Use of a bacterial carboxylase reductase for producing terephthalaldehyde

The use of a Segniliparus rugosus-derived CAR enzyme efficiently converts terephthalic acid to terephthalaldehyde, addressing inefficiencies and environmental concerns in existing production methods, offering a sustainable and safe bioproduction process.

WO2026074077A1PCT designated stage Publication Date: 2026-04-09MICHELIN & CO (CIE GEN DES ESTAB MICHELIN)
View PDF 12 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-10-02
Publication Date
2026-04-09

AI Technical Summary

Technical Problem

Current methods for producing terephthalaldehyde involve chemical processes that generate hazardous byproducts, require high temperatures and pressures, and use costly catalysts, while bioproduction methods using existing enzymes are inefficient and rely on petrochemical substrates, lacking sustainability and safety.

Method used

Utilizing a carboxylase reductase (CAR) from Segniliparus rugosus with at least 80% identity to SEQ ID NO:2 to convert terephthalic acid into terephthalaldehyde in vitro, using a bacterial phosphopantetheinyl transferase for activation, and employing optimized nucleic acid molecules and host cells for efficient production.

Benefits of technology

This approach provides a sustainable and safe method for producing terephthalaldehyde with high efficiency, avoiding hazardous chemicals and high-energy conditions, using a renewable substrate and minimizing environmental impact.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure EP2025078319_09042026_PF_FP_ABST
    Figure EP2025078319_09042026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to the use of a carboxylase reductase (abbreviated to "CAR") comprising an amino acid sequence having at least 80% identity to SEQ ID NO: 2 for producing terephthalaldehyde (abbreviated to "TPAL") from terephthalic acid (abbreviated to "TPA"), associated methods for producing TPAL, as well as nucleic acids, vectors and host cells for the production of the CAR or TPAL from TPA.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] DESCRIPTION

[0002] USE OF A BACTERIAL CARBOXYLASE REDUCTASE TO PRODUCE TEREPHTHALALDEHYDE

[0003] FIELD OF INVENTION

[0004] The present invention relates to the fields of microbial biochemistry and more particularly to the synthesis of terephthalaldehyde by microbial enzymes. It concerns the use of a carboxylase reductase (CAR) comprising an amino acid sequence with at least 80% identity to SEQ ID NO:2 to produce terephthalaldehyde (abbreviated as "TPAL") from terephthalic acid (abbreviated as "TPA"), an associated in vitro method for producing TPAL, as well as nucleic acids, vectors, and host cells for the production of such a CAR.

[0005] STATE OF THE ART

[0006] Terephthalaldehyde (TPAL) is used in various fields. It primarily serves as an intermediate in the preparation of optical brighteners and in the synthesis of photopolymers. It is also used in cosmetics for hair coloring.

[0007] Currently, terephthalaldehyde is produced primarily through chemical processes. Generally, the synthesis reaction involves the radical halogenation of p-xylene [US2446430], followed by controlled oxidation of the halogenated p-xylene to yield terephthalaldehyde [US4465865, US2948756]. The overall molar yield is 70–80%, and the purity of the terephthalaldehyde is 98%. These chemical reactions generate numerous byproducts, such as chlorinated effluents, which must be treated before being released into the environment or require the use of costly catalysts.

[0008] However, two alternative routes for the synthesis of terephthalaldehyde are under development. In the more mature route, developed at pilot scale [W02008075901], the synthesis reaction is characterized by the direct oxidation of p-xylene via heterogeneous tungsten oxide-based catalysts. The conversion of p-xylene to terephthalaldehyde is 60 to 80 mol⁻¹, and the selectivity is 58 mol⁻¹. This route does not present major Health, Safety, and Environment (HSE) risks. However, the reaction takes place under high-temperature conditions (over 350°C), the synthesis of the heterogeneous catalysts requires high-temperature calcination for several hours, and there are risks of product and catalyst degradation.

[0009] A second alternative route for the synthesis of terephthalaldehyde involves reducing terephthalic acid (TPA) or dialkyl terephthalate to terephthalaldehyde using chemical catalysts. The reduction of terephthalic acid to terephthalaldehyde is characterized by dehydration followed by hydrogenation in the presence of a palladium-based catalyst [JP20000229897]. The yield is 68 mol%. The reduction of dialkyl terephthalate is carried out in the presence of hydrogen and a heterogeneous catalyst based on Mn, Zr, or Y oxide [CN107303486]. The best yield obtained is 87–88 mol%. This route does not present major HSE risks. However, it is still in its early stages (examples have been carried out on a gram scale), requires high temperature and pressure (> 320°C, 1 MPa), and the use of expensive catalysts.

[0010] It has been suggested that terephthalaldehyde can be produced from p-xylene by biochemical means. In one case, p-xylene was converted to p-xylylene glycol and two coproducts, hydroxymethylbenzaldehyde and terephthalaldehyde, using a modified microorganism producing xylene monooxygenase [JP2004008149]. In the second case, the existence of a theoretical metabolic pathway in the bacterium E. coli to convert p-xylene to terephthalaldehyde (without using terephthalic acid (TPA) as an intermediate) via the action of a series of enzymes was documented by Baudoin Delépine, et al. 2018. However, in the first case, terephthalaldehyde is only a coproduct. In the second case, several steps involving multiple enzymes are required.Moreover, in both cases, the starting product is p-xylene, which is a petrochemical substrate that does not allow for the implementation of a sustainable process for the synthesis of terephthalaldehyde.

[0011] There is therefore a need for other methods of bioproducing terephthalaldehyde from a substrate available in unlimited quantities and which are part of a more sustainable approach, healthier for human health and more environmentally friendly and which implement a small number of energy- and / or reagent-intensive steps.

[0012] Terephthalic acid is a potentially bio-based monomer (it can be produced from the transformation of sugars by microorganisms, making it a renewable substrate within a human lifespan) or derived from the depolymerization of polyethylene terephthalate (PET), and is therefore available in unlimited quantities compared to fossil-based raw materials. Thus, the production of terephthalaldehyde from terephthalic acid could be considered a sustainable approach within a circular economy.

[0013] Furthermore, obtaining terephthalaldehyde from terephthalic acid via biological routes would not present any major HSE risks compared to the conventional and unconventional routes explained above: no hazardous reagents used (gaseous chlorine, nitric acid), no harmful co-products generated (gaseous hydrochloric acid), no synthesis of heterogeneous catalysts requiring high-temperature calcination, and no reaction conditions requiring high temperature and pressure.

[0014] CARboxylase Reductases (CARs) are the only known enzymes capable of converting aromatic carboxylic acids into their corresponding aldehydes [Aditya M. Kunjapur et al. 2015]. They have notably been shown to convert vanillic acid into vanillin and benzoic acid into benzaldehyde [Aditya M. Kunjapur et al. 2015]. Benzoic acid and vanillic acid have historically been the most frequently used substrates to demonstrate that an enzyme has CAR activity [Margit Winkler et al. 2022]. Bayer et al. [Thomas Bayer, et al. 2022] described the transformation of Escherichia coli bacteria by a plasmid encoding the CAR of Mycobacterium marinum (CAR). Mm ) and the phosphopantetheinyl transferase of Nocardia iowensis (PPT Ni The authors suggest that the CAR Mmenabled the conversion of terephthalic acid (TPA) to terephthalaldehyde (TPAL) in cellulo. However, this conversion is not very efficient, since even with the most efficient Escherichia coli strain, 75% of unconverted terephthalic acid (TPA) was still present after 24 hours.

[0015] Gopal et al. and WO2023215742A2 tested 17 CARs for their ability to reduce terephthalic acid (TPA), 4-formylbenzoic acid (4FBA), mono-(2-hydroxyethyl)-terephthalic acid (MHET), monomethyl terephthalate (mmTPA), and para-(aminomethyl)benzoic acid (pAMBA). Three of the 17 tested CARs had no significant TPA-reducing activity, and 10 had weak TPA-reducing activity (less than 20% of the activity of the Segniliparus rotundus CAR).

[0016] The substrate spectra of CARs are indeed very varied, but specific to each CAR, as confirmed by Winkler (2018) Curr Opin Chem Biol 43:23-29. Moreover, as highlighted by Finnigan et al. (2017) ChemCatChem 9: 1005-1017, the activity of the same CAR will not be identical for an aromatic substrate compared to a linear substrate, or for a substrate with two carboxylic functions compared to one.

[0017] Therefore, it is not possible to predict whether a newly identified CAR will be able to convert TPA to TPAL, let alone with good activity.

[0018] Therefore, there is a need to identify new CARs capable of converting TPA to TPAL with good activity. The present invention addresses this problem.

[0019] DESCRIPTION OF THE INVENTION

[0020] Within the scope of the present invention, the inventors have shown that a CAR (Carbohydrate Extraction Receptor) from Segniliparus rugosus is capable of converting terephthalic acid (TPA) to terephthalaldehyde (TPAL) with good activity compared to some CARs described in Gopal et al. and WO2023215742A2, and can therefore be used to produce terephthalaldehyde (TPAL) in vitro from terephthalic acid (TPA). This TPAL production strategy has numerous advantages, such as the use of a raw material (TPA) that is available in large quantities in a sustainable manner, and the absence of major Health, Safety, and Environment (HSE) risks.

[0021] Thus, the present invention relates to the use of a carboxylase reductase (CAR) comprising, essentially consisting of, or consisting of an amino acid sequence having at least 80% identity with SEQ ID NO:2 for producing terephthalaldehyde (TPAL) from terephthalic acid (TPA). Production preferably takes place in vitro.The present invention also relates to an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a carboxylase reductase comprising, essentially consisting of or consisting of an amino acid sequence having at least 80% identity with SEQ ID NO:2, characterized in that: a) the isolated nucleic acid molecule further comprises a promoter controlling the expression of the nucleic acid sequence; or b) the isolated nucleic acid molecule further comprises a transcription terminator controlling the expression of the nucleic acid sequence; or c) the nucleic acid sequence is further optimized for expression in a host cell, in particular a fungus (such as yeast or a fungus) or a bacterium; or d) any combination of a) to c).

[0022] The present invention also relates to an isolated nucleic acid molecule or a combination of two isolated nucleic acid molecules comprising: a) a nucleic acid sequence encoding a carboxylase reductase (CAR) comprising, essentially consisting of, or consisting of an amino acid sequence having at least 80% identity with SEQ ID NO:2; and b) a nucleic acid sequence encoding a bacterial phosphopantetheinyl transferase (PPT).

[0023] The present invention also relates to a vector or a combination of two vectors comprising an isolated nucleic acid molecule or a combination of two isolated nucleic acid molecules according to the invention.

[0024] The present invention also relates to a host cell comprising an isolated nucleic acid molecule or a combination of two isolated nucleic acid molecules according to the invention or a vector or a combination of two vectors according to the invention.

[0025] The present invention also relates to the use of a nucleic acid molecule, a vector or a host cell according to the invention as described above to produce a CAR comprising, essentially made up of or made up of an amino acid sequence having at least 80% identity with SEQ ID NO: 2.

[0026] The present invention also relates to a method for producing a CAR comprising, essentially consisting of, or consisting of an amino acid sequence having at least 80% identity with SEQ ID NO: 2, wherein the method comprises, is essentially consisting of, or is consisting of:

[0027] (ii) the culture of a host cell according to the invention in a culture medium under conditions permitting the expression of the nucleic acid molecule(s) or vector(s) contained in said host cell, so as to produce said CAR.

[0028] The present invention also relates to a method for producing terephthalaldehyde (TPAL) in vitro, comprising the steps of:

[0029] (iil) contacting in a terephthalic acid (TP A) reaction medium with a carboxylase reductase comprising essentially or consisting of an amino acid sequence having at least 80% identity with SEQ ID NO:2, the carboxylase reductase being activated by a bacterial phosphopantetheinyl transferase (PPT) or the reaction medium further comprising a bacterial phosphopantetheinyl transferase (PPT);

[0030] (iiil) the incubation of the reaction medium from step (iil) under suitable conditions to produce terephthalaldehyde (TPAL);

[0031] (ivl) optionally, the recovery of the reaction medium comprising the terephthalaldehyde (TPAL) obtained after step (iiil); and

[0032] (vl) optionally, the purification of terephthalaldehyde (TPAL) from the reaction medium recovered in step (ivl).

[0033] DESCRIPTION OF THE FIGURES

[0034] Figure 1 shows an SDS-PAGE gel containing CAR enzymes purified in vitro after production in E. coli. 2.25 μL of each CAR enzyme is independently loaded onto the gel. The CARs are easily identifiable by their size of approximately 130 kDa.

[0035] CAR A1 corresponds to the CAR of purified Mycobacterium marinum

[0036] CAR A2 corresponds to purified Segniliparus rugosus CAR.

[0037] CAR A3 corresponds to the purified CAR of Nocardia iowensis.

[0038] CAR A7 corresponds to the CAR of purified Mycobacteroides salmoniphilum.

[0039] DETAILED DESCRIPTION OF THE INVENTION

[0040] The invention is described in more detail below.

[0041] Definitions

[0042] The terms "a" or "an" refer to one or more. In other words, when "a" or "an" is used with respect to a feature, it covers both embodiments with a single instance of the feature of interest and those with multiple instances of the feature of interest. In other words, unless otherwise specified (such as "only one" or "just one"), "a" is used synonymously with "one or more" or "at least one." In this document, when used to define products, compositions, and methods, the terms "comprising" (and any form of "comprising," such as "includes"), "having" (and any form of "having," such as "has"), "including" (and any form of inclusion, such as "includes"), or "containing" (and any form of "containing," such as "contains") are open-ended and do not exclude additional, unmentioned method elements or steps.Thus, a polypeptide "comprises" an amino acid sequence when that amino acid sequence is part of the final amino acid sequence of the polypeptide. Such a polypeptide can have up to several hundred additional amino acid residues. "Consisting essentially of" or "made up of" means the exclusion of other components or steps of any essential importance. Therefore, a polypeptide "consists essentially of" an amino acid sequence when such an amino acid sequence is present, possibly with only a few additional amino acid residues (for example, a peptide of at most 20 amino acids, such as a 6-histidine tag Hisx6, may also be present). "Consisting of" or "made up of" means excluding more than trace amounts of other components or steps.For example, a polypeptide "consists of" an amino acid sequence when the polypeptide contains no other amino acids than the stated amino acid sequence.

[0043] By "te-rephthalic acid", "paraphthalic acid" or "benzene-1,4-dicarboxylic acid" (abbreviated as "TPA"), we mean a compound of CAS No. 100-21-0 and formula (I):

[0044] By "terephthalaldehyde" or "benzene-1,4-dicarboxaldehyde" (abbreviated as "TPAL"), we mean a compound of CAS No. 623-27-8 and formula (II):

[0045] An enzyme is a protein with catalytic properties. An enzyme acts by lowering the activation energy of a chemical reaction, thereby increasing the reaction rate. The enzyme itself is not altered during the reaction. The initial molecules are the enzyme's substrates, and the molecules formed from these substrates are the reaction products. Enzymes are characterized by their very high specificity. Furthermore, an enzyme has the unique ability to be reused. Enzymes are generally globular proteins that act alone or in complexes of several enzymes or subunits. Like all proteins, enzymes consist of one or more polypeptide chains folded to form a three-dimensional structure corresponding to their native state. Enzymes are molecules much larger than their substrates. Their size can range from about fifty residues to more than 2,000 residues.Only a very small portion of the enzyme—usually between two and four residues, sometimes more—is directly involved in catalysis; these constitute what is called the catalytic site (or catalytic domain). The catalytic site is most often located near one or more binding sites, where the substrate(s) are bound and oriented to catalyze the chemical reaction. The catalytic site and the binding site(s) together form the active site of the enzyme.

[0046] The term "enzymatic activity," "catalytic activity," or simply "activity" of an enzyme refers to its efficiency in converting a substrate into a product within a given environment. Enzyme efficiency encompasses both the rate at which the enzyme converts the substrate into a product and the conversion rate. The "substrate-to-product conversion rate" refers to the ratio of the amount of final product obtained to the initial amount of substrate for a given quantity of enzyme. For example, enzymatic activity as defined in this invention can be expressed as the amount of TPAL produced in a given volume (in g / L).By “carboxylase reductase” or “carboxylic acid reductase” “CAR”, we mean an enzyme capable of converting a carboxylic acid into an aldehyde by consuming adenosine triphosphate (ATP) and nicotinamide adenine dinucleotide phosphate in reduced form (NADPH) and producing adenosine monophosphate (AMP), pyrophosphate (PP) and nicotinamide adenine dinucleotide phosphate in oxidized form (NADP+) as by-products. CARs are classified in subcategory EC 1.2.1.30 of the Enzyme Commission nomenclature published by the International Union of Biochemistry and Molecular Biology in 2018. The structure of CARs consists of 3 domains: the A domain (or adenylation domain), the T domain (or transthiolation domain) and the R domain (or reduction domain) [Holly Stolterfoht, et al. 2016; William Finnigan, et al.].For a CAR to be active (i.e., to be able to reduce a carboxylic acid substrate to the corresponding aldehyde product), a phosphopantetheinyl residue must be attached to a conserved serine amino acid from its T domain by a phosphopantetheinyl transferase [William Finnigan, et al. 2017].

[0047] Phosphopantetheinyl transferase (abbreviated as "PPT") is understood to be a Mg-dependent enzyme. 2+ capable of transferring the essential prosthetic group 4'phosphopantetheine from coenzyme A (CoA) to a conserved serine residue within a motif in the T domain of CARs. PPTs are classified in subcategory EC 2.7.8.7 of the Enzyme Commission nomenclature published by the International Union of Biochemistry and Molecular Biology in 2018.

[0048] "In vivo" refers to research conducted within a living organism, that is, an approach performed within a whole, living, multicellular organism. In contrast, "in cellulo" and "in vitro" approaches are conducted outside of a whole, living, multicellular organism. Research performed on isolated organs, tissues, cells, cell components, proteins, enzymes, or biomolecules is therefore not included in the "in vivo" approach. "In cellulo" refers to research conducted within a single cell, outside of a whole, living, multicellular organism. This term designates an approach performed with one or more cells, eukaryotic or prokaryotic, outside of a whole, living, multicellular organism.This includes approaches performed in an isolated organ, isolated cellular tissue or in isolated cells, but not approaches in isolated cell components or with isolated proteins, isolated enzymes, or isolated biomolecules.

[0049] By "in vitro," we mean outside of a whole living multicellular organism and outside of a single cell. The term "in vitro" therefore includes approaches using isolated cell components or isolated proteins, enzymes, or biomolecules, but excludes all the approaches described above for "in cellulo" and "in vivo."

[0050] A prokaryote is a single-celled microorganism whose cellular structure does not include a nucleus. Prokaryotes include the kingdoms of bacteria (also called eubacteria) and archaea (sometimes called archaebacteria).

[0051] The kingdom of bacteria includes several divisions (also called phyla), including those of Pseudomonadota (also formerly called "Proteobacteria" or "Proteobacteria"), Bacillotci (also formerly called "Firmicutes"), and Actinomycetota (also called "Actinomycetes").

[0052] The division Pseudomonadota includes, in particular, the class Gammaproieobacieria, which itself includes the genera Pseudomonas (which notably includes the species Pseudomonas putida, Pseudomonas nitroreducens, and Pseudomonas chloraphis), Klebsiella (which notably includes the species Klebsiella aerogenes), Enterobacter (which notably includes the species Enterobacter hormaechei), and Serratia (which notably includes the species Serratia marcescens).

[0053] The division Bacillota includes in particular the class Bacilli, which itself includes in particular the genera Bacillus (which notably includes the species Bacillus subtilis) and Tepidibacillus (which notably includes the species Tepidibacillus fermentons).

[0054] The division Actinomycetota includes in particular the class Actinomycetes, which itself includes in particular the genera Corynebacterium (which notably includes the species Cornebacterium glutamicum), Rhodococcus (which notably includes the species Rhodococcus rhodochrous), Nocardia (which notably includes the species Nocardia iowensis), Amycolatopsis (which notably includes the species Amycolatopsis mediterranei), Segniliparus (which notably includes the species Segniliparus rugosus and Segniliparus rotundus), and Mycobacteroides (which notably includes the species Mycobacteroides salmoniphilum and Mycobacteroides immunogenum).

[0055] The adjective "bacterial," when used to describe an enzyme, refers to an enzyme naturally expressed by a bacterium that has not been genetically modified in the laboratory or a mutant of such an enzyme. "Eukaryote," as opposed to prokaryotes, refers to any unicellular or multicellular organism whose cells possess a structured nucleus. Eukaryotes are divided into several kingdoms: protists, fungi, plants, and animals.

[0056] The term "fungus" refers to a unicellular or multicellular organism of the kingdom Fungi. This kingdom includes several divisions (also called phyla), including that of the Ascomycetes, also called higher fungi, that is to say, those with septate mycelium.

[0057] The Ascomycetes division comprises several subdivisions, including Pezizomycotina, which includes filamentous fungi (i.e., fungi that have a cottony appearance during their growth). This subdivision notably includes the Trichocomacecia family, which itself includes the genus Aspergillus. The genus Aspergillus includes the species Aspergillus tanneri, Aspergillus aculecitus (particularly strains ATCC 16872 / CBS 172.66 / WB 5094), Aspergillus arachidicola, Aspergillus awamori, Aspergillus bertholletiae, Aspergillus bombycis, Aspergillus brasiliensis (particularly strains CBS 101740 / IMI 381727 / IBT 21946), Aspergillus caelatus, and Aspergillus caudousius. Aspergillus homomorphus (especially strain CBS 101889), Aspergillus leporis, Aspergillus luchuensis (especially strain CBS 106.47), Aspergillus minisclerotigenes, Aspergillus niger (especially strains ATCC 1015 / CBS 113.46 / FGSC Al 144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7, CBS 513.88 / FGSC A1513), Aspergillus nomiae NRRL 13137, Aspergillus novoparcisiticus , Aspergillus oryzae (including strains ATCC 42149 / RIB 40), Aspergillus parasiticus (including strains ATCC 56775 / NRRL 5862 / SRRC 143 / SU-1), Aspergillus pseudonomiae, Aspergillus pseudoiamarii. Aspergillus steynii IBT 23096, Aspergillus iamarii. Aspergillus uvarum CBS 121591, Aspergillus violaceofuscus (including strain CBS 115571), and Aspergillus welwitschiae.

[0058] La division des Ascomycètes comprend également les sous-divisions Taphrinomycotina et Saccharomycotina.

[0059] The subdivision Saccharomycotina comprises the order Saccharomycetales (budding yeasts), which includes the genera Saccharomyces (including, notably, the species Saccharomyces cerevisiae, Saccharomyces houlardii, Saccharomyces douglasii, and Saccharomyces hayanus), Candida, Eremothecium, Dekkera (including, notably, the species Dekkera hrucelensis and Dekkera intermedia), Pichia (Hansenula), Deharyomyces, Lodderomyces, Yarrowia, Zigosaccharomyces (including, notably, the species Zigosaccharomyces hailii), Torulaspora (including, notably, the species Torulaspora glohosa and Torulaspora glahrata), Kluyveromyces (including, notably, the species Kluyveromyces themotolerens), and Brettanomycces (including, notably, the species Brettanomycces custersii and Brettanomycces intermedius).

[0060] The subdivision Taphrinomycotina includes the class Schizosaccharomycetes (yeasts that reproduce by fission, notably including the genus Schizosaccharomyces, which notably includes the species Schizosaccharomyces pombe). The kingdom Fungi also includes the division Basidiomycota, which includes the yeast genera Cryptococcus and Malassezia.

[0061] By "isolated molecule" is meant a molecule, including a protein, polypeptide, peptide, nucleic acid molecule, plasmid vector, viral vector or host cell, which is extracted from its natural environment (i.e. separated from at least one other component with which it is naturally associated).

[0062] The terms "polypeptide," "protein," and "peptide" refer to polymers of amino acid residues comprising at least nine amino acids linked by peptide bonds. The polymer may be linear, branched, or cyclic. The polymer may comprise natural amino acids and / or amino acid analogs and may be interrupted by non-amino acid residues. As a general guideline, and not limited to this application, if the amino acid polymer contains more than 50 amino acid residues, it is preferably called a polypeptide or a protein, whereas if the polymer consists of 50 amino acids or fewer, it is preferably called a "peptide."

[0063] The term "nucleic acid molecule" refers to a polymer of any length of deoxyribonucleic acid (DNA), or polydeoxyribonucleotides, including complementary DNA (cDNA), genomic DNA, plasmids, vectors, viral genomes, isolated DNA, probes, primers, and any mixture thereof; or a polymer of any length of ribonucleic acid (RNA), or polyribonucleotides, including messenger RNA (mRNA), antisense RNA; or mixed polyribo-polydeoxyribonucleotides. These include single- or double-stranded, linear or circular, natural or synthetic polynucleotides. Furthermore, a polynucleotide may contain non-natural nucleotides and may be interrupted by non-nucleotide components.

[0064] In the context of the present invention, the terms "nucleic acid", "nucleic acid molecule", "polynucleotide" and "nucleotide sequence" are used interchangeably.

[0065] A "mutant" of a polypeptide or nucleic acid molecule is defined as a polypeptide or nucleic acid molecule containing one or more mutations relative to a reference amino acid or nucleic acid sequence. Mutations may include substitutions (replacement of one amino acid or nucleic acid with another amino acid or nucleic acid), deletions (removal of one or more amino acids or nucleic acids from one end or within the reference sequence), and / or insertions (addition of one or more amino acids or nucleic acids to one end or within the reference sequence).

[0066] A mutant of a reference polypeptide preferentially retains the activity of the reference polypeptide. In the case of an enzyme, a mutant preferentially retains the enzymatic activity of the reference enzyme.

[0067] Conservative substitution refers to the replacement of an amino acid residue in a protein with an equivalent amino acid residue of a different type, meaning one with similar physicochemical properties (molar mass, electrical charge, functional groups, hydrophobicity, etc.). Table 1 below provides examples of equivalent amino acids that can be used in conservative substitutions.

[0068] [Table 1]

[0069] A "tag peptide" is a short sequence of amino acids (typically 2 to 25 amino acids) fused to another polypeptide. This allows for the detection of the polypeptide's presence or facilitates its purification or solubilization. Examples of such tag peptides are described in Kimple et al. [Kimple ME, et al. 2013] and presented in Table 2 below. [Table 2]

[0070] By "identity" is meant an exact sequence match between two polypeptides or two amino acid molecules. The "percentages of identity" referred to in the description of the present invention are determined on the basis of a global alignment of the sequences (nucleic or protein) to be compared, that is, on an alignment of the sequences taken in their entirety along their full length using any algorithm well known to those skilled in the art, such as the Needleman and Wunsch algorithm [Needleman and Wunsch. J. Mol. Biol. 48,443-453, 1970]. This sequence comparison can be performed using any software well known to those skilled in the art, for example, the "Needle" software, using the "Gap open" parameter equal to 10.0, the "Gap extend" parameter equal to 0.5, and a "Blosum 62" matrix. The Needle software, for example, is available on the website ebi.ac.uk worldwide under the name "Align".

[0071] The term "vector" refers to a vehicle, preferably a nucleic acid molecule or a viral particle, that contains the elements necessary to enable the administration, propagation, and / or expression of one or more nucleic acid molecules in a host cell or organism. From a functional perspective, this term encompasses maintenance vectors (cloning vectors), expression vectors in various host cells or organisms (expression vectors), extrachromosomal vectors (e.g., multicopy plasmids), and integration vectors (e.g., designed to integrate into the genome of a host cell and produce additional copies of the nucleic acid molecule it contains when the host cell replicates).This term also encompasses shuttle vectors (e.g., functioning in both prokaryotic and / or eukaryotic hosts) and transfer vectors (e.g., for the transfer of nucleic acid molecule(s) into the genome of a host cell).

[0072] From a structural point of view, the vectors according to the invention can be natural, synthetic, or artificial genetic sources, or a combination of natural and artificial genetic elements. Thus, in the context of the invention, the term "vector" should be understood broadly to include plasmid (or plasmid) and viral vectors.

[0073] A "plasmid," as used here, refers to a replicable DNA construct. Plasmid vectors typically contain selection marker genes that allow host cells carrying the plasmid to be identified and / or selected positively or negatively in the presence of the compound corresponding to the selection marker. A variety of positive and negative selection marker genes are known in this technique. For example, an antibiotic resistance gene can be used as a positive selection marker gene to select a host cell in the presence of the corresponding antibiotic.

[0074] The term "viral vector" as used here refers to a nucleic acid vector that includes at least one element of a viral genome and can be packaged into a viral particle. Viral vectors can be replication-competent or selective (e.g., engineered to replicate best or selectively in specific host cells), or they can be genetically inactivated so as to be defective or deficient for replication.

[0075] A "host cell" is defined as a cell containing a heterologous nucleic acid molecule. "Heterologous" or "exogenous" means that the nucleic acid molecule originates from a different species than the host cell. Thus, a host cell is not a naturally occurring cell but a molecular biology tool obtained through genetic engineering techniques. The host cell can consist of a single cell type or a group of different cell types (resulting in a mixture of distinct host cell types). A host cell can also be a hybrid cell, resulting from the fusion of at least two different cell types. Host cells can be cultured cell lines, primary cells, non-human stem cells, or proliferative cells.In the context of this invention, the term "host cell" includes both prokaryotic and eukaryotic cells. A host cell may, for example, be isolated, meaning it is not part of a living organism, nor of an entire organ or tissue taken from a living organism. When cultured in a culture medium, an isolated cell can, however, be grown either in suspension or adherent to a support and, after multiplication, form a cell mat. A host cell may alternatively be organized into a tissue, an organ, or be part of a complete organism. In the case where the host cell is part of a complete organism, said organism is not human.

[0076] By "Uniprot reference" we mean a unique reference number allowing the identification of a protein in the Uniprot public database in its version 2023_03 of June 28, 2023.

[0077] Use of a CAR comprising, essentially consisting of, or consisting of an amino acid sequence having at least 80% identity with SEQ ID NO: 2 to produce TPAL from TPA

[0078] In a first aspect, the invention relates to the use of a carboxylase reductase (CAR) comprising or consisting of an amino acid sequence having at least 80% identity with SEQ ID NO:2 to produce terephthalaldehyde (TPAL) from terephthalic acid (TPA).

[0079] Carboxylase reductase (CAR) used

[0080] The CAR used comprises an amino acid sequence having at least 80% identity, advantageously at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity or at least 99.5% identity with SEQ ID NO:2. The amino acid sequence of the carboxylase reductase used may in particular comprise, be essentially composed of or consist of SEQ ID NO:2.

[0081] The SEQ ID NO sequence: 2 corresponds to the amino acid sequence of a Segniliparus rugosus CAR shown to be able to convert terephthalic acid (TPA) to terephthalaldehyde (TPAL) with interesting activity (see Examples 1 and 2 below), and is presented in Table 3 below.

[0082] [Table 3]

[0083] Advantageously, the carboxylase reductase is therefore chosen from among the carboxylase reductases of bacteria of the genus Segniliparus.

[0084] When the amino acid sequence of the carboxylase reductase used in the invention is not 100% identical to SEQ ID NO:2, it nevertheless retains carboxylase reductase activity, enabling it to produce terephthalaldehyde (TPAL) from terephthalic acid (TPA). Maintaining the carboxylase reductase activity that allows a mutant of the reference sequence SEQ ID NO:2 to produce terephthalaldehyde (TPAL) from terephthalic acid (TPA) can be achieved by limiting not only the number (high percentage of identity with the reference sequence) but also the nature and position of the mutations introduced into the reference sequence.

[0085] The nature of the mutations introduced can influence the activity of the resulting mutant. In particular, it is well known that conservative substitutions are less likely to alter the enzymatic activity of a mutant than non-conservative substitutions.

[0086] It is also known that adding a tag polypeptide to enable easier detection or purification of the mutant generally does not alter enzymatic activity, especially when the tag polypeptide is inserted at the N-terminus or C-terminus (rather than within the sequence).

[0087] Therefore, when using a mutant of the reference sequence SEQ ID NO:2, in addition to a minimum percentage of identity with the reference sequence as described above, the mutations of the mutant are advantageously chosen from conservative substitutions and the insertion of a tag peptide, preferably at the N-terminus or C-terminus.

[0088] The position of the introduced mutations can also influence the activity of the resulting mutant. In particular, those skilled in the art know that mutations should be avoided in regions known to be involved in enzymatic activity (substrate binding sites and sites for potential cofactors...).

[0089] CARs are very well characterized in terms of function, protein sequences and residues of interest, and optimal expression conditions in microorganisms [Holly Stolterfoht, et al. 2016],

[0090] In particular, a number of amino acid residues are known to be conserved within CARs. These residues are described in Table 4 below.

[0091] [Table 4]

[0092] Advantageously, when using a mutant of the reference sequence SEQ ID NO:2, in addition to a minimum percentage of identity with the reference sequence as described above (and advantageously mutations advantageously chosen from conservative substitutions and the insertion of a tag peptide, preferably at the N-terminus or C-terminus), the mutant has no mutations at the conserved positions described for SEQ ID NO:2 in Table 4 above.

[0093] Activation by bacterial phosphopantetheinyl transferase (PPT)

[0094] For a carboxylase reductase to be active, a phosphopantetheinyl residue must be attached to a conserved serine amino acid from its T domain by a phosphopantetheinyl transferase [William Finnigan, et al. 2017],

[0095] Therefore, in an advantageous embodiment, a carboxylase reductase is used comprising essentially consisting of or consisting of an amino acid sequence having at least 80% identity with SEQ ID NO:2 activated by a bacterial phosphopantetheinyl transferase (PPT).

[0096] Activation can precede contact between carboxylase reductase and TPA, or it can result from contact between carboxylase reductase and TPA in the presence of a bacterial PPT. In an advantageous embodiment: a) the bacterial phosphopantetheinyl transferase is of the same bacterial genus as the carboxylase reductase. Indeed, CARs and PPTs from the same bacterial genus are generally well-adapted to each other; b) the bacterial phosphopantetheinyl transferase is selected from among the phosphopantetheinyl transferases of bacteria of the genera Segniliparus, Mycobacteroides, Nocardia, Bacillus, and Escherichia; Advantageously, bacterial phosphopantetheinyl transferase is chosen from among the phosphopantetheinyl transferases of bacteria of the species Segniliparus rotundus Mycobacteroides immunogenum, Nocardia iowensis, Bacillus Subtilis and Escherichia coli.Indeed, these PPTs have been shown to be effective in activating CARs by the inventors (see Examples 1 and 2 below); (c) the bacterial phosphopantetheinyl transferase is selected from among the phosphopantetheinyl transferases having an amino acid sequence with at least 80% identity, advantageously at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity or at least 99.5% identity, with a sequence selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9; or (d) any combination of (a) to (c) (i.e. a) and (b); a) and (c); b) and (c); or a), b) and c)).

[0097] The amino acid sequences SEQ ID NO:5 to SEQ ID NO:9 and SEQ ID NO:64 of PPTs particularly useful in the context of the use according to the invention are presented in Table 5 below.

[0098] [Table 5]

[0099] As with CARs, when using a mutant of one of the amino acid sequences of the PPTs in Table 5 above, the mutant preferentially retains the enzymatic activity of the original PPT. This can be achieved by limiting not only the number (high percentage of identity with the reference sequence) but also the nature and position of the mutations introduced into the reference sequence.

[0100] Therefore, when using a mutant of any of the reference sequences SEQ ID NO:5 to SEQ ID NO:9, in addition to a minimum percentage of identity with the reference sequence as described above, the mutations of the mutant are advantageously chosen from conservative substitutions and the insertion of a tag peptide, preferably at the N-terminus or C-terminus.

[0101] A person in the field also knows that it is necessary to avoid mutations in regions known to be involved in enzymatic activity (substrate binding sites and sites for possible cofactors...).

[0102] PPTs are very well characterized in terms of function, protein sequences and residues of interest, and optimal expression conditions in microorganisms [Beld J. et al., 2015]. In particular, a number of amino acid residues are known to be conserved within PPTs. These residues are described in Table 6 below.

[0103] [Table 6]

[0104] Uses

[0105] The CAR comprising, essentially consisting of or consisting of an amino acid sequence having at least 80% identity with SEQ ID NO:2, the nucleic acid molecule encoding it, the vector comprising a nucleic acid molecule encoding it, or the host cell expressing it, each being as defined above, is used to produce TPAL from TP A, regardless of the production method used, although the use advantageously takes place in vitro.

[0106] Nucleic acid molecules according to the invention

[0107] A nucleic acid molecule further comprising a promoter and / or a terminator and / or an export sequence and / or optimized for expression in a given host cell

[0108] The invention also relates to an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a carboxylase reductase comprising, essentially consisting of or consisting of an amino acid sequence having at least 80% identity with SEQ ID NO:2 (as described above), characterized in that: a) the isolated nucleic acid molecule further comprises a promoter controlling the expression of the nucleic acid sequence; or b) the isolated nucleic acid molecule further comprises a transcription terminator controlling the expression of the nucleic acid sequence; or c) the nucleic acid sequence is further optimized for expression in a host cell, in particular a yeast or bacterium or fungus; or d) any combination of a) to c) (i.e. a) and b); a) and c); b) and c); or a), b) and c)).

[0109] Such isolated nucleic acid molecules are useful for the production of a carboxylase reductase comprising, essentially made up of or consisting of an amino acid sequence having at least 80% identity with SEQ ID NO: 2.

[0110] In one embodiment, the isolated nucleic acid molecule further comprises a promoter controlling the expression of the nucleic acid sequence. In this case, a person skilled in the art will be able to choose an appropriate promoter depending on the system and, in particular, on the host cell in which they wish to express the nucleic acid molecule.

[0111] When expression in yeast is desired, a yeast promoter may be used, preferably one chosen from ADH1 and ADH2 (pADH1 and pADH2; these promoters allow expression particularly when the culture medium contains ethanol as a carbon source), CCW12 (pCCW12; this promoter allows expression particularly when the culture medium contains glucose as a carbon source), and TEF1 (pTEF1; this promoter allows expression particularly when the culture medium contains glucose or sucrose as a carbon source), preferably again one chosen from ADH1 (pADH1) and ADH2 (pADH2) of Saccharomyces cerevisiae, CCW12 (pCCW12) of S. cerevisiae, and TEF1 (pTEF1) of S. cerevisiae. preferably another promoter chosen from ADH1 of sequence SEQ ID NO:22, ADH2 of sequence SEQ ID NO:23, CCW12 of sequence SEQ ID NO:24, and TEF1 of sequence SEQ ID NO:25, these sequences being presented in Table 7 below.

[0112] [Table 7]

[0113] When expression in a bacterium is desired, a bacterial promoter can be used, preferably one chosen from among J23101 with sequence SEQ ID NO: 26, pLtetOl with sequence SEQ ID NO: 27, galPl with sequence SEQ ID NO: 28, PlacUV5 with sequence SEQ ID NO: 29, pLacOl with sequence SEQ ID NO: 30, Ptrc with sequence SEQ ID NO: 31, Ptet with sequence SEQ ID NO: 32 identified in Mutalik et al., 2013 (doi.org / 10.1038 / nmeth.2403), and T7 with sequence SEQ ID NO: 33, these sequences being presented in Table 8 below. The Ptet promoter is particularly strong and can therefore be advantageously used preferentially. [Table 8]

[0114] When expression in a filamentous fungus is desired, a filamentous fungus promoter may be used, preferably the ADH1 (pADHl) promoter from the genus Aspergillus, preferably the ADH1 promoter with sequence SEQ ID NO:34 shown in Table 9 below.

[0115] [Table 9]

[0116] When expression in a fungus other than yeast or filamentous fungi is desired, a promoter known to those skilled in the art, derived from the fungal species in which the sequence will be expressed, may be used. However, a yeast or filamentous fungus promoter may also be used.

[0117] According to an alternative embodiment or one combinable with the preceding one, the isolated nucleic acid molecule further comprises a transcription terminator of said nucleic acid sequence.

[0118] In this case, a person in the field will know how to choose an appropriate transcription terminator depending on the system and in particular on the host cell in which they wish to express the nucleic acid molecule.

[0119] When expression in a yeast is desired, a yeast terminator may be used, preferably the RPL3 terminator (tRPL3) or the ADH1 terminator (tADHl), or the CYC1 terminator (tCYCl), preferably the RPL3 terminator from S. cerevisiae, or the ADH1 terminator from S. cerevisiae, preferably the RPL3 terminator of sequence SEQ ID NO:35 or the ADH1 terminator of sequence SEQ ID NO:36, or the CYC1 terminator of sequence SEQ ID NO:37, these sequences being presented in Table 10 below.

[0120] [Table 10]

[0121] When expression in a bacterium is desired, a bacterial terminator may be used, preferably the amyA terminator of B. subtilis, or the erp terminator of E. coli, or the His terminator of E. coli, or the ilv terminator of E. coli, or the mpb terminator of E. coli, or the T3 terminator of bacteriophage T3, or the T7 terminator of bacteriophage T7, or the T21 terminator of bacteriophage T21, or the M13 terminator of bacteriophage Ml 3, or the tetAC terminator of the tnlO transposon (all mentioned by Cambray et al., 2013, doi: 10.1093 / nar / gktl63).Preferably, the terminator amyA of sequence SEQ ID NO:38, or the terminator erp of sequence SEQ ID NO:39, or the terminator His of sequence SEQ ID NO:40, or the terminator ilv of sequence SEQ ID NO:41, or the terminator mpb of sequence SEQ ID NO:42, or the terminator T3 of sequence SEQ ID NO:43, or the terminator T7 of sequence SEQ ID NO:44, or the terminator T21 of sequence SEQ ID NO:45, or the terminator M13 of sequence SEQ ID NO:46, or the terminator tetAC of sequence SEQ ID NO:47, these sequences being presented in Table 11 below.

[0122] [Table 11]

[0123] When expression in a filamentous fungus is desired, a filamentous fungus terminator may be used, preferably the RPL3 (tRPL3) terminator or the ADH1 terminator, or the CYC1 terminator, preferably the RPL3 terminator from the genus Aspergillus or the ADH1 terminator from the genus Aspergillus, or the CYC1 terminator from the genus Aspergillus. Preferably, the RPL3 terminator with sequence SEQ ID NO: 48, the ADH1 terminator with sequence SEQ ID NO: 49, or the CYC1 terminator with sequence SEQ ID NO: 50 may be used; these sequences are shown in Table 12 below. [Table 12]

[0124] When expression in a fungus other than yeast or filamentous fungi is desired, a terminator known to those skilled in the art, derived from the fungal species in which the sequence will be expressed, may be used. However, a yeast or filamentous fungus terminator may also be used.

[0125] According to a preferred embodiment, the isolated nucleic acid molecule further comprises both a promoter and a terminator which are as defined above.

[0126] According to an alternative embodiment or one that can be combined with one or both of the embodiments of the isolated nucleic acid molecule described above, the nucleic acid molecule further comprises an export sequence. Advantageously, this export sequence allows the secretion or excretion of the polypeptide(s) encoded by the nucleic acid molecule into the cellular environment.

[0127] According to a preferred embodiment, the isolated nucleic acid molecule further comprises both a promoter, a transcription terminator and an export sequence as defined above.

[0128] The nucleic acid molecule may be isolated from homologous strains in culture, preferably selected from the genus Segniliparus, and more advantageously from the species Segniliparus rugosus. Alternatively, the nucleic acid molecule may be isolated from a vector or a heterologous host cell comprising said molecule, said vector or host cell being as defined above and described below in the sections "Host Cells" or "Vectors". Alternatively, the isolated nucleic acid molecule may be synthesized in vitro by nucleic acid synthesis techniques known to those skilled in the art.

[0129] According to an alternative embodiment or one that can be combined with one and / or the other of the embodiments relating to the isolated nucleic acid molecule according to the invention described above, the nucleic acid sequence included in the isolated nucleic acid molecule according to the invention is further optimized for expression in a host cell, in particular in a fungus (and especially a yeast or a filamentous fungus) or in a bacterium.

[0130] To optimize expression in a host cell, particularly in a fungus (especially yeast or filamentous fungi) or a bacterium, those skilled in the art know how to exploit genetic code usage bias, which refers to the preferential use by a given organism of one of the possible triplets of nucleotides, or codons, to code for the same amino acid. Indeed, there are generally several combinations of three nucleotides (called "codons") that code for the same amino acid (except for methionine and tryptophan), known as synonymous codons, but some of these combinations are generally used preferentially by a given organism. For the production of an amino acid sequence of interest, optimal expression can thus be achieved when the codons chosen to code for the amino acid sequence are those preferentially used by the host cell's organism of origin.Depending on the production organism chosen (in particular a yeast, a bacterium or a fungus, especially a nutrient-rich one), different optimal nucleic acid sequences will therefore be used when the nucleic acid sequence included in the nucleic acid molecule according to the invention is further optimized for expression in the production organism chosen.

[0131] Various software programs are available to professionals to optimize codons for expression in a host cell, particularly in a fungus (especially yeast or a fungal fungus) or a bacterium. Examples of such software include the Twist Codon Optimization tool (provided by Twist Biosciences), the GenSmart™ Codon Optimization software (provided by GenScript and whose functionalities are described in application W02020024917A1), the IDT Codon Optimization Tool (provided by Integrated DNA technologies), and Azenta's codon optimization tool (provided by Azenta).

[0132] An example of an optimized nucleic acid sequence encoding SEQ ID NO:2 is the nucleic acid sequence SEQ ID NO:51, shown below, which is optimized (at least partially) for expression in a bacterium, specifically Escherichia coli.

[0133] SEQ ID NO :51 (optimized nucleic acid sequence encoding for SEQ ID NO :2, the amino acid sequence of CAR A2):

[0134] ATGACTGAATCTCAAAGGTATGAGACGCGTGAGGCTCGCCCGGGCGGACAGTCTTTAGCGGAACGT GTGGCTCGCGTTGTAGGGATCGATCCGCAGGCCOCGGGAGCCGTCCGCGAAAGGGGTTGCCGAA CGGGCAACCCAACAGGGATTGGGGTT CGCGCGGGGCTGGCTCAGCGTGCGTTTGAGATTAGCAAAGAGCCCATTACCGGGCGTGGTGTCGCG ACTTTOCTGCCGAAATTCGAAACCGTCTGTTATCGCGAACTTTTAOAACGTTCGGATGCGATTGCAT CCGAATTA0CTAACCATGCTGAGGCTCCG CATCGACGGACTACACCTCGTTAGATATTGCGGGGGTCCTTTTGGGTGTTACATGGGTCGCATTACA AACCGGTGCCAGCACAGATAÇGTTGAAAGGGATTGCGGAAGAAACCGCGGCCGCAGTCTTTGGCG CGTCAGTTGAGCATTTGGATAATGCAGTCAGAAGTGCTCTGCCGATTGGTCGCGC TTGTGTGTTCGATTACCGTCAAGGTGTGGATGAGGACCGCGAGGCTGTGGAGGCAGCGCGCTCACGTT TGGCAGAAGCCGGATCCGCTGTTTTAGTTGATACCTTGGATGAAGTAATCGCCCGCGGCCGCGCAT

[0135] TGCCGCGCGTCGCCCTTCCACCAGCTACGGACGCGGGAGATGACTCTCTGAGTTTACTTATCTATAC

[0136] TAGC-GGTTCTACCGGAACACCAAAAGGTGCGATGTATCCTGAACGCAACGTGGCACAATTTTGGGG

[0137] AGGTATCTGGCACAACGCCTTTGACGACGGGGATAGTGCGCCTGACGTACCGGACATTATGGTTAA

[0138] CTTCATGCCATTGAGCCATGTTGCCGCTGCGCATCGGACTTATGGGCACTCTTTCATCTGGAGGAACC

[0139] ACATACTTTATCGCAAAATCAGACCTGAGTACGTTTTTTGAGGATTATAGCTTAGCCCGCCCGACCA

[0140] AGTTGTTTTTCGTACCTCGCATCTGTGAGATGATTTATCAACATTATCAGAGCGAGCTTGACCGTAT

[0141] TGGTGCTGCCGATGGTTCGCCTCAGGCGGAAGCTATCAAGACCGAGTTGCGTGAGAAACTTTTGGG

[0142] GGGACGCGTTCTGACAGCTGGTTCAGGCAGCGCTCCGATGTCCCCTGAACTTACTGCCTTCATTGA

[0143] AAGTGTGCTTCAGGTTCACCTTGTGGACGGCTACGGTAGCACAGAGGCGGGACCTGTATGGCGTGA

[0144] CCGTAAACTGGTGAAACCCCCGGTCACTGAGCACAAACTTATTGATGTCCCAGAGTTGGGGTATTT

[0145] CTCAACTGACTCTCCGTACCCGCGTGGAGAGTTAGCTATTAAGACCCAGACGATTCTTCCCGGTTAC

[0146] TACAAGCGTCCAGAAACAACAGCGGAAGTGTTTGACGAGGATGGCTTTTACTTGACTGGGGATGTG

[0147] GTAGCGGAAGTCGCACCGGAAGAATTCGTCTACGTCGACCGTCGTAAGAATGTGCTTAAGTTATCA

[0148] CAAGGCGAGTTCGTGGCGTTATCAAAATTAGAGGCTGCGTACGGCACGTCACCACTTGTACGCCAA

[0149] ATTTCGGTCTATGGAAGCAGCCAACGTTCTTACTTATTAGCGGTGGTAGTGCCGACCCCTGAAGCG

[0150] CTGGCTAAGTATGGTGATGGAGAAGCAGTCAAAAGCGCATTAGGCGACAGTCTGCAGAAGATCGC

[0151] TCGCGAGGAAGGCTTACAAAGTTACGAGGTCCCTCGCGATTTCATTATTGAGACAGACCCATTTAC

[0152] CATTGAAAACGGAATCTTAAGTGACGCGGGAAAGACGCTTCGCCCAAAAGTCAAAGCTCGTTACG

[0153] GAGAGCGTCTGGAAGCCCTGTATGCACAACTGGCAGAGACTCAGGCAGGAGAGCTGCGCAGTATC

[0154] CGTGTCGGGGCTGGCGAGCGCCCTGTCATCGAAACCGTTCAGCGTGCAGCCGCTGCCTTGTTGGGG

[0155] GCATCTGCTGCAGAGGTAGACCCTGAGGCCCATTTTTCGGACCTGGGAGGCGATAGCCTGAGCGCC

[0156] CTGACATATTCTAATTTTTTACATGAGATTTTCCAAGTGGAAGTACCAGTGAGTGTTATTGTGTCCG

[0157] CTGCGAACAACTTACGTTCTGTGGCAGCCCACATTGAGAAAGAGCGTAGCTCTGGCTCGGACCGCC

[0158] CGACGTTCGCTTCTGTCCATGGTGCTGGGGCGACCACAATTCGTGCATCTGACTTGAAGTTGGAGA

[0159] AATTCTTGGACGCGCAGACTTTGGCGGCTGCCCCATCCCTTCCTCGCCCCGCGAGCGAAGTTCGTAC

[0160] AGTCCTGTTAACGGGTTCCAATGGATGGTTGGGACGCTTCTTAGCTTTGGCATGGCTGGAGCGCCTT

[0161] GTTCCGCAAGGTGGTAAGGTCGTCGTTATTGTTCGTGGGAAGGACGATAAAGCAGCAAAAGCGCG

[0162] TTTAGACTCAGTATTTGAATCGGGTGATCCGGCACTTCTTGCCCACTATGAGGATCTTGCAGATAAA

[0163] GGACTTGAAGTGCTGGCAGGAGATTTTTCCGACGCCGACCTTGGGTTACGTAAAGCGGACTGGGAT

[0164] CGCCTGGCTGATGAAGTAGATTTAATTGTCCACTCCGGCGCATTAGTAAACCACGTCCTTCCCTACA

[0165] GCCAATTGTTCGGCCCGAATGTCGTTGGTACTGCCGAGGTTGCCAAACTGGCATTAACAAAGCGCC

[0166] TTAAGCCAGTTACATACCTGAGTACGGTGGCAGTCGCGGTTGGTGTCGAGCCGTCCGCTTTTGAAG

[0167] AAGACGGCGATATTCGCGATGTATCAGCGGTGCGCTCTATCGATGAGGGCTACGCCAATGGCTATG

[0168] GGAATTCGAAATGGGCAGGGGAAGTATTGCTTCGTGAGGCTTATGAGCATGCGGGCTTACCAGTTC

[0169] GGGTGTTCCGTTCAGACATGATCTTAGCCCATCGCAAATATACAGGTCAGCTTAATGTTCCGGACC

[0170] AGTTTACGCGCTTGATTTTGTCGTTGCTTGCAACGGGTATTGCCCCCAAATCGTTCTACCAGTTAGA

[0171] CGCCACTGGGGGGCGTCAACGCGCCCATTATGACGGGATCCCTGTGGATTTCACGGCGGAGGCGAT

[0172] TACTACACTTGGGTTGGCTGGGTCAGATGGTTACCATTCTTTCGACGTTTTCAATCCACACCATGAC

[0173] GGTGTTGGGTTGGATGAATTTGTCGACTGGTTAGTGGAGGCGGGCCACCCGATTTCACGTGTGGAC GACTATGCAGAATGGTTAAGTCGTTTTGAGACATCTTTACGCGGCCTGCCAGAGGCCCAACGCCAG CACAGTGTCTTGCCTCTTTTACATGCGTTCGCTCAACCAGCTCCCGCTATCGACGGGTCGCCTTTCC AGACCAAGAATTTCCAGAGTTCTGTTCAAGAAGCAAAAGTGGGAGCAGAAGACGATATTCCTCATC TTGACAAGGCGCTGATCGTAAAGTACGCGGAAGATATTAAGCAGTTGGGGTTATTG

[0174] Nevertheless, a person skilled in the art would be able to generate other nucleic acid sequences optimized for expression in a bacterium, notably Escherichia coll., in a fungus (and in particular a yeast such as Saccharomyces cerevisiae or a filamentous fungus, especially of the genus Aspergillus), or in another type of host cell (in particular another species of bacterium or fungus).

[0175] Once the optimized nucleic acid sequence is defined, a person skilled in the art can obtain this sequence by in vitro synthesis directly with the optimized codons. When the number of nucleotides to be modified compared to the original sequence is not too high, the optimized sequence can also be obtained by in vitro site-directed mutagenesis from a sample of the nucleic acid molecule whose codons are to be adapted, using polymerase chain reaction (PCR) amplification.

[0176] According to a preferred embodiment, the isolated nucleic acid molecule further comprises both a transcription promoter and terminator as defined above, and the nucleic acid sequence included in the isolated nucleic acid molecule according to the invention is further optimized for expression in a host cell, advantageously in a fungus (and in particular a yeast or filamentous fungus) or in a bacterium, preferably in a bacterium, as described above.

[0177] According to another preferred embodiment, the isolated nucleic acid molecule further comprises both a promoter, a transcription terminator and an export sequence as defined above, and the nucleic acid sequence included in the isolated nucleic acid molecule according to the invention is further optimized for expression in a host cell, advantageously in a fungus (and in particular a yeast or a filamentous fungus) or in a bacterium, preferably in a bacterium, as described above.

[0178] Nucleic acid molecule or combination of nucleic acid molecules encoding a bacterial CAR and PPT

[0179] The invention also relates to an isolated nucleic acid molecule or a combination of two isolated nucleic acid molecules comprising: a) a nucleic acid sequence encoding a carboxylase reductase comprising, essentially consisting of, or consisting of an amino acid sequence having at least 80% identity with SEQ ID NO:2; and b) a nucleic acid sequence encoding a bacterial phosphopantetheinyl transferase (PPT) as described above.

[0180] The CAR and bacterial PPT can be encoded either by the same nucleic acid molecule (a single isolated nucleic acid molecule), or by two distinct nucleic acid molecules (a combination of two isolated nucleic acid molecules).

[0181] Each of the embodiments relating to nucleic acid molecules comprising a nucleic acid sequence encoding a carboxylase reductase comprising, essentially made up of, or made up of an amino acid sequence having at least 80% identity with SEQ ID NO:2 described previously in the preceding section also applies to the nucleic acid molecules or combinations of nucleic acid molecules according to the invention described in this section.

[0182] Regarding the nucleic acid sequence encoding a bacterial phosphopantetheinyl transferase (PPT), it may further include a promoter, a transcription terminator, an export sequence, or any combination thereof and / or be optimized for expression in a given host cell.

[0183] Nucleic acid sequences encoding the PPTs described above, which are optimized (at least partially) for expression in bacteria and in particular in Escherichia coli are presented in Table 13 below.

[0184] [Table 13] Vectors according to the invention

[0185] The invention also relates to a vector or a combination of vectors comprising an isolated nucleic acid molecule or a combination of isolated nucleic acid molecules according to the invention.

[0186] Any isolated nucleic acid molecule or combination of isolated nucleic acid molecules according to the invention described above can be inserted into a vector or a combination of vectors according to the invention.

[0187] In particular, the invention relates to a single vector comprising either a single isolated nucleic acid molecule encoding for bacterial CAR and PPT, or two distinct nucleic acid molecules encoding respectively for bacterial CAR and PPT.

[0188] Alternatively, the invention also relates to a combination of two vectors comprising one an isolated nucleic acid molecule encoding CAR and the other an isolated nucleic acid molecule encoding bacterial PPT.

[0189] The vector according to the invention, or each vector in a combination of vectors according to the invention, can be chosen from any suitable vector type. When it is a combination of two vectors, both vectors are preferably suitable for expression in the same host cell.

[0190] Vectors suitable for the purposes of this invention include, without limitation, bacteriophage, plasmid, or cosmid vectors for expression in prokaryotic host cells such as bacteria (e.g., E. coli or bacteria of the genus Pseudomonas); vectors for expression in yeast (e.g., Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris); baculovirus vectors for expression in insect cell systems (e.g., Sf9 cells); viral and plasmid vectors for expression in plant cell systems (e.g., the Ti plasmid, cauliflower mosaic virus, CaMV, tobacco mosaic virus TMV); and viral and plasmid vectors for expression in vertebrate cells or organisms, particularly mammals.

[0191] Depending on the host cell of interest, the person skilled in the art is familiar with appropriate expression vectors. These vectors are generally commercially available (e.g., from suppliers such as Invitrogen, Stratagene, Amersham Biosciences, Promega, etc.), available from depository institutions such as the American Type Culture Collection (ATCC, Rockville, Md.), or have been the subject of numerous publications describing their sequence, structures, and production methods, so the person skilled in the art can apply them without difficulty.

[0192] When the host cell is yeast, the vector according to the invention can advantageously be a plasmid vector suitable for yeast transfection. Representative examples of plasmid vectors suitable for yeast transfection include, without limitation, pREP4, pCEP4 (Invitrogen), pCI (Promega), pVAX (Invitrogen), pgWiz (Gene Therapy System Inc), and YCplac22 (ATCC 87585), as well as any derivative of these vectors (in particular a derivative of YCplac22 in which the pair (PGK promoter and CYC terminators) and the pair (TEF1 promoter and ADH1 terminator) have been integrated), but any other vector suitable for yeast transfection may be used.

[0193] When the host cell is a bacterium, the vector according to the invention can advantageously be a plasmid vector suitable for bacterial transfection. Representative examples of plasmid vectors suitable for bacterial transfection include, without limitation, pBAD His (SEQ ID NO: 54, Addgene), pET28 (SEQ ID NO: 55, Addgene), pBR322 (SEQ ID NO: 56, Addgene), pBeloBACl l (SEQ ID NO: 57, Genbank U51113), these sequences being shown below.

[0194] Plasmid pRB322 (SEQ ID NO: 56):

[0195] TTCTCATGTTTGACAGCTTATCATCGATAAGCTTTAATGCGGTAGTTTATCACAGTTAAAT TGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGTCATCCTCGGC ACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCTCTTG CGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCTATAT GCGTTGATGCAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCT1TGGCCGCC GCCCAGTCGTGCTCGCTTCGCTACTTGGAGCCACTATCGACTACGCGATCATGGCGACCA CACCCGTCCTGTGGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCCACAG GTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACT TCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGAC TGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAA CCTACTACTGGGCTGCTTCCTAATGCAGGAGTCGCATAAGGGAGAGCGTCGACCGATGCC CTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGC CGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGG GTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGGCCTGTCGCTTGCG GTATfCGGAATCTrGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCACCAAACGTT TCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCTACGTCTTGCTGGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGG CATCGGGATGCCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGG GACAGCTTCAAGGATCGCTCGCGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGA TCGTCACGGCGATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGATTGTAG GCGCCGCCCTATACCTTGTCTGCCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCA CCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGG AGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCAGAACATATC CATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCTG

[0196] GCCACGGGTGCGCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTG

[0197] CCTTACTGGTTAGCAGAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTG

[0198] CAAAACGTCTGCGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTITCGTAAAG

[0199] TCTGGAAACGCGGAAGTCAGCGCCCTGCACCATTATGTTCCGGATCTGCATCGCAGGATG

[0200] CTGCTGGCTACCCTGTGGAACACCTACATCTGTATTAACGAAGCGCTGGCATTGACCCTG

[0201] AGTGATTTTTCTCTGGTCCCGCCGCATCCATACCGCCAGTTGTTTACCCTCACAACGTTCC

[0202] AGTAACCGGGCATGTTCATCATCAGTAACCCGTATCGTGAGCATCCTCTCTCGTTTCATCG

[0203] GTATCATTACCCCCATGAACAGAAATCCCCCTTACACGGAGGCATCAGTGACCAAACAGG

[0204] AAAAAACCGCCCTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGA

[0205] AACTCAACGAGCTGGACGCGGATGAACAGGCAGACATCTGTGAATCGCTTCACGACCAC

[0206] GCTGATGAGCTTTACCGCAGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGA

[0207] CACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACA

[0208] AGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGT

[0209] CACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATfGTACT

[0210] GAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCA

[0211] TCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCG

[0212] AGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACG

[0213] CAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGC

[0214] GTTGCTGGCGTTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTC

[0215] AAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAA

[0216] GCTCCTTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTC

[0217] CCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGG

[0218] TCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTT

[0219] ATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGC

[0220] AGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGA

[0221] AGTGGTGGCCTAACTACXiGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGA

[0222] AGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTG

[0223] GTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAG

[0224] AAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG

[0225] GGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTITTAAATTAAAAAT

[0226] GAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCT

[0227] TAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATGCATAGTTGCCTGACT

[0228] CCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAAT

[0229] GATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGG

[0230] AAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTG

[0231] TTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCAT TGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCC

[0232] CAACGATCAAGGCGAGITACATGATCCCCCATGTTGTGCAAAAAAGCGGITAGCTœn’C

[0233] GGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCA

[0234] GCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGT

[0235] ACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAG1TGCTCTTGCCCGGCGT

[0236] CAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAAA

[0237] CGTTCTTCGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAA

[0238] CCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGGCGTTTCTGGGTGAG

[0239] CAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTG

[0240] AATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGA

[0241] GCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGTTCCGCGCACATTTC

[0242] CCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAA

[0243] ATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAA

[0244] Plasmid pBeloBACl 1 (SEQ ID NO : 57):

[0245] GCGGCCGCAAGGGGTTCGCGTTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATG

[0246] CGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGA

[0247] TGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGG

[0248] GAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCT

[0249] GCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACG

[0250] GCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGGGGATCC

[0251] TCTAGAGTCGACCTGCAGGCATGCAAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTT

[0252] GGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACAC

[0253] AACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACT

[0254] CACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGICGGGAAACCTGTCGTGCCAGCTG

[0255] CATTAATGAATCGGCCAACGCGAACCCCTTGCGGCCGCCCGGGCCGTCGACCAATTCTCA

[0256] TGTTTGACAGCTTATCATCGAATTTCTGCCATTCATCCGCTTATTATCACTTATTCAGGCGT

[0257] AGCAACCAGGCGTTTAAGGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCC

[0258] ACTCATCGCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCACAAA

[0259] CGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATT

[0260] TGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAAC

[0261] TGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAG

[0262] GGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACT

[0263] GCŒGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGA

[0264] AAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCA

[0265] TACGGAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAA

[0266] AACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCGAGCTGAACGGTCT GGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATT

[0267] GGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCT

[0268] GAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAG

[0269] TTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCC

[0270] CGGTATCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTA

[0271] TTTATTCGCGATAAGCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGC

[0272] GCGGATCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTTGCCG

[0273] CTATGCGATGCACATGCTGTATGCCGGTATACCGCTGAAAGTTCTGCAAAGCCTGATGGG

[0274] ACATAAGTCCATCAGTTCAACGGAAGTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGC

[0275] CCGGCACCGGGTGCAGTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATT

[0276] ATCCTGAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATATGCTGT

[0277] TTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGCGAACGAAACAGTCGG

[0278] GAAAATCTCCCATTATCGTAGAGATCCGCATTATTAATCTCAGGAGCCTGTGTAGCGTTTA

[0279] TAGGAAGTAGTGTTCTGTCATGATGCCTGCAAGCGGTAACGAAAACGAT1TGAATATGCC

[0280] TTCAGGAACAATAGAAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGC

[0281] AATGGACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTACAGCCAG

[0282] TAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGAGTGAGCGAGGAAGCACCAG

[0283] GGAACAGCACTTATATATTCTGCTTACACACGATGCCTGAAAAACTTCCCTTGGGGTTA

[0284] TCCACTTATCCACGGGGATAATTTTTTATAATTATTTTTTTTATAGTTTTTAGATCTTCTTTTTT

[0285] AGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAAGGTGTTGTGACAAATTGCC

[0286] CTTTCAGTGTGACAAATCACCCTCAAATGACAGTCCTGTCTGTGACAAATTGCCCTTAACC

[0287] CTGTGACAAATTGCCCTCAGAAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTATTTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGGCG

[0288] GAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATCGTCCAGTCAA

[0289] CGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCAAAAACGTATGCTGTATCTGTT

[0290] CGTTGACCAGATCAGAAAATCTGATGGCACCCTACAGGAACATGACGGTATCTGCGAGAT

[0291] CCATGTTGCTAAATATGCTGAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATAT

[0292] ACGGCAGGCATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG

[0293] ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGTGCGCACAGTC

[0294] CATCGAGAGGGCTTTACAGTGTACATATCAACCCATATCTCATTCCCTTCTTTATCGGGTT

[0295] ACAGAACCGGTTTACGCAGTTTCGGCTTAGTGAAACAAAAGAAATCACCAATCCGTATGC

[0296] CATGCGTTTATACGAATCCCTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCT

[0297] CTGAAAATCGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGCCT

[0298] GACTTCGGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAAC.AGCAGAACTCCAATG

[0299] CGCCTCTATACATTGAGAAAAAGAAAGGCCGCCAGACGACTCATATCGTATTTTCCTTCC

[0300] GCGATATCACTTCCATGACGACAGGATAGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTTCTGACCTACTGAGGGTAATTTGTCACAGTTTTQCTGTTTCCTTCA

[0301] GCCTGCATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATTTGAGGG

[0302] CAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTGACCTGATATCGGGGGTTA

[0303] GTTCGTCATCATTGATGAGGGTTGATTATCACAGTTTATTACTCTGAATTGGCTATCCGCG

[0304] TGTGTACCTCTACCTGGAGTTTTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGA

[0305] GCTATCTGACAGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTAC

[0306] ACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCTTCTTATCTCCTT

[0307] TTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTTTTTGATGACTTTGCGATTTTGTTG

[0308] TTGCTTTGCAGTAAATTGCAAGATTTAATAAAAAAACGCAAAGCAATGATTAAAGGATGT

[0309] TCAGAATGAAACTCATGGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACG

[0310] AAGGCTATCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACCCG

[0311] GCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCAGGCTATCAGAGA

[0312] TGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGGAAATTCGAGGACGGGTTGAGC

[0313] AACGTGTTGGTTATACAATTGAACAAATTAATCATATGCGTGATGTGTTTGGTACGCGATT

[0314] GCGACGTGCTGAAGACGTATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGT

[0315] TTACAAAACCTCAG1TTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGTG1T

[0316] TTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCACGGATGGGTACCA

[0317] GATCTTCATATTCATGCAGAAGACACTCTCCTGCCTTTCTATCTTGGGGAAAAGGACGAT

[0318] GTCACTTATGCAATAAAGCCCACTTGCTGGCCGGGGCTTGACATTATTCCTTCCTGTCTGG

[0319] CTCTGCACCGTATTGAAACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCG

[0320] ATCCACACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTCATAGT

[0321] TATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGTATGTGCTGCTGATGT

[0322] GCTGATTGTTCGCACGCCTGCTGAGTTGTTTGACTACACCTCGGCACTGCAGTTTTTCGAT

[0323] ATGCTTCGTGATCTGCTCAAGAACGTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTT

[0324] TGCTTACCAAATACAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTC

[0325] GGGATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAAGTTGGT

[0326] AAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGATCAACGCTCTTCAACT

[0327] GGTGCCTGGAGAAATGCTCTTTCTATTTGGGAACCTGTCTGCAATGAAATTTTCGATCGTC

[0328] TGATTAAACCACGCTGGGAGATTAGATAATGAAGCGTGCGCCTGTTATTCCAAAACATAC

[0329] GCTCAATACTCAACCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGA

[0330] TTCGTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAAIGCCATTACTTTGCCTGTATGT

[0331] GGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGATAGTGTTGAGAAGACCTCT

[0332] CGGGTATGGTCAGGTAATGAACGTGACCAGGAGCTGCTTACTGAGGACGCACTGGATGA

[0333] TCTCATCCCTTCTTTTCTACTGACTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCT

[0334] GGTGTCATAGAAATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGT

[0335] GATTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTATCCAGATTG

[0336] GGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAGCGTTATGCAAGCCGATTG CAGAATGAATTTGCTGGAAATATTTCTGCGCTGGCTGATGCGGAAAATATTTCACGTAAG

[0337] ATTATTACCCGCTGTATCAACACCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTC

[0338] ACCCCGGTGAACTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAG

[0339] AGGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTGGGGTGATA

[0340] TTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTTAAAACGTCATCTGCATCAA

[0341] GAACTAGTTTAAGCTCACGACATCAGTTTGCTCCTGGAGCGACAGTATTGTATAAGGGCG

[0342] ATAAAATGGTGCTTAACCTGGACAGGTCTCGTGTTCCAACTGGTGTATAGAGAAAATTGA

[0343] GGCCATTCTTAAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT

[0344] TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTGGCCTGAATATT

[0345] CTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGATAATCAGACTGGGACCACGGTC

[0346] CCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTC

[0347] TGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGA

[0348] CCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTCGTAT

[0349] CGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG

[0350] TCTGGAACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCA

[0351] CTCGTATCGTCGGTCTGATTATTAGTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGA

[0352] TTATCGGTCTGGGACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTA

[0353] CGATTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGTAGAACGG

[0354] AGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGCTGTGTCCTGCTTATCCAC

[0355] AACATTTTGCGCACGGTTATGTGGACAAAATACCTGGTTACCCAGGCCGTGCCGGCACGT

[0356] TAACCGGGCTGCATCCGATGCAAGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATG

[0357] AGGTTGCCCCGTATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTT

[0358] GATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTGGTTTGATGGC

[0359] CTCCACGCACGTTGTGATATGTAGATGATAATCATTATCACTTTACGGGTCCTTTCCGGTG

[0360] ATCCGACAGGTTACGGGGCGGCGACCTCGCGGGTTTTCGCTATTTATGAAAATTTTCCGG

[0361] AAGAAAGGAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTCTCT

[0362] GTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAATAACTTCGTATAGC

[0363] ATACATTATACGAAGTfATATTCGAT

[0364] When the host cell is a fungus other than a yeast, in particular a filamentous fungus, the vector according to the invention may advantageously be a non-circular nucleic acid molecule obtained by PCR or from plasmid digestion by restriction enzymes, and transformed in the fungus by electroporation or by transformation with lithium acetate (same protocol as for yeasts but adapted and known to those skilled in the art).

[0365] The vector according to the invention advantageously comprises all the regulatory sequences (promoter, transcription terminator, export sequence, etc., and all combinations thereof) necessary for the expression of a coding sequence. It advantageously comprises one or more restriction sites and / or codes advantageously for one or more selection markers (for example, for expression in a bacterium, an antibiotic resistance gene may be used, but other types of selection markers may also be used). When intended to integrate a sequence of interest into the genome of a host cell, it also advantageously contains flanking sequences (at each end of the sequence of interest to be integrated into the genome) of 100 to 200 nucleotides, homologous to the recombination site identified in the genome (insertion site).

[0366] Host cells according to the invention

[0367] The invention also relates to a host cell comprising an isolated nucleic acid molecule or a combination of two isolated nucleic acid molecules according to the invention, or a vector or a combination of two vectors according to the invention.

[0368] The host cell according to the invention may comprise any isolated nucleic acid molecule or combination of two isolated nucleic acid molecules according to the invention described above or any vector or combination of two vectors according to the invention as described above.

[0369] The host cell according to the invention can be any host cell capable of expressing a carboxylase reductase (CAR) comprising, essentially consisting of, or consisting of an amino acid sequence having at least 80% identity with SEQ ID NO: 2. It can in particular be chosen from host cells comprising an isolated nucleic acid molecule as defined above or a vector as defined above.

[0370] As defined above, a host cell is a cell containing a heterologous nucleic acid molecule. For the purposes of this invention, the heterologous nucleic acid molecule corresponds to the isolated nucleic acid molecule as defined above or to the vector as defined above. The host cell may be a prokaryotic cell or a eukaryotic cell.

[0371] Among prokaryotic cells, it can be chosen from among bacteria.

[0372] Among eukaryotic cells, it can be chosen from fungal cells (including in particular yeast cells and filamentous fungal cells), algal cells, insect cells, plant or mammalian cells (e.g. human or non-human cells, preferably non-human).

[0373] The host cell is preferably a fungus (especially a yeast or a filamentous fungus) or a bacterium, and in particular a bacterium.

[0374] Among bacteria, the host cell is advantageously chosen from the genera Escherichia, Pseudomonas, Bacillus, Tepidihacillus, Klebsiella, Enterobacter, Serratia, Rhodococcus, Nocardia, and Amycolatopsis. It may be specifically chosen from the species Escherichia coli, Pseudomonas putida, Pseudomonas nitroreducens, Pseudomonas chloraphis, Bacillus subtilis, Cornebacterium glutamicum, Tepidihacillus fermentons, Klebsiella aerogenes, Enterobacter hormaechei, Serratia marcescens, Rhodococcus rhodochrous, Nocardia iowensis, and Amycolatopsis mediterranei. Preferably, the bacterium is of the genus Escherichia, and more preferably of the species Escherichia coli.

[0375] Among the fungi, a yeast or a filamentous fungus will be used to advantage.

[0376] Among yeasts, the host cell is advantageously chosen from the genera Saccharomyces, Candida, Ashbya, Dekkera, Pichia (Hansenula), Deharyomyces, Clavispora, Lodderomyces, Yarrowia, Zigosaccharomyces, Schizosaccharomyces, Torulaspora, Kluyveromyces, Brettanomyces, Cryptococcus, and Malassezia. It can be particularly selected from the species Saccharomyces cerevisiae, Saccharomyces houlardii, Saccharomyces douglasii, and Saccharomyces bayanus. Zigosaccharomyces bailii, Schizosaccharomyces pomhe, Candida tropicalis, Pichia pastoris, Yarrowia lipolitica, Dekkera hrucelensis, Dekkera intermedia, Brettanomycces custersii, Brettanomycces intermedins, Kluyveromyces themotolerens, Torulaspora glohosa, and Torulaspora glahrata. Preferably, the yeast is of the genus Saccharomyces, preferably the species Saccharomyces cerevisiae. Among filamentous fungi, the host cell is advantageously chosen from the genus Aspergillus.It can in particular be chosen from the species Aspergillus tanneri, Aspergillus aculeatus (in particular strains ATCC 16872 / CBS 172.66 / WB 5094), Aspergillus arachidicola, Aspergillus awamori, Aspergillus hertholletiae, Aspergillus homhycis, Aspergillus hrasiliensis (in particular strains CBS 101740 / IMI 381727 / IBT 21946), Aspergillus caelatus, Aspergillus calidoustus, Aspergillus homomorphus (in particular strain CBS 101889), Aspergillus leporis, Aspergillus luchuensis (in particular strain CBS 106.47), Aspergillus minisclerotigenes, Aspergillus niger (in particular strains ATCC 1015 / CBS 113.46 / FGSC Al 144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7, CBS 513.88 / FGSC A1513), Aspergillus nomiae NRRL 13137, Aspergillus novoparasiticus, Aspergillus oryzae (in particular strains ATCC 42149 / RIB 40), Aspergillus parasiticus (in particular strains ATCC 56775 / NRRL 5862 / SRRC 143 / SU-1), Aspergillus pseudonomiae, Aspergillus pseudotamarii, Aspergillus steynii IBT 23096, Aspergillus tamarii, Aspergillus uvarum CBS 121591, Aspergillus violaceofuscus (notably strain CBS 115571), and Aspergillus welwitschiae.

[0377] The host cell contains at least one copy of the isolated nucleic acid molecule as defined above integrated into its genome. Specifically, it may contain a single copy of the isolated nucleic acid molecule as defined above integrated into its genome.

[0378] When the host cell is a fungal cell, particularly a yeast cell (especially of the genus Saccharomyces, preferably of the species Saccharomyces cerevisiae) or a filamentous fungus cell, the copy(ies) of the nucleic acid molecule can be integrated at different loci, preferentially at the URA3, JLP1, LEU2, or TRP1 locus of the genome of said fungal cell (advantageously a yeast or a filamentous fungus). When the host cell is a fungal cell, particularly a yeast or filamentous fungus cell, and multiple copies of the nucleic acid molecule are integrated, the different copies can be integrated at the same locus, or at different loci, preferentially at any combination of the URA3, JLP1, LEU2, and / or TRP1 loci.

[0379] When the host cell is a bacterium (notably Escherichia coli), the copy or copies of the nucleic acid molecule can be integrated into the bacterial chromosome at different loci, for example, the yqiH locus, or the ttdT locus, or the yjhl locus or the ymjB locus, or stored in a plasmid (not integrated into the genome, e.g., pBeloBac).

[0380] Advantageously, the codons used in the nucleic acid molecule or vector within the host cell have been adapted for optimal expression in the selected host cell. As explained previously, for the production of an amino acid sequence of interest, optimal expression can be achieved when the codons chosen to encode the amino acid sequence are those preferentially used by the host cell's organism of origin. Regardless of the host cell type, a person skilled in the art will be able to identify the preferred codons in the literature or using codon optimization software.

[0381] For use according to the invention, host cells can be cultured in aerobic or anaerobic bioreactors, on a small or large scale, in flasks or Petri dishes. Culture can be carried out at a temperature, pH, culture medium, and oxygen level appropriate for a given host cell.

[0382] For yeasts, and particularly for Saccharomyces cerevisiae, culture is advantageously carried out by any suitable method. The methods for culturing a Saccharomyces cerevisiae strain are well known, and those skilled in the art know how to optimize the culture conditions for each strain according to its nature. Classical methods are described in particular in the reference work "Yeast Technology," 2 èmeEdition, 1991, Reed and Nagodawithana, published by Van Nostrand Reinhold (ISBN 0-442-31892-8). In particular, the culture of a yeast strain, especially of the species Saccharomyces cerevisiae, can generally be carried out at a temperature between 20 and 37°C, in a rich liquid medium (for example, YPD medium available from VWR) or synthetic medium (defined to precisely meet the needs of the strain), in aerobic or anaerobic culture.

[0383] For bacteria, and particularly for Escherichia coli, culture is advantageously carried out by any suitable method. The methods for culturing an Escherichia coli strain are well-established, and those skilled in the art know how to optimize the culture conditions for each strain according to its nature. Classical methods are described, in particular, in the reference work "Microbial Culture," 1 èreEdition, 1995, Isaacs and Jennings, published by Garland Science (ISBN 9781872748924). In particular, the culture of a bacterial strain, especially of the species Escherichia coli, can generally be carried out at a temperature between 23°C and 40°C, in a rich medium (for example, LB medium available from VWR), in synthetic culture (defined to precisely meet the needs of the strain), in aerobic or anaerobic culture.

[0384] For fungi other than yeasts, particularly filamentous fungi, and especially those of the genus Aspergillus, culture is advantageously carried out by any suitable method. The methods for culturing a strain of the genus Aspergillus are well known, and those skilled in the art know how to optimize the culture conditions for each strain according to its nature. Classical methods are described, in particular, in the reference work "Biology of the Fungal Cell," 3 èmeEdition, 2019, Hofimeister and Gressler, published by Springer Cham (ISBN 978-3-030-05448-9). In particular, the culture of a fungal strain other than a yeast, especially filamentous fungi, particularly of the genus Aspergillus, can generally be carried out at a temperature between 6°C and 47°C, preferably an optimal temperature of 35°C to 37°C, in a rich medium (for example YPD medium available from VWR) or synthetic (defined to precisely meet the needs of the strain), in aerobic or anaerobic culture.

[0385] Use of a nucleic acid molecule, a vector, or a host cell to produce a CAR comprising, essentially consisting of, or consisting of an amino acid sequence having at least 80% identity with SEQ ID NO: 2

[0386] The present invention further relates to the use of an isolated nucleic acid molecule or a combination of two isolated nucleic acid molecules, a vector or a combination of two vectors or a host cell according to the invention as described above to produce a CAR comprising, essentially made up of or made up of an amino acid sequence having at least 80% identity with SEQ ID NO: 2.

[0387] Methods for producing a CAR

[0388] The present invention further relates to a method for producing a carboxylase reductase (CAR) comprising, essentially consisting of, or consisting of an amino acid sequence having at least 80% identity with SEQ ID NO: 2.

[0389] According to one embodiment, the method for producing such a carboxylase reductase (CAR) comprises, is essentially made up of, or is made up of the following steps:

[0390] (i) the introduction of a nucleic acid molecule, a combination of nucleic acid molecules, a vector, or a combination of vectors according to the invention into a suitable host cell (as described above in the section concerning host cells according to the invention); and

[0391] (ii) the culture of the host cell obtained in step (i) in a culture medium under conditions permitting the expression of the nucleic acid molecule(s) or vector(s) contained in said host cell, so as to produce said CAR.

[0392] According to another embodiment, the method for producing such a CAR comprises, is essentially made up of, or is made up at least of the step consisting of:

[0393] (ii) the culture of a host cell according to the invention in a culture medium under conditions permitting the expression of the nucleic acid molecule(s) or vector(s) contained in said host cell, so as to produce said CAR.

[0394] Step (i) of introducing the nucleic acid molecule or vector into a suitable host cell can be carried out by any appropriate method known to a person skilled in the art, such as calcium phosphate transfection, transfection with liposomes comprising the nucleic acid molecule or vector to be transfected, transfection with polycationic agents, electroporation, and heat shock transfection. In particular, step (i) can be carried out by transfection (by any method described above) into the host cell of a transfer plasmid comprising the CAR-encoding sequence as defined above, flanked at the 5' and 3' ends by sequences homologous to genomic sequences of the host cell, thereby enabling homologous recombination between the transfer plasmid and the host cell genome.This method is particularly applicable when the host cell is a bacterium, especially of the genus Escherichia, preferably of the species Escherichia coli; a yeast, especially of the genus Saccharomyces, preferably of the species Saccharomyces cerevisiae; or a fungus, especially filamentous ones, particularly of the genus Aspergillus.

[0395] Step (ii) of culturing the host cell is carried out in a culture medium under conditions that allow the expression of the nucleic acid molecule contained in said host cell, so as to produce the CAR. These conditions vary depending on the host cell used and a person skilled in the art will be able to determine them based on their general knowledge (see also the section above concerning the host cells according to the invention).

[0396] The method for producing the CAR as defined above may further include at least one additional step chosen from the following steps:

[0397] (a) the recovery of host cells expressing said CAR and / or of the supernatant comprising said CAR, obtained after the culture step; and

[0398] (P) the purification of said CAR from the host cells and / or supernatant recovered in step (a).

[0399] The optional step (a) of recovering host cells expressing said CAR and / or the supernatant containing the CAR may be carried out by any appropriate technique known to those skilled in the art. The cells and the supernatant may, in particular, be separated by decantation or centrifugation. The optional step (P) of purifying the CAR from the host cells and / or the supernatant recovered in step (a) may be carried out by any appropriate technique known to those skilled in the art. When the CAR is purified from the supernatant, any liquid-phase protein purification technique may be used, such as various types of chromatography (gel filtration, ion exchange, hydrophobic interaction, affinity when the protein includes an affinity tag, high-performance liquid chromatography [HPLC]).When CAR is purified from cells or cells and supernatant, the purification further includes one or more preliminary step(s) of cell lysis and possibly removal of cell debris, before the use of a liquid-phase purification technique.

[0400] In any of the above methods, the more advantageously the host cell is isolated or organized into tissue, the more advantageously the host cell is isolated.

[0401] Methods for producing TPAL from TPA according to the invention

[0402] The present invention also relates to a method for producing terephthalaldehyde (TPAL) in vitro, comprising the steps of:

[0403] (iil) contacting in a terephthalic acid (TPA) reaction medium with a carboxylase reductase comprising essentially or consisting of an amino acid sequence having at least 80% identity with SEQ ID NO:2, the carboxylase reductase being activated by a bacterial phosphopantetheinyl transferase (PPT) or the reaction medium further comprising a bacterial phosphopantetheinyl transferase (PPT);

[0404] (iiil) the incubation of the reaction medium from step (iil) under suitable conditions to produce terephthalaldehyde (TPAL);

[0405] (ivl) optionally, the recovery of the reaction medium comprising the terephthalaldehyde (TPAL) obtained after step (iiil); and

[0406] (vl) optionally, the purification of terephthalaldehyde (TPAL) from the reaction medium recovered in step (ivl).

[0407] This method can be subdivided into two embodiments, depending on whether the method includes (emphasis MA) or not (emphasis MB) a prior step of CAR production as described above.

[0408] In embodiment MA, the invention relates to a method for producing TPAL in vitro, which comprises, is essentially made up of, or is made up of the following steps:

[0409] (il) the production of a carboxylase reductase comprising, essentially consisting of, or consisting of an amino acid sequence having at least 80% identity with SEQ ID NO:2 as described above by one of the production methods described above and, optionally, its activation by a bacterial phosphopantetheinyl transferase (PPT);

[0410] (iil) contacting TPA in a reaction medium with the CAR obtained in step (il) and, optionally, with a bacterial phosphopantetheinyl transferase (PPT);

[0411] (iiil) the incubation of the reaction medium from step (iil) under conditions suitable for producing TPAL;

[0412] (ivl) optionally the recovery of the reaction medium comprising the TPAL, obtained after step (iiil); and

[0413] (vl) optionally, the purification of TPAL from the reaction medium of step (ivl).

[0414] In embodiment MB, the invention relates to a method for producing TPAL in vitro, which comprises, is essentially made up of, or is made up of the following steps:

[0415] (iil) contacting in a reaction medium of TPA with a carboxylase reductase comprising essentially or consisting of an amino acid sequence having at least 80% identity with SEQ ID NO:2 as described above, the carboxylase reductase being activated by a phosphopantetheinyl transferase (PPT) or the reaction medium further comprising a bacterial phosphopantetheinyl transferase (PPT);

[0416] (iiil) the incubation of the reaction medium from step (iil) under conditions suitable for producing TPAL;

[0417] (ivl) optionally the recovery of the reaction medium comprising the TPAL, obtained after step (iiil); and

[0418] (vl) optionally, the purification of TPAL from the reaction medium of step (ivl).

[0419] For the purposes of these MA and MB methods, and in particular when the host cell is a bacterium (especially of the genus Escherichia, preferably of the species Escherichia coli):

[0420] - step (il) can be carried out by any method described herein to produce a carboxylase reductase (CAR) comprising, essentially consisting of, or consisting of an amino acid sequence having at least 80% identity with SEQ ID NO:2 as described above.

[0421] It may also optionally include CAR activation by a bacterial phosphopantetheinyl transferase (PPT).

[0422] - step (iil) consists of bringing the CAR into contact with its substrate TPA, and when the CAR has not been activated in step (il), with a bacterial phosphopantetheinyl transferase (PPT), in reaction medium to allow the production of TPAL.

[0423] This contact is made in a reaction medium and at a temperature that does not alter the enzymatic activity of CAR.A suitable reaction medium can be chosen from several media known to those skilled in the art (the medium chosen according to the enzyme's operating pH), such as, but not limited to: PIPES (Piperazinediethane sulfonic acid, CAS 5625-37-6, available from Thermo Scientific), HEPES (N-(2-hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid), CAS 7365-45-9, available from Sigma-Aldrich), MOBS (3-(N-morpholino)propanesulfonic acid, 4-morpholinopropanesulfonic acid, CAS 1132-61-2, available from Sigma-Aldrich), KPi (potassium phosphate, CAS 7778-77-0, available from Thermo Scientific), Tris-HCl (tromethane hydrochloride, CAS 1185-53-1, available from Merck) supplemented with cofactors (e.g. : ATP, CoA) or other electrolytes (Mg2+, NaCl) necessary for the proper functioning of the enzyme and advantageously has a pH between 6.5 and 8.5, and in particular between 6.5 and 7.5.An appropriate temperature range is 20 to 40°C, particularly 25 to 40°C, and more specifically between 30 and 35°C.

[0424] A bacterial phosphopantetheinyl transferase (PPT) will be added to the reaction medium if the CAR was not activated by a bacterial phosphopantetheinyl transferase (PPT) in step (il). However, it will not be necessary if the CAR was activated by a bacterial phosphopantetheinyl transferase (PPT) in step (il).

[0425] - Step (iiil) consists of incubating the reaction medium containing the activated CAR and its substrate (TPA) under conditions that allow for the production of TPAL. These conditions involve a reaction medium and an incubation temperature that do not alter the enzymatic activity of the CAR, as described above for step (ivl). The incubation time is chosen according to the amount of substrate (TPA) present in the medium. A person skilled in the art will be able to adjust the initial substrate concentration to the incubation time. It may also be considered to add substrate during the incubation period to continue the production of TPAL.

[0426] - when present, the (ivl) step of recovery of the reaction medium does not require any particular technique since there are no cells to exclude or lyse before purification.

[0427] - when present, the step (vl) of TPAL purification from the culture medium can be carried out by any appropriate technique, such as 1) crystallization (TPAL has a very low solubility of 1.22 g / L at 20°C in water, above which it crystallizes, making it easy to extract from the reaction medium) followed by ultrafiltration (membrane separation system which separates suspended particles between 1 and 100 nm); 2) A liquid or solid biphasic system known to those skilled in the art for selectively capturing aldehydes.

[0428] In all the above methods, the host cell is advantageously isolated or organized into tissue; more advantageously, the host cell is isolated. EXAMPLES

[0429] The following examples are intended to illustrate the present invention.

[0430] Example 1: Study of the activity of bacterial CARs co-expressed with a bacterial PPT

[0431] The activity of different bacterial CARs co-expressed with a bacterial PPT was studied.

[0432] Bacterial CARs studied

[0433] The bacterial CARs studied are presented in Table 14 below:

[0434] [Table 14]

[0435] PPT Identifications

[0436] The PPTs of Bacillus subtilis and Nocardia iowensis are known to effectively activate bacterial CARs.

[0437] Furthermore, PPTs belonging to the same bacterial genus as a studied CAR were identified using a search using the BLAST program using the PPT enzyme sequence of B. subtilis as a test sequence against a database containing all the nucleotide sequences of the strain containing the gene of the studied CAR.

[0438] In cases where no match was found (for some PPTs, only several operons of the organisms are in the databases, and for other PPTs, there is only partial genome coverage), the same type of search was performed on the entire genus of the strain containing the CAR gene under study.

[0439] The bacterial PPTs studied are presented in Table 15 below: [Table 15]

[0440] Construction of plasmids containing PPTs and CARs for expression in E. coli

[0441] The construction of plasmids containing PPTs and CARs for expression in E. coli is described below.

[0442] List of plasmids

[0443] The list of constructed plasmids is presented in Table 16 below. The sequences of the parent plasmids pBAD-HIS Addgene (SEQ ID NO: 54) and pET28 Addgene (SEQ ID NO: 55) are presented next.

[0444] [Tableau 16]

[0445] Plasmide pBAD-HIS (SEQ ID NO :54), disponible auprès d’Invitrogen, ref C43001:

[0446] AAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTGGCTCTTCTCGCT

[0447] AACCAAACCGGTAACCCCGCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAA

[0448] AAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCA

[0449] CACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGC.A

[0450] ACTCTCTACTGTTTCTCCATACCCGTTTTTTGGGCTAACAGGAGGAATTAACCATGGGGGGTTCTCA

[0451] TCATCATCATCATCATGGTATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGGGATCTGTACGA

[0452] CGATGACGATAAGGATCGATGGGGATCCGAGCTCGAGATCTGCAGCTGGTACCATATGGGAATTC

[0453] GAAGCTTGGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAG

[0454] AAGCGGTCTGATAAAACAGAATTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCC

[0455] GAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGA

[0456] ACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGT

[0457] TTGTCGGTGAACGCTCTCCTGAGTAGGACAA TCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAA

[0458] CGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGC

[0459] CATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTTGTTTATTTTTCTAAATACATTCAAAT

[0460] ATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATG

[0461] AGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCAC

[0462] CCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGA

[0463] ACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAG

[0464] CACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGG

[0465] TCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTAC

[0466] GGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCA

[0467] ACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATC

[0468] ATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGAC

[0469] ACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTA

[0470] GCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCG

[0471] GCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATC

[0472] ATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAG

[0473] GCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTA

[0474] ACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGG

[0475] GAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTG

[0476] CTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAAC

[0477] TCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCG

[0478] TAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTAC

[0479] CAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGG

[0480] ATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACC

[0481] TACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCCCACGCTTCCCGAAGGGAGAAA

[0482] GGCGGACAGGTATCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGG

[0483] GGAAACGCCTGGTATCTTTATAGTCCTGTCGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTTGT

[0484] GATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGG

[0485] CCTTTTGCTGCCTTTTGCTCACATGGTTCTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATT

[0486] ACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCGAACGACCGAGCGCAGCGAGTCAGTGAG

[0487] CGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCG

[0488] CATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTAT

[0489] CGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGG

[0490] CTTGTCTGCTCCCGGCATCCGCTTAGAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGA

[0491] GGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCAGATCAATTCGCGCGCGAAGGCGAAGCGG

[0492] CATGCATAATGTGCCTGTCAAATGGACGAAGCAGGGATTCTGCAAACCCTATGCTACTCGGTCAAG

[0493] CCGTCAATTGTCTGATTCGTTACCAATTATGACAACTTGACGGCTACATCATTCACTITTTCTTCACA

[0494] ACCGGCACGGAACTCGCTCGGGCTGGCCCCGGTGCATTTTTTAAATACCCGCGAGAAATAGAGTTG

[0495] ATCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGGTGGTGCTCAAAAGCAGCT

[0496] TCGCCTGGCTGATACGTTGGTCCTCGCGCCAGCTTAAGACGCTAATCCCTAACTGCTGGCGGAAAA

[0497] GATGTGACAGACGCGACGGCGACAAGCAAACATGCTGTGCGACGCTGGCGATATCAAAATTGCTG

[0498] TCTGCCAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCCATCGGTGGATGGAGC

[0499] GACTCGTTAATCGCTTCCATGCGCCGCAGTAACAATTGCTCAAGCAGATTTATCGCCAGCAGCTCC

[0500] GAATAGCGCCCTTCCCCTTGCCCGGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGG

[0501] TGCGCTTCATCCGGGCGAAAGAACCCCGTATTGGCAAATATTGACGGCCAGTTAAGCCATTCATGC

[0502] CAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCATTCGCGAGCCTCCGGATGACGACC

[0503] GTAGTGATGAATCTCTCCTGGCGGGAACAGCAAAATATCACCCGGTCGGCAAACAAATTCTCGTCC

[0504] CTGATTTTTCACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCCCAGCGGT

[0505] CGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCGTTAAACCCGCCACCAGATGGGC

[0506] ATTAAACGAGTATCCCGGCAGCAGGGGATCATTTTGCGCTTCAGCCATACTTTTCATACTCCCGCCA

[0507] TTCAGAG

[0508] Plasmid pET28 (SEQ ID NO :55 ), available from Novagen, ref. 69864 :

[0509] ATCCGGATATAGTTCCTCCTTTCAGCAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTT ATCTCAGTGGTGGTGGTGGTGCTCGAGTGCGGCCGCAAGCTGTCGACGGAGCTCGAATTCGG

[0510] ATCCGCGACCCATTTGCTGTCCACCAGTCATGCTAGCCATATGGCTGCCGCGCGGCACCAGGCCGC

[0511] TGCTGTGATGATGATGATGATGGCTGCTGCCCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTA

[0512] TTTCTAGAGGGGAATTGTTATCCGCTCAATTCCCCTATAGTGAGTCGTATTAATTTCGCGGGATC

[0513] GAGATCTCGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCCACAGGTGCGGTTGCT

[0514] GGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCT

[0515] TGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCAT

[0516] GCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAG

[0517] GAGTCGCATAAGGGAGAGCGTCGAGATCCCGGACACCATCGAATGGCGCCAAAACCTTTCGCGGTA

[0518] TGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATAC

[0519] GATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCAC

[0520] GTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCG

[0521] CGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCT

[0522] GCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGT

[0523] GGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGC

[0524] AACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTG

[0525] CCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTT

[0526] CTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGC

[0527] GCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTC

[0528] ACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAA

[0529] CAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATG

[0530] GCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTG

[0531] GGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTT

[0532] CGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGG

[0533] CAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGC

[0534] CTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGG

[0535] GCAGTGAGCGCAACGCAATTAATGTAAGTTAGCTCACTCATTAGGCACCGGGATCTCGACCGATGC

[0536] CCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCAC

[0537] TTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGG

[0538] CGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCA

[0539] CGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTAT

[0540] CGCCGGCATGGCGGCCCCACGGGTGCGCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTG

[0541] GCGGGGTTGCCTTACTGGTTAGCAGAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCT

[0542] GCTGCAAAACGTCTGCGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTC

[0543] TGGAAACGCGGAAGTCAGCGCCCTGCACCATTATGTTCCGGATCTGCATCGCAGGATGCTGCTGGC

[0544] TACCCTGTGGAACACCTACATCTGTATTAACGAAGCGCTGGCATTGACCCTGAGTGATTTTTCTCTG

[0545] GTCCCGCCGCATCCATACCGCCAGTTGTTTACCCTCACAACGTTCCAGTAACCGGGCATGTTCATCA

[0546] TCAGTAACCCGTATCGTGAGCATCCTCTCTCGTTTCATCGGTATCATTACCCCCATGAACAGAAATC

[0547] CCCCTTACACGGAGGCATCAGTGACCAAACAGGAAAAAACCGœCTTAACATGGCGCGCTTTATCA

[0548] GAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCTGGACGCGGATGAACAGGCAGACATC TGTGAATCGCTTCACGACCACGCTGATGAGCTTTACCGCAGCTGCCTCGCGCGTTTCGGTGATGAC

[0549] GGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGG

[0550] AGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCA

[0551] GTCACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGA

[0552] GTGCACCATATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGC

[0553] TCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTC

[0554] ACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCA

[0555] AAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCG

[0556] CCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTAT

[0557] AAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTAC

[0558] CGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTAT

[0559] CTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGAC

[0560] CGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTG

[0561] GCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAA

[0562] GTQGTQGCCTAACTACGGCTACACTAGAAGGACAQTATTTGQTATCTGCGCTCTGCTGAAQCCAGT

[0563] TACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTT

[0564] TTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTC

[0565] TACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAACAATAAAAC

[0566] TGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTGCT

[0567] CTAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATG

[0568] TCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGA

[0569] AACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACG

[0570] GAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCA

[0571] CTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAATATCCTGATTCAGGTGAAAATATTG

[0572] TTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGC

[0573] GATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGAT

[0574] TTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCA

[0575] TTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACGTTATTTTTGACGAGGGGA

[0576] AATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCG

[0577] TATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAAACGGCTTTTTCAAAAATATGGTATTGA

[0578] TAATCCTGATATGAATAATTCAGTTTCATTTGATGCTCGATGAGTTTTTCTAAGAATTAATTCAT

[0579] GAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGTTCCGCGCACATTTCCCCG

[0580] AAAGTGCCACCTGAAATTGTAAACGTTAATATTTTGTAAATTCGCGTTAAAATTTTTGTTAAATC

[0581] AGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAG

[0582] ATAGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTC

[0583] AAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTT

[0584] TTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCGATTTAGAGCTTG

[0585] ACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAG

[0586] GGCCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCT

[0587] ACAGGGCGCGTCCCATTCGCCA Plasmid combinations used for co-expression

[0588] Different combinations were used:

[0589] - Combination a: E. coli BL21 AI is transformed with each pBAD-HIS plasmid containing the different CARs expressed in E. coli.

[0590] - Combinations b and c: E. coli BL21 AI is transformed with each pBAD-HIS plasmid containing the different CARs, as well as the pl5 / T7 plasmid containing the PPT of B subtilis (example pBAD- CARA1-HIS with T7 / pl5 PPT Pl 1 B subtilis) in E. coli BL21 AI. The CAR is then purified using the HI S tag.

[0591] - Combinations of d and e: E. coli BL21 AI is transformed with each pBAD-HIS plasmid containing the different CARs and is co-expressed, as well as the pl5 / T7 plasmid containing the associated PPT from the CAR's originating organism (e.g., pBAD-CARAl-HIS with T7 / pl5 PPT PI). The CAR is then purified using the HIS tag.

[0592] The sequenced plasmids were transfected into E. coli BL21 AI. This strain has the T7 polymerase gene under the control of the araBAD operon (while arabinose metabolism is deactivated), and can be used for the expression of enzymes encoded on pBAD vectors and encoded on pET / T7 vectors as well as for the co-expression of proteins carried by these vectors.

[0593] Plasmid construction

[0594] pBAD-HIS plasmids containing CARs with HIS label (for purification)

[0595] The nucleotide sequences of CARs, as well as the sequence of the B. subtilis PPT, have been optimized for expression in E. coli. The sequences are ordered as synthetic genes. They are assembled in the pBAD-HIS plasmid upstream of the HIS tag via Golden Gate. The B. subtilis PPT is also purified, as are the CARs, for in vitro CAR activation experiments (see section on in vitro CAR activation by B. subtilis PPT below).

[0596] T7 / pl5 plasmids containing PPTs from the native organisms of the CARs used, as well as the PPT of B subtilis (for co-expression)

[0597] For the co-expression of PPTs (unpurified, therefore without the HIS tag), a second vector containing a different resistance marker, a different expression system, and a different origin of replication for the pBAD-HIS plasmid was required. The pET28 plasmid, containing the T7 promoter and a kanamycin selection marker, was chosen. Using the Gibson construction technique, the origin of replication of pET28 (i.e., the pRB322 origin, identical to that of pBAD-HIS) was replaced with the pl5A origin of replication (ORI P15A) with SEQ ID NO:66, shown in Table 17 below. [Table 17]

[0598] Growing conditions

[0599] Transfected bacteria are cultured in 0.5 L of TB with 100 µg / mL ampicillin (for the pBAD vector) and 50 µg / mL kanamycin (for the p15 / T7 vector). They are inoculated at a 1 / 100 ratio. Protein expression is induced by 0.002% (w / v) L-arabinose and 1 mM IPTG after 4 hours of culture at 37°C when the OD at 600 nm (OD = Optical Density) is approximately 0.6. The bacteria are then cultured for an additional 36 hours at 24°C.

[0600] CAR enzyme purification

[0601] After culture, the bacteria were recovered, lysed, and then centrifuged. To do this, they were resuspended in 40 mL of Buffer A (50 mM KPi pH 7.5, 150 mM NaCl) with 0.1 mM PMSF and lysed by sonication (10 min net sonication at 70% amplitude). After centrifugation at 21,000 x g for 60 min, the supernatant was loaded onto a 2 mL Ni-Sepharose column. After washing with Buffer A containing 20 mM imidazole, the protein was eluted using Buffer A containing 500 mM imidazole. The resulting 2.5 mL solution containing the protein and imidazole was desalted in Buffer A using DG 10 size-exclusion columns, yielding a final volume of 3 mL per protein. Concentrations were determined by NanoDrop assay, using the formula 1 abs = 1 mg / mL. To confirm expression and determine purity, 0.1 μL of purified protein was loaded onto a 12% SDS-PAGE gel.We observe an expression of the CARs studied at approximately 130 kDa and the presence of PPT at approximately 26 kDa (see Figure 1).

[0602] The concentrations obtained are presented in Table 18 below.

[0603] [Table 18]

[0604] In vitro activation of CARs by PPT of B subtilis

[0605] In addition to being co-expressed with PPTs from the same organism as the CARs or the B. subtilis PPTase, the purified CAR enzymes are activated in vitro with B. subtilis PPT (only for Example 1). For this purpose, 3 mg / mL of CAR and 3 mg / mL of B. subtilis PPT and 1 mM CoA are incubated for 1 hour at 22°C in buffer A (150 mM NaCl / 50 mM KPi pH 7.5). These enzymes are then used as is for the subsequent reactions with the different substrates.

[0606] In vitro conversion reaction of substrates by CARs

[0607] Each reaction has a final volume of 200 μL and is performed in a 96-well microplate. 0.05 pM CAR enzymes are contacted with 0.5 mM TPA in 50 mM potassium phosphate buffer at pH 7.5, 150 mM NaCl, 20 mM MgCl₂, 2.5 mM NADPH, and 2.5 mM ATP. The TPA is dissolved in DMSO before being added to the reaction. The final DMSO concentration for each reaction after substrate addition is 5% v / v. The reaction is carried out for 3 hours at room temperature (22°C).

[0608] Final enzyme concentration for the 200 μL reaction = 2 mg / mL or 15 pM, i.e., 0.4 mg enzyme per 200 μL reaction

[0609] Detection of metabolites by HPLC

[0610] The reaction is stopped by adding 200 μl of acetonitrile to precipitate the proteins and the MgCl2 present in the reaction. After centrifugation for 10 min at 20,000 g, the supernatant is collected and transferred to flasks for HPLC analysis. CAR metabolites are detected by HPLC using an adapted method developed by Willem Dijkman (Dijkman, WP 2015). The method used is described below:

[0611] - System: ThermoFisher Vanquish HPLC equipped with a quaternary pump

[0612] - Column: Gemini NX C18, 5 μm x 250 mm x 4.6 mm (Phenomenex)

[0613] - Mobile phase: Buffer A: 0.1% formic acid adjusted to pH 3.10, Buffer B: acetonitrile - Flow rate: µL / min

[0614] - Composition: 32% buffer B, isocratic

[0615] - Detection: Diode array detection (DAD), measuring wavelengths between 200 and 500 nm

[0616] - Injection: 5μL

[0617] - Analysis time: 12 min

[0618] Terephthalic acid (TP A), NADPH, and ATP are eluted in approximately 1 minute at 230 nm.

[0619] The TPAL is eluted after 7 minutes at 260 nm.

[0620] TPA to TPAL Conversion Results The results obtained for the substrate Terephthalic acid (TPA) and the metabolite terephthalaldehyde (TPAL) after 3 hours of incubation are presented in Table 19 below.

[0621] [Table 19]

[0622] Conclusion

[0623] The data presented above show that CARs A1, A2, A3 and A7 are capable of converting TPA to TPAL, but that CAR A2 has better TPA to TPAL conversion activity than CARs A1, A3 and A7.

[0624] Example 2: Study of the activity of CAR A2 of Segniliparus rugosus in comparison with CAR A1 of Mycobacterium marinum

[0625] The same method, co-expression protocols, enzyme purification, and HPLC analysis described in Example 1 were used. However, there was no in vitro activation of CARs by B. subtilis PPT, in addition to their co-expression with a PPTase in cellulo.

[0626] Two expression conditions were tested for CAR Al:

[0627] - co-expression of CAR A1 with PPT Nocardici iowensis (P3) in cellulo,

[0628] - co-expression of CAR A1 with PPT from the same organism as CAR Al (Mycobacterium marinum, PI) in cellulo

[0629] An expression condition was tested for CAR A2:

[0630] - co-expression of CAR A2 with PPT from the same species as CAR A2 (Segniliparus rotundus, P2) in cellulo

[0631] The reaction conditions with the substrates have changed compared to Example 1, and are detailed below. Each reaction has a final volume of 200 μL and is carried out in a 96-well microplate.

[0632] For the TPA substrate:

[0633] 1 pM of CAR enzyme is reacted with 1 mM of TPA in 50 mM potassium phosphate buffer at pH 7.5, 150 mM NaCl, 20 mM MgCl₂, 2.5 mM NADPH, and 2.5 mM ATP. The TPA is dissolved in DMSO before being added to the reaction. The final DMSO concentration for each reaction after substrate addition is 5% v / v. The reaction is carried out for one hour at 25°C.

[0634] The results obtained for the substrate terephthalic acid (TPA) and the reaction product terephthalaldehyde (TPAL) after 1 hour of incubation at 25°C are presented in Table 20 below. [Table 20]

[0635] CAR A2 co-expressed with PPT from the organism / genus of origin exhibits a higher conversion rate of TPA to TPAL than CAR A1 co-expressed with PPT from B. subtilis or the organism of origin, under the conditions mentioned above. The conversion rate of TPA to TPAL obtained with CAR A2 / PPT P2 is 2.3 times higher than that obtained with CAR A1 / PPT PI and 3.5 times higher than that obtained with CAR A1 / PPT P3. CAR A2 is therefore the best enzyme for converting TPA to TPAL.

[0636] Example 3: Study of CAR A2 activity with several pH and temperature ranges

[0637] In order to better understand the operation of the CAR A2 and to find the optimal conversion conditions (substrate, product, pH, temperature), an experimental plan was carried out.

[0638] The same CAR A2 enzyme from Example 1 (co-expression of CAR A2 and PPT, with PPT originating from the same bacterial genus as CAR) was used. However, unlike Example 1, there was no in vitro activation by PPT of B. subtilis in addition to in-cell co-expression.

[0639] The same method and protocols for co-expression, enzyme purification, and HPLC analysis as in Example 1 were used. Only the reaction conditions with the substrates changed and are detailed below. Each reaction has a final volume of 200 μL and is performed in a 96-well microplate. 0.05 pM CAR A2 is contacted with 0, 0.1, 0.3, or 0.5 mM TPA in 50 mM potassium phosphate buffer at pH 7.5, 6.5, or 8.5, 150 mM NaCl, 20 mM MgCl2, 2.5 mM NADPH, and 2.5 mM ATP. The TPA is solubilized beforehand with DMSO before being added to the reaction. The final DMSO concentration for each reaction after substrate addition is 5% v / v. The reaction takes place over one hour and 15 minutes or two hours and 15 minutes at a temperature of 25°C, 30°C or 35°C. The different parameters tested are detailed in Table 21 below.

[0640] [Table 21]

[0641] The results obtained for the substrate terephthalic acid (TPA) and the reaction product terephthalaldehyde (TPAL) under the different tested conditions are presented in Tables 22 and 23 below. [Table 22]

[0642] [Table 23]

[0643] Lowering the pH to 6.5 increases the conversion rate of TPA to TPAL. Increasing the temperature to 35°C improves the conversion rate. Finally, increasing the reaction time also improves the conversion rate.

[0644] In conclusion, the optimal in vitro activity conditions of CAR A2 for the conversion of TPA to TPAL are a pH of 6.5 and a temperature of 35°C, but satisfactory conversion can be obtained at a pH between 6 and 8, especially between 6.5 and 7.5 and at a temperature between 28°C and 38°C, especially between 30 and 35°C.

[0645] Example 4: Effect of different bacterial PPTs on the activation of CAR A2 in Segniliparus rugosus

[0646] The objective is to demonstrate that several CAR A2 and PPT pairs exist that can convert TPA to TPAL. Therefore, the conversion rates of TPA to TPAL using CAR A2 co-expressed with three different PPTs were compared.

[0647] The CAR A2 enzyme, produced and purified under the same conditions as in Example 1, was used. However, there was no in vitro activation by PPT of B. subtilis beyond in cellulo co-expression.

[0648] Three expression conditions were tested for CAR Al:

[0649] - co-expression CAR A2 with PPT from the same species as CAR A2 (Segniliparus rotundus, P2),

[0650] - CAR A2 co-expression with Bacilus subtilis PPT (P11), and

[0651] - CAR A2 co-expression with Nocardia iowensis PPT (P3).

[0652] The same method and protocols for co-expression, enzyme purification and HPLC analysis as those of Example 1 were used.

[0653] Only the reaction conditions with the substrates have changed, and are detailed below.

[0654] Each reaction has a final volume of 50 μL and is performed in a 96-well microplate. For the TPA substrate:

[0655] 2 μM of CAR A2 (with the 3 expression conditions mentioned above) is contacted with 1 mM of TPA in 50 mM potassium phosphate buffer at pH=7.5, 150 mM NaCl and 20 mM MgCl2,

[0656] 2.5 mM NADPH, 2.5 mM ATP. The TPA is dissolved beforehand in DMSO before being added to the reaction. The final DMSO concentration for each reaction after substrate addition is 5% v / v. The reaction takes place for one hour at 25°C.

[0657] The results obtained for the substrate terephthalic acid (TPA) and the reaction product terephthalaldehyde (TPAL) after 1 hour of incubation at 25°C are presented in Table 24 below.

[0658] [Table 24]

[0659] Several CAR A2 and PPT pairs convert TPA to TPAL. The CAR A2 and PPT pair from Bacillus subtilis appears to be the most promising, under the experimental conditions defined above, for obtaining TPAL from TPA. BIBLIOGRAPHICAL REFERENCES:

[0660] "Yeast Technology", 2nd Edition, 1991, Reed and Nagodawithana, published by Van Nostrand Reinhold (ISBN 0-442-31892-8)

[0661] “Biology of the fungal cell”, 3 eme Edition, 2019, Hoffineister and Gressler, published by Springer Cham (ISBN 978-3-030-05448-9)

[0662] "Microbial Culture", 1st Edition, 1995, Isaacs and Jennings, published by Garland Science (ISBN 9781872748924)

[0663] Aditya M. Kunjapur, Kristala L. J. Prather. Microbial Engineering for Aldehyde Synthesis (2015). Applied and Environmental Microbiology. DOI: 0.1128 / AEM.03319-14

[0664] Aditya M. Kunjapur, Yekaterina Tarasova, and Kristala L. J. Prather. Synthesis and Accumulation of Aromatic Aldehydes in an Engineered Strain of Escherichia coli. Journal of the American Chemical Society 2014 136 (33), 11644-11654. DOI: 10.1021 / ja506664a

[0665] Baudoin Delépine, et al. RetroPath2.0 : A retrosynthesis workflow for metabolic engineers. Metabolic Engineering. 2018, 45, ppl58-170

[0666] Beld J. et al. The phosphopantetheinyl transferases: catalysis of a post-translational modification crucial for life. Nat. Prod. Rep., 2014,31, 61-108

[0667] Cambray G, Guimaraes JC, Mutalik VK, Lam C, Mai QA, Thimmaiah T, Carothers JM, Arkin AP, Endy D. Measurement and modeling of intrinsic transcription terminators. Nucleic Acids Res. 2013 May;41(9):5139-48.

[0668] CN107303486

[0669] Dijkman, W. P. (2015). HMF oxidase: Characterization, application and engineering of 5- (hydroxymethyl)fiirfiiral oxidase. [Thesis University of Groningen]

[0670] Gopal Madan R. et al. Reductive Enzyme Cascades for Valorization of PolyethyleneTerephthalate Deconstruction Products. ACS Catal. 2023, 13, 4778-4789.

[0671] Hansen EH, Moller BL, Kock GR, Bünner CM, Kristensen C, Jensen OR, Okkels FT, Olsen CE, Motawia MS, Hansen J. De novo biosynthesis of vanillin in fission yeast (Schizosaccharomyces pombe) and baker's yeast (Saccharomyces cerevisiae). Appl Environ Microbiol. 2009 May;75(9):2765-74. doi: 10.1128 / AEM.02681-08

[0672] Holly Stolterfoht, Daniel Schwendenwein, Christoph W. Sensen, Florian Rudroff, Margit Winkler. Four distinct types of E.C. 1.2.1.30 enzymes can catalyze the reduction of carboxylic acids to aldehydes. Journal of Biotechnology (2016). DOI: 10.1016 / j.jbiotec.2017.02.014

[0673] Holly Stolterfoht, et al. Four distinct types of E.C. 1.2.1.30 enzymes can catalyze the reduction of carboxylic acids to aldehydes. Journal of Biotechnology (2016). DOI: 10.1016 / j.jbiotec.2017.02.014 JP20000229897

[0674] JP2004008149 Kimple ME, Brill AL, Pasker RL. Overview of affinity tags for protein purification. Curr Protoc Protein Sci. 2013 Sep 24;73:9.9.1-9.9.23. doi: 10.1002 / 0471140864.ps0909s73

[0675] Margit Winkler and Jonathan Guyang Ling Biocatalytic Carboxylate Reduction - Recent Advances and New enzymes. ChemCatChem 2022, 14,e20220441

[0676] Margit Winkler and Jonathan Guyang Ling Biocatalytic Carboxylate Reduction - Recent Advances and New enzymes. ChemCatChem 2022, 14,e20220441

[0677] Margit Winkler. Carboxylic acid reductase enzymes (CARs). Current Opinion in Chemical Biology (2017). DOI: 10. 1016 / j.cbpa.2017. 10.006 ;

[0678] Needleman et Wunsch. J. Mol. Biol. 48,443-453, 1970

[0679] Thomas Bayer, et al. Biosensor and chemo-enzymatic one-pot cascade applications to detect and transform PET-derived terephthalic acid in living cells. iScience, Volume 25, Issue 5, 2022, 104326.

[0680] Tralau, T., et al., Map of the IncPlb plasmid pTSA encoding the widespread genes (tsa) forp- toluenesulfonate degradation in Comamonas testosteroni T-2. Appl. Environ. Microbiol. 67, 1508-1516 (2001).

[0681] US2446430

[0682] US2948756

[0683] US4465865

[0684] William Linnigan, et al. Characterization of Carboxylic Acid Reductases as Enzymes in the Toolbox for Synthetic Chemistry (2017). DOI : 10.1002 / cctc.201601249 W02008075901

[0685] W02020024917A1

[0686] WO2023215742A2

[0687] Winkler et al. Carboxylic acid reductase enzymes (CARs) Curr Opin Chem Biol 43:23-29 (2018).

[0688] Finnigan et al. Characterization of carboxylic acid reductases as enzymes in the toolbox for synthetic chemistry. ChemCatChem 9 : 1005-1017 (2017).

Claims

DEMANDS 1. Use of a carboxylase reductase (CAR) comprising an amino acid sequence having at least 80% identity with SEQ ID NO:2 to produce terephthalaldehyde (TPAL) from terephthalic acid (TP A).

2. Use according to claim 1, characterized in that the carboxylase reductase is selected from the carboxylase reductases of bacteria of the genus Segniliparus, advantageously the carboxylase reductase is selected from the carboxylase reductases of bacteria of the species Segniliparus rugosus.

3. Use according to claim 1 or claim 2, characterized in that the amino acid sequence of the carboxylase reductase comprises SEQ ID NO:

2.

4. Use according to claim 3, characterized in that the amino acid sequence of the carboxylase reductase consists of SEQ ID NO:

2.

5. Use according to any one of claims 1 to 4, characterized in that a carboxylase reductase activated by a bacterial phosphopantetheinyl transferase (PPT) is used.

6. Use according to claim 5, characterized in that: a) the bacterial phosphopantetheinyl transferase is of the same bacterial genus as the carboxylase reductase; b) the bacterial phosphopantetheinyl transferase is selected from the phosphopantetheinyl transferases of bacteria of the genera Segniliparus, Mycobacteroides, Nocardia, Bacillus, and Escherichia; advantageously bacterial phosphopantetheinyl transferase is selected from phosphopantetheinyl transferases of bacteria of the species Segniliparus rotundus Mycobacteroides immunogenum, Nocardia iowensis, Bacillus Subtilis, and Escherichia coli, c) bacterial phosphopantetheinyl transferase is selected from phosphopantetheinyl transferases whose amino acid sequence has at least 80% identity with a sequence selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, SEQ ID NO: 9; or d) any combination of a) to c).

7. An isolated nucleic acid molecule comprising a nucleic acid sequence encoding a carboxylase reductase as defined in any one of claims 1 to 4, characterized in that: a) the isolated nucleic acid molecule further comprises a promoter controlling the expression of the nucleic acid sequence; or b) the isolated nucleic acid molecule further comprises a transcription terminator controlling the expression of the nucleic acid sequence; or c) the nucleic acid sequence is further optimized for expression in a host cell, in particular a fungus (such as yeast or filamentous fungus) or a bacterium; or d) any combination of a) to c).

8. Isolated nucleic acid molecule or combination of two isolated nucleic acid molecules comprising: a) a nucleic acid sequence encoding a carboxylase reductase (CAR) as defined in any one of claims 1 to 4; and b) a nucleic acid sequence encoding a bacterial phosphopantetheinyl transferase (PPT) as defined in any one of claims 5 and 6.

9. Vector or combination of two vectors comprising an isolated nucleic acid molecule or a combination of two isolated nucleic acid molecules according to any one of claims 7 and 8, said vector preferably being a plasmid.

10. Host cell comprising an isolated nucleic acid molecule or a combination of two isolated nucleic acid molecules according to any one of claims 7 and 8, or a vector or a combination of two vectors according to claim 9.

11. Host cell according to claim 10, characterized in that said host cell is: a) a bacterium, advantageously selected from the genera Escherichia, Pseudomonas, Bacillus, Tepidihacillus, Klebsiella, Enterobacter, Serratia, Rhodococcus, Nocardia, Amycolatopsis, more particularly from the species Escherichia coli, Pseudomonas putida, Pseudomonas nitroreducens, Pseudomonas chloraphis, Bacillus subtilis, Cornebacterium glutamicum, Tepidihacillus fermentons, Klebsiella aerogenes, Enterobacter hormaechei, Serratia marcescens, Rhodococcus rhodochrous, Nocardia iowensis, Amycolatopsis mediterranei, - even more particularly, the bacterium is of the genus Escherichia, preferably of the species Escherichia coli, ' or b) a yeast, advantageously selected from the genera Saccharomyces, Candida, Ashbya, Dekkera, Pichia (Hansenula), Debaryomyces, Clavispora, Lodderomyces, Yarrowia, Zigosaccharomyces, Schizosaccharomyces, Torulaspora, Kluyveromyces,Brettanomycces, Cryptococcus stMalassezia, ' more particularly among the species Saccharomyces cerevisiae, Saccharomyces boulardii, Saccharomyces douglasii, Saccharomyces bayanus, Zigosaccharomyces bailii, Schizosaccharomyces pombe, Candida tropicalis, Pichia pastoris, Yarrowia lipolitica, Dekkera brucelensis, Dekkera intermedia, Brettanomycces custersii, Brettanomycces intermedius, Kluyveromyces themotolerens, Torulaspora globosa or Torulaspora glabrata; even more, in particular, the yeast is of the genus Saccharomyces, preferably of the species Saccharomyces cerevisiae; or c) a filamentous fungus, advantageously the fungus is of the genus Aspergillus.

12. Use of an isolated nucleic acid molecule or a combination of two isolated nucleic acid molecules according to claim 7 or claim 8, or of a vector or a combination of two vectors according to claim 9 to produce a carboxylase reductase as defined in any one of claims 1 to 4.

13. A method for producing a carboxylase reductase as defined in any one of claims 1 to 4, comprising: (ii) the culture of a host cell according to claim 10 or claim 11 in a culture medium under conditions permitting the expression of the nucleic acid molecule(s) or vector(s) contained in said host cell, so as to produce said carboxylase reductase.

14. Method for producing terephthalaldehyde (TPAL) in vitro, comprising the steps of: (i) contacting in a reaction medium of terephthalic acid (TP A) with a carboxylase reductase as defined in any one of claims 1 to 4, the carboxylase reductase being activated by a bacterial phosphopantetheinyl transferase (PPT) or the reaction medium further comprising a bacterial phosphopantetheinyl transferase (PPT); (iiil) the incubation of the reaction medium from step (iil) under suitable conditions to produce terephthalaldehyde (TPAL); (ivl) optionally, the recovery of the reaction medium comprising the terephthalaldehyde (TP AL) obtained after step (iiil); and (vl) optionally, the purification of terephthalaldehyde (TPAL) from the reaction medium recovered in step (ivl).

Citation Information

Patent Citations

  • Hydrofining catalyst and preparation method thereof

    CN107303486A

  • Production of carboxylic acid anhydride and aldehyde

    JP2000229897A

  • Production method using xylene monooxygenase

    JP2004008149A

  • Chlorination of hydrocarbons

    US2446430A

  • Terephthalaldehyde preparation

    US2948756A