capacitor. As a result, the excitation and receiving coils and substrate coil act as a tuned circuit, an example circuit configuration is shown in FIG. 15B. This includes fixed inductance 1561 and capacitance 1562 and resistance 1563, which represent the inherent response of the excitation coil and substrate coil. The circuit also includes variable capacitance and resistance 1565, 1564, which represent the response of the microstructure electrode and the tissue or other material between the electrodes. It will therefore be appreciated that the frequency response and attenuation (Q) of the tuned circuit will vary depending on the values ​​of the variable capacitance and resistance, which in turn depend on the environment in which the microstructure electrode resides.

[0469] Generally, when a signal is applied to the excitation and receiving coils, the overall response is a constant amplitude signal in the excitation and receiving coils, as shown in FIG. 15C. When the drive signal is stopped, the circuit continues to resonate, and the resulting signal decays over time, as shown to the right of the dotted line. Because the rate and / or frequency of decay depends on the values ​​of the variable capacitance and resistance, different responses 1581, 1582 result depending on conditions within the subject, which further allows information to be derived about conditions within the subject. For example, this can be affected by analyte binding to the microstructure electrodes, fluid levels, etc., and examining changes in the decay rate and frequency can be used to derive information about the presence of analyte, fluid levels, etc.

[0470] However, because the decaying signal is transient, in another example, the response of the circuit at different frequencies is analyzed and used to determine the resonant frequency and Q-factor of the tuned circuit, which further indicate resistance and capacitance values. In this regard, changes in electrical conditions within the subject result in changes in the frequency response, as shown in Figure 15D. For example, the response in the absence of analyte may be as shown by the solid line, while the presence of analyte may result in an increase or decrease in the resonant frequency and / or Q-factor, as shown by the dotted line.

[0471] In one particular example, it is preferable to provide a control reference to allow for more accurate interpretation of the response. This example is shown in Figure 15E, where two patches 1510.1, 1510.2 are provided, each having a respective substrate 1511, microstructure 1512, and substrate coil 1515. In this example, patch 1510.2 is coated with a binding agent to attract the analyte, while patch 1510.1 is uncoated and serves as a control.

[0472] In this case, each substrate coil is driven and the modification, including signal attenuation and / or frequency or phase change, is measured, which depend on the resonant frequency and Q factor. An example of a modified drive signal is shown in FIG. 15F, where signal 1571 represents the control obtained for patch 1510.2, and signals 1571.11, 1571.12, and 1571.21, 1571.22 represent the differential responses obtained for patch 1510.2, respectively. In this regard, signals 1571.11, 1571.21 represent the signal applied without analyte, emphasizing that different patches may have different tuned frequency responses, and signals 1571.12, 1571.22 show frequency changes δ1, δ2, emphasizing that different responses may be measured, which may further be used to derive information about the level or concentration of analyte near the microstructure of second patch 1510.2.

[0473] Measurement of the frequency changes that occur in response to different analyte levels or concentrations may be performed in the frequency domain by use of a return loss bridge circuit in the excitation coil. In this manner, absorption of the rf electromagnetic signal while swept across various frequencies indicates a signal loss in decibels (dB) at the resonant frequency of the substrate coil. The frequency and depth of this absorption indicate the analyte level or concentration.

[0474] It will be appreciated that this technology allows measurements to be made regarding conditions in a subject, such as the presence, absence, level, or concentration of an analyte, to be readily determined using a patch that does not include an electronically active sensing element. It will also be appreciated that by appropriately adapting the coating, a variety of analytes can be sensed, and that it can be adapted to make other suitable measurements.

[0475] Further exemplary details of the above-mentioned equipment will now be described.

[0476] manufacturing An example process for manufacturing a substrate containing microstructures will now be described in more detail.

[0477] 17A-17P, the microstructures are fabricated from an insulating polymer that is applied to a substrate, and electrodes are patterned on the substrate through selective etching to serve as electrical connections for the polymer microstructures. It will also be appreciated that conductive polymers can also be used, for example, through appropriate doping of the insulating polymer.

[0478] In this example, the first step, shown in Figures 17A-17G, is to selectively pattern an electrode architecture on a flexible polyethylene terephthalate (PET) substrate 1701. The electrode design to define the microstructures on the PET was patterned; in this case, an indium tin oxide (ITO) 1702 layer was deposited on the flexible PET substrate, and the electrode pattern was selectively etched from the ITO layer. The substrate was prepared (Figure 17A), after which a positive photoresist, AZ1518 (MicroChemicals), was patterned on top of the ITO via photolithography (Figure 17B) and soft-baked (Figure 17C). The photoresist was selectively exposed to UV light (Figure 17D) to define the electrode pattern, after which the photoresist was baked and developed using developer AZ726MIF (MicroChemicals) (Figure 17E), and the exposed ITO areas were wet acid etched (Figure 17F). The photoresist was removed to reveal the final etched ITO pattern that provides the conductive electrodes for the device (Figure 17G).

[0479] In the second step, shown in Figures 17H–17P, 3D microstructures were fabricated on the ITO electrodes from a photosensitive polymer. The patterned PET substrate with ITO electrodes was treated with oxygen plasma (Figure 17H) to improve wetting and resist adhesion, and a seed adhesion layer 1704 of SU-8 3005 (MicroChemicals) was spin-coated onto the ITO-PET substrate (Figure 17I). After baking the seed SU-8 layer stack (Figure 17J), a SUEX SU-8 film resist 1705 (DJ MicroLaminates) was bonded to the substrate via thermal lamination (Figure 17K). After alignment through a mask aligner and exposure to UV light (Figure 17L), the exposed SU-8 regions crosslinked to form an array of rectangular microstructures 1706 with vertical wall profiles along the conductive ITO fingers 1702 (Figure 17M). The structure is baked with SU-8 1704 and SUEX 1705, then developed with PGMEA (propylene glycol monomethyl ether acetate) (Sigma Aldrich) and then hard baked (Figure 17N). A shadow mask 1708 is applied to the substrate 1701 and the microstructures 1706 are coated with gold 1707 through selective deposition (Figure 17O), after which the mask is removed (Figure 17P), leaving behind the selectively metallized microstructures that act as electrodes.

[0480] In this example, the microstructures have flat tips, but it will be appreciated that other UV lithography techniques such as grayscale lithography, backside diffraction lithography, and two-photon lithography can also be used to define tapered microstructures.

[0481] The resulting microstructure is shown in Figures 18A to 18D.

[0482] In a second example shown in Figures 19A-19L, the microstructure is fabricated by molding.

[0483] In this example, a 90 nm layer of nitride 1902 was deposited on a silicon wafer 1901 (Figure 19A). Next, AZ1505 (MicroChemicals) positive resist 1903 was spun at 4000 rpm (Figure 19B). A rectangular pattern defining the blade outline was directly written using a mask writer 1904 (Figure 19C). The written pattern was developed using AZ726MIF (MicroChemicals) for 30 seconds (Figure 19D). The nitride layer 1902 was removed using reactive ion etching (Figure 19F), followed by removal of the photoresist 1913 (Figure 19E). Next, the wafer was held vertically in an 80°C potassium hydroxide bath for 40 minutes to etch the silicon wafer along its crystallographic axes (Figure 19G). Etching stops at axis 111 to define the desired sharp tip, which will act as a mold for the further fabricated device.

[0484] OmniCoat was used as the lift-off resist and was coated onto the wafer to a thickness of approximately 20 nm using a spin recipe at 3000 RPM for 1 minute, followed by a bake at 200 °C for 1 minute. Following this, a 5-micron layer of SU8 3005 1905 was spun onto the wafer at 3000 RPM, then baked at 65 °C for 1 minute, then 95 °C for 20 seconds, and then again at 65 °C for 1 minute (Figure 19H). The thinner formulation of SU8 3005 would allow it to flow more easily into the sharp triangular gaps etched into the silicon wafer mold. Next, a layer of SU8 1900 2016 was spun onto this layer to a thickness of 200 microns using a spin recipe at 2000 RPM for 60 seconds (Figure 19I). Following this, the wafer was baked at 65 °C for 5 minutes, then 95 °C for 35 minutes, and then again at 65 °C for 5 minutes. This layer of SU8 1900 is believed to allow a sharp tip to stand on a solid layer.

[0485] Finally, the wafer was exposed to 15 mW / cm 2The structure was then flood exposed for 40 seconds using a UV source 1907 delivering a power of 1000 .mu.m (FIG. 19J). The structure was released by immersing the wafer in AZ726 developer overnight (FIG. 19K), and the wafer was exposed to a heat shock at 120° C. for 15 seconds. The structure was removed from the inverted mold and dried using nitrogen gas (FIG. 19L).

[0486] The resulting microstructures are shown in Figures 20A and 20B, and 20C and 20D.

[0487] Figures 21A and 21B show silicon blades fabricated by etching. Figure 21A shows a blade coated with a nearly 1-micron-thick layer of SU8 3005 diluted 3:2 using SU8 thinner and spun at 5000 RPM for 40 seconds. Figure 21B shows a blade whose base has been selectively coated with a polymer coating. The tip of the blade is bare, and only this area can be used for detection purposes. This selective coating is achieved by pressing the coated blade of Figure 21A against a thin layer of aluminum foil, which mechanically removes the resist from the tip of the blade. This allows the blade to be partially covered with an insulating coating, so that only the tip acts as an electrode, allowing measurements to be taken in the epidermis and / or dermis, as described above with respect to Figures 5L and 5M.

[0488] Applicable Vibrations applied to the patch can result in temporary changes in the mechanical properties of the skin surrounding the patch, resulting in reduced friction between the microstructure and the skin, increased crack propagation, and reduced applied force due to the modulation effect caused by the vibrations. As a result of these changing properties, patches applied with vibration penetrate deeper than patches without vibration when the same force is applied.

[0489] To verify this, we conducted an experiment in which patches were applied to pig ears at a quasi-static speed of 0.83 mm / s using forces ranging from 1.25 N to 40 N. Each force was tested with and without vibration. The patch was applied to the tissue under load for 10 seconds and then removed. The vibration mechanism was a z-axis vibration motor operating at 6.6 Vpp and 180 Hz, producing a vibration amplitude of 30 μm. Upon completion of the test, each test site was removed from the ear and examined by H&E staining.

[0490] Observing the following results for patch penetration at 2.5 N with and without vibration, there is evidence to suggest that adding vibration increases penetration depth. Of the six penetration sites extracted from one row of microarray structures without vibration, all six blades were able to penetrate the stratum corneum, but only one microstructure was able to penetrate the epidermis. In contrast, of the five penetration sites extracted from the sample with vibration, there is clear and significant penetration in three microstructures. Considering this, there is evidence to suggest that adding vibration increases the penetration depth of the patch at the same force compared to the patch without vibration.

[0491] Figures 22A-22F are images showing penetration of a pig's ear by a microstructure using a force of 2.5 N for 10 seconds without vibration, and only Figure 22E shows penetration of the epidermis, while Figures 22G-22K are images showing penetration of a pig's ear by a microstructure using a force of 2.5 N for 10 seconds with vibration at approximately 175 Hz, and Figures 22H, 221, and 22K show penetration of the epidermis.

[0492] In further experiments, the patch was applied to the tissue and then immediately removed, followed by the application of an aqueous solution of methylene blue (1% v / v) to the site and then the removal. 2 , 300 / cm 2 , 550 / cm 2 As shown in Figures 23A-23C, which show the results for the patch of Figure 5K, the blue dye selectively stains the areas where the stratum corneum is penetrated, indicating penetration of the microstructure throughout the patch. Figure 23D is an image showing an example of penetration of the stratum corneum for the patch of Figure 5K.

[0493] In a further example, penetration tests were performed with different configurations of microstructures and different applied forces. In this example, the microstructure density was 188 / cm 2 The force was applied with a handheld force gauge without vibration, and the patch was applied under load for 10 seconds and then removed. In this example, microstructures in the form of plates including vertical sidewalls similar to those shown in FIGS. 5A and 5B and plates including shoulders similar to those shown in FIGS. 5L and 5M were used. The results shown in FIG. 24A include microstructure 2401 with a shoulder when a force of 5 N was applied, microstructure 2402 with a shoulder when a force of 10 N was applied, microstructure 2403 without a shoulder when a force of 5 N was applied, and microstructure 2404 without a shoulder when a force of 10 N was applied.

[0494] As shown, all blades are shown to penetrate to a depth of 10 μm at a force of 5 N or 10 N. At an applied force of 5 N, 60% of the shouldered blades penetrate to 50 μm and no shouldered blades penetrate to 100 μm, compared to 100% and 90% of the vertical sidewall blades at 50 μm and 100 μm, respectively.

[0495] At an applied force of 10 N, 100% of the blades of either configuration penetrate to 50 μm, but only 15% of the shouldered blades penetrate to 100 μm, whereas 100% of the blades with vertical sidewalls penetrate.

[0496] This indicates both that a relatively small amount of force is required to apply the microstructures and that the presence of the shoulders can be used to control the degree of penetration into the epidermis.

[0497] In another experiment, the penetration of microstructures by applying a constant force (2.5 N) with or without vibration was compared. The results, shown in Figure 24B, indicate that vibration helps increase penetration depth.

[0498] water retention An example of the use of microstructures in measuring water retention will now be described.

[0499] In this regard, research suggests that there is a strong correlation between performance level and dehydration, measured as a %Δ of body weight, with significant dehydration occurring when body weight loss exceeds 2%. Evidence suggests that dehydration adversely affects high-intensity muscular endurance, strength, and power. Furthermore, there is a relationship between decreased strength and power and the likelihood of injury, suggesting that being able to accurately measure hydration could be beneficial for athletes, especially in high-risk sports.

[0500] An experiment was conducted to measure the water retention of porcine skin using a microstructure impedance-based approach. In this example, the tissue was measured at a nominal "fresh" water retention point and then dehydrated by applying a heating plate at a set point of 38 °C. The volume of the tissue block was measured by the displacement method at the beginning and end of the experiment. It was assumed that all mass changes were due to evaporative water loss from the excised tissue.

[0501] Time series data for impedance measured at 200 Hz are shown in Figure 25A, where the secondary axis represents the concurrent estimate of water content derived from the measured mass and volume measurements. The inverse correlation between impedance and water content is as expected, with the primary rate of water loss reflected in changes in measured impedance.

[0502] This indicates that the microstructure patch is well engaged and capable of measuring the water loss of the sample with a sufficient level of accuracy. Therefore, this architecture is a solid foundation for the development of electrically interfaced microstructure patches, as demonstrated in water retention sensing.

[0503] Human water loss and hydration experiments were conducted to examine the ability of the above-described device to assess body water loss (and gain) through interstitial fluid investigations in the living epidermal layer...

Claims

1. 1. A system for performing measurements on a living subject, comprising: a) at least one substrate comprising a plurality of plate microstructures configured to penetrate the stratum corneum of the subject; b) at least one sensor operatively connected to the at least one microstructure and configured to measure a response signal from the at least one microstructure; c) i) determining a measured response signal; ii) (1) providing an output based on the measured response signal; (2) at least partially analyzing the measured response signal; and (3) storing data at least partially indicative of the measured response signal; Do at least one of the following: one or more electronic processing devices configured to A system including:

2. The system includes a signal generator operably connected to the at least one microstructure for applying a stimulation signal; the one or more processing devices a) controlling the signal generator to perform measurements; and b) controlling said signal generator in accordance with the measured response signal. The system of claim 1 configured to perform at least one of the following:

3. 3. The system of claim 2, wherein the response signal and the stimulus signal comprise electrical signals, and the substrate comprises electrical connections that enable electrical signals to be applied to and / or received from each microstructure.

4. the system includes one or more switches for selectively connecting at least one of the at least one sensor and the at least one signal generator to one or more of the microstructures; the one or more processing devices a) enabling at least one measurement to be taken; and b) Controlling which microstructures are used to measure response signals / apply stimuli The system according to any one of claims 1 to 3, configured to control the switch for at least one of:

5. The response signal is a) fluid level, b) visualization; c) mapping; d) mechanical properties; e) force; f) pressure; g) muscle exercise; h) blood pulse wave; i) the presence, absence, level or concentration of an analyte; j) blood oxygen saturation; k) tissue inflammatory conditions; l) bioimpedance; m) biocapacitance; n) bioconductance, and o) Electrical signals in the body The system according to any one of claims 1 to 4, further comprising at least one of:

6. The system of any one of claims 1 to 5, wherein the plate microstructure is at least partially tapered and has a substantially rounded rectangular cross-sectional shape.

7. applying the microstructures to the skin of the subject; a) at least some of the microstructures are i) penetrating the stratum corneum; ii) enter the viable epidermis but not the dermis, and iii) Enter the dermis At least one of b) at least some of the microstructures are i) (1) Less than 2500 μm, (2) Less than 1000 μm, (3) Less than 750 μm, (4) Less than 450 μm, (5) less than 300 μm, (6) Less than 250 μm, (7) Approximately 250 μm, (8) Approximately 150 μm, (9) More than 100 μm, (10) greater than 50 μm; and (11) More than 10 μm the length of at least one of ii) (1) Less than 2500 μm, (2) Less than 1000 μm, (3) Less than 750 μm, (4) Less than 450 μm, (5) less than 300 μm, (6) Less than 250 μm, (7) A size similar to the above length; (8) greater than the length; (9) greater than the length; (10) Approximately the same length as the above-mentioned length, (11) Approximately 250 μm, (12) about 150 μm, and (13) More than 50 μm the maximum width of at least one of the iii) (1) smaller than the width; (2) significantly smaller than said width; (3) a size smaller than the length; (4) Less than 300 μm, (5) less than 200 μm, (6) less than 50 μm, (7) about 25 μm, and (8) More than 10 μm At least one of the maximum thicknesses The system according to any one of claims 1 to 6, comprising at least one of the following:

8. At least some of the microstructures include electrodes; At least one electrode is a) extending the length of a distal portion of the microstructure; b) extending the length of a portion of the microstructure spaced from the tip; c) disposed proximate the distal end of the microstructure; d) positioned adjacent to the tip of the microstructure; e) extending over at least 25% of the length of the microstructure; f) extending over less than 50% of the length of the microstructure; g) extending across about 60 μm of the microstructure; h) configured to be placed within the living epidermis of the subject in use; and i) i) 200,000μm ２ less than, ii) Approximately 22,500 μm ２ , and iii) at least 2,000 μm ２ having a surface area that is at least one of The system according to any one of claims 1 to 7, wherein the system is at least one of the following:

9. At least some of the microstructures are arranged in groups; a) a response signal is measured between the microstructures in the group; and b) A stimulus is applied between the microstructures in the group. The system according to any one of claims 1 to 8, wherein the system is at least one of the following:

10. the one or more microstructures interact with one or more analytes of interest such that a response signal is dependent on the presence, absence, level or concentration of the analyte of interest; Optionally, the analyte interacts with a coating on the microstructure to change the electrical and / or optical properties of the coating, thereby enabling the analyte to be detected.

11. At least some of the microstructures are at least partially coated with a coating; Alternatively, a) at least some of the microstructures are not coated; b) at least some of the microstructures are porous and include an inner coating; c) at least some of the microstructures are partially coated; d) different microstructures have different coatings; e) different portions of the microstructure include different coatings; f) at least some of the microstructures include a plurality of coatings; and g) at least some of said microstructures are coated with a selectively dissolvable coating. The system according to any one of claims 1 to 10, wherein the system is at least one of the following:

12. The system includes an actuator configured to apply a force to the substrate to at least one of pierce and penetrate the stratum corneum; a) the actuator, i) an electromagnetic actuator; ii) a vibration motor; iii) a piezoelectric actuator; and iv) Mechanical Actuators At least one of b) the actuator i) biasing force; ii) vibration forces, and iii) One continuous force The system according to any one of claims 1 to 11, configured to add at least one of:

13. the one or more electronic processing devices a) analyzing the measured response signal to determine at least one indicator that is at least partially indicative of a physiological status associated with the subject; b) analyzing the measured response signal to determine at least one metric, and using the at least one metric to determine at least one indicator, the at least one indicator being at least partially indicative of a physiological status associated with the subject; fitting the at least one metric to at least one computational model to determine the indicator, the at least one computational model embodying a relationship between a health status and the at least one metric, obtained by applying machine learning to a reference metric derived from subject data measured on one or more reference subjects; and c) i) the presence, absence or severity of a medical condition; ii) prognosis related to a medical condition; iii) the presence, absence, level or concentration of a biomarker; iv) the presence, absence, level or concentration of an analyte; v) fluid levels in the subject; vi) blood oxygenation, and vii) Bioelectrical Activity determining a physiological status indicative of at least one of The system according to any one of claims 1 to 12, wherein the system is at least one of the following:

14. The system includes a monitor device and a patch including the substrate and the microstructure; a) the monitoring device, i) inductively coupled to said patch; ii) attached to said patch; and iii) contacting the patch when a reading is to be taken; and b) the monitoring device is i) causing a measurement to be taken; ii) at least partially analyzing the measurements; iii) controlling a stimulus applied to the at least one microstructure; iv) generating an output; v) providing an output indicative of said indicator; vi) providing recommendations based on said indicators; and vii) Causing an action to be taken configured to perform at least one of The system according to any one of claims 1 to 13, wherein the system is at least one of the following:

15. The system comprises: a) a wearable monitor device for performing said measurements; b) i) receiving target data derived from said measured response signals; ii) analyzing the subject data to generate at least one index, the at least one index being at least partially indicative of a physiological status associated with the subject; Processing system and The system according to any one of claims 1 to 14, comprising:

Images