Fusion protein for seralbumin and interferon

A technology of serum albumin and human serum albumin, applied in the field of fusion proteins, can solve the problems of short plasma half-life, increased patient suffering and treatment costs, as long as several months or even years, and achieve the effect of prolonging the plasma half-life.

Inactive Publication Date: 2010-07-07
INST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE +2
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Due to the small molecular weight of IFN, it is easy to be filtered by the glomerulus. Therefore, in clinical application, the plasma half-life is short, and it generally requires frequent medication in large doses, such as 2-3 times a week. IFN treats hepatitis, tumors, and multiple sclerosis. , rheumatoid and other diseases, the treatment cycle often lasts for several months or even years. This kind of long-term high-dose frequent medication not only increases the patient's pain and treatment costs, but also easily produces toxic and side effects.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein for seralbumin and interferon
  • Fusion protein for seralbumin and interferon
  • Fusion protein for seralbumin and interferon

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1: Cloning of HSA cDNA

[0046] The HSA cDNA with the signal peptide and propeptide coding sequences was obtained from the human liver fetal cDNA library (purchased from Clontech Laboratories Inc.USA) by PCR method, and the primers HSA1 and HSA2 used were synthesized with an oligonucleotide synthesizer, wherein the primers In addition to the 3' end sequence of the HSA gene, HSA2 also added a sequence encoding a GlyGlyGlyGlySer linker peptide after the 3' end.

[0047] HSA1:5'GC TTCGAA ACCATGAAGTGGGTAACCTTTATTTCCCT3'

[0048] HSA2: 5'TA GGATCC ACCACCACCAAGGCCTAAGGCAGCTTGACTTGC3'

[0049] The PCR conditions were: 1 μl of human hepatic fetal cDNA library, 3 μl of 20 μmol / L HSA1 and HSA2 primers, 10 μl of 2 mmol / L dNTP, 10 μl of 10X reaction buffer, 5 U of TaqplusI DNA polymerase in 100 μl reaction system. Using a 9600 PCR instrument from Perk-Elmer, the PCR conditions were denaturation at 94°C for 1 minute, annealing at 52°C for 1 minute, extension at 72°C fo...

Embodiment 2

[0053] Example 2: cDNA Cloning of IFNα

[0054] Take normal human peripheral blood and add separation lymphocyte stratification solution, separate human leukocytes, culture in DMEM medium containing 5% fetal bovine serum, add Newcastle disease virus and culture at 37°C for 1 hour, centrifuge to discard the supernatant, and add the medium again , 37°C, 5% CO 2 Incubate for 18 hours. Total RNA was isolated with an RNA extraction kit, reverse-transcribed cDNA was obtained with a general-purpose RT-PCR kit (both kits were purchased from Beijing Broadtech Biogene Technology Co., Ltd., and the specific operation was performed according to the instructions), and obtained by PCR. cDNA of IFNα. The primers used are slightly different according to the different IFNα subtypes to be cloned, such as cloning IFNα 2b, IFNα 2a, the primers are available:

[0055] IFNα2b-1: 5'---ATGGATCC TGT GAT CTC CCT CAA ACC CAC AG---3'

[0056] IFNα2b-2: 5'---ATGAATTC TTA TTC CTT ACT CCT TAA TCT TTC TT...

Embodiment 3

[0062] Example 3: cDNA Cloning of IFNβ

[0063] Human amnion cells (Wish cells, provided by the Cell Bank of the Chinese Academy of Sciences) were cultured with 1640 medium containing 10% calf serum until the cells covered the bottom of the bottle, discarded the medium, and added 100 U / ml IFN and 10% calf serum The 1640 medium was continued to be cultured for 16 hours, and the medium was discarded. Add 1640 medium containing 50 μg / ml polyinosinic acid and 10 μg / ml cycloheximide to continue culturing for 4 hours, then add 1 μg / ml actinomycin D for 5 hours. Discard the supernatant, digest with trypsin, collect the cells, use the RNA extraction kit to isolate the total RNA, and use the general RT-PCR kit (both kits were purchased from Beijing Broadtech Biogene Technology Co., Ltd., the specific operation is as follows: Instructions) to obtain reverse-transcribed cDNA, obtain the cDNA of IFNβ by the method of PCR, and its primers can be used:

[0064] IFNβ-1: 5'ATGGATCC ATG AGC ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a fusional protein of a serum albumin and an interferon, the coding of the fusional protein DNA sequence, as well as bacteria, barm, animal cell and plant cell of the DNA sequence. The fusional protein provided by the present invention includes a first district with at least 85 percents congeneric sequence of the artificial serum albumin and a second district with at least 85 percents congeneric sequence of the artificial interferon. Without changing the property of the fusional protein, the fusional protein can implement the replacement, deficit or addition ofexceptional amide acid residue. A connecting peptide is arranged between the first district and the second district of the fusional protein provided by the present invention; the general formula of the connecting peptide is [GlyGly GlyGlySer]n and n is an integer from 1 to 10. The fusional protein provided by the present invention with the property of artificial interferon and prolonged half-value period will be widely applied in the medicine field.

Description

[0001] This application is a divisional application of a Chinese patent application filed on August 10, 2001, with the application number 01124110.1 and the title of the invention "Fusion Protein of Serum Albumin and Interferon". technical field [0002] The invention relates to a fusion protein, especially a fusion protein of serum albumin and interferon. Background technique [0003] Serum albumin is an important component of plasma, and is also the carrier of many endogenous factors and exogenous drugs, and it is difficult to penetrate the glomerulus under normal circumstances. Human serum albumin (sequence 1) is a protein composed of 585 amino acid residues (A.Dugaiczyk et al., PNAS, 198279:71-75), its molecular weight is about 66.5KD, and its plasma half-life is as long as more than 2 weeks . [0004] Human serum albumin (HSA) is synthesized in cells in the form of a propeptide containing a signal peptide of 18 amino acid residues and 6 propeptides, which are excised d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K19/00C07K14/76C12N15/63C12N1/19C12N15/62
Inventor吴军巩新唱韶红马清钧
OwnerINST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE