A biotin:avidin-based secondary antibody:transposase complex and its application in detecting protein-DNA interactions

Abstract

The invention provides a biotin:avidin-based secondary antibody:transposase complex and its application in detecting the interaction between protein and DNA.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology. The present invention specifically relates to a biotin:avidin-based secondary antibody:transposase complex and a mixture thereof. The present invention specifically relates to the use of the complex or the mixture thereof in detecting protein-DNA interactions. The present invention specifically relates to a method and its application that can improve the accuracy of detecting protein-DNA interactions, effectively reduce background and increase the yield of real data. Background Art

[0002] Chromatin immunoprecipitation (ChIP) is a widely used method to study protein-DNA interactions, and is usually used to study transcription factor binding sites or histone-specific modification sites. Combining ChIP with massively parallel DNA sequencing technology allows researchers to accurately map the global DNA binding sites of proteins of interest. The basic process of ChIP is: (1) Cross-linking: using formaldehyde to fix tissues or cells so that DNA and proteins are tightly bound; (2) Fragmentation: this process destroys chromatin and ultimately obtains DNA fragment protein complexes for ChIP analysis; (3) Chromatin immunoprecipitation: by adding antibodies against the target protein, the target protein-DNA complex is bound; (4) DNA recovery and purification: the recovered DNA fragments are purified and enriched, and the DNA sequence information specifically bound to the target protein is analyzed by downstream detection technology (quantitative PCR, gene chip, sequencing, etc.) (doi:10.1038 / nrg2641)( Figure 1 ). However, because ChIP technology requires formaldehyde cross-linking of tissues or cells and then DNA fragmentation, this technology requires an extremely high initial cell input (millions), and it is very likely that excessive formaldehyde cross-linking will cause false positives in the experimental results.

[0003] In order to make up for the technical defects of ChIP, researchers have developed CUT&Run (Cleavage Under Targets&Release Using Nuclease) technology and CUT&Tag (Cleavage Under Targets&Tagmentation) technology through continuous updating and optimization (DOI: 10.7554 / eLife.21856.001; doi.org / 10.1038 / s41467-019-09982-5). CUT&Tag and CUT&Run are technologies for studying the interaction between proteins and DNA in living cells. They use antibodies to enrich Tn5 transposase or MNase nuclease to specifically cut the DNA near the target protein, and then construct and sequence the library of the marked DNA after cutting to map the global DNA binding site of the target protein ( Figure 2). Because this technology does not require cross-linking and physical disruption of DNA, it alleviates the shortcomings of CHIP technology such as false positives and high cell input to a certain extent.

[0004] Although CUT&Tag and CUT&Run technologies are significantly improved compared to ChIP, CUT&Tag and CUT&Run rely on the PA / PG-Tn5 / MNase fusion protein to bind to the Fc segment of the secondary antibody, and then bring Tn5 / MNase to the vicinity of the target protein region for DNA cleavage. On the one hand, this process is limited by the binding ability of the PA / PG protein to the Fc segment of the secondary antibody. On the other hand, the quantitative relationship between the PA / PG-Tn5 / MNase fusion protein and the secondary antibody is difficult to quantify, which is very likely to lead to excessive PA / PG-Tn5 / MNase fusion protein incubation. Unspecifically bound PA / PG-Tn5 / MNase fusion protein will non-specifically cut the open region of chromatin during the CUT&Tag / CUT&Run experiment, thereby generating a large number of false positive signals in the TSS (Transcription Start Sites) region ( Figure 3 ), which will greatly interfere with the authenticity of CUT&Tag / CUT&Run experimental data. In addition, the enrichment of false positive signals in the TSS region will also lead to a low proportion of real signal data at the same sequencing depth, reducing the output of effective data. SUMMARY OF THE INVENTION

[0006] Purpose of the Invention

[0007] 1. Solve the false positive problem in CUT&Tag and CUT&Run experiments.

[0008] 2. Optimize the CUT&Tag and CUT&Run experimental processes, reduce the washing steps, and directly perform amplification without template extraction, thereby shortening the experimental time.

[0009] 3. Innovative complex construction method can achieve tight binding of eukaryotic proteins and prokaryotic proteins in vitro. Summary of the invention

[0010] 1. The present invention constructs a complex of different secondary antibodies and Tn5 / MNase based on a biotin: avidin binding pair. The construction of the complex can effectively reduce the amount of free Tn5 and MNase. In the CUT&Tag and CUT&Run experiments, the original primary antibody incubation, secondary antibody incubation, and protein A (PA) / protein G (PG)-Tn5 / MNase incubation are optimized to primary antibody incubation and secondary antibody-T5 / MNase complex incubation. This step reduces the experimental operation process, and firmly binds Tn5 / MNase through the secondary antibody-T5 / MNase complex, reducing the exposure of free Tn5 / MNase in the original CUT&Tag and CUT&Run experiments, and significantly reducing the false positive signal in the negative control TSS region.

[0011] 2. Since the secondary antibody is generally derived from species such as mice, rabbits, and goats, while the Tn5 enzyme is derived from E. coli, it is very difficult to construct the fusion protein. After expressing the secondary antibody-Tn5 / MNase fusion protein in E. coli, it was found that the secondary antibody binding efficiency was very low, which may be related to the difference in post-transcriptional modification between eukaryotes and prokaryotes. In order to overcome the inability to obtain a functionally active secondary antibody-Tn5 / MNase fusion protein due to the different host sources of the secondary antibody and Tn5, we innovatively modified the secondary antibody with biotin (BT) and then incubated it with avidin, especially streptavidin (SA)-Tn5 / MNase fusion protein in vitro (or BT-modified the secondary antibody and coupled it with SA, and BT-modified Tn5 / MNase at the same time, and then incubated the two in vitro). The binding capacity of SA:BT reached Kd=10^-15, which is at least 10,000 times higher than the highest binding antigen-antibody binding capacity. And one SA protein can bind to four BT molecules. We control the ratio of SA:BT to ensure that most of the Tn5 / MNase enzyme is captured by the secondary antibody, thus achieving the functional "secondary antibody-BT:SA-Tn5 / Mnase complex" and "secondary antibody-BT:SA:BT-Tn5 / Mnase complex".

[0012] 3. After the CUT&Tag enzyme digestion reaction, add the stop solution and the amplification mix with a special sequence adapter, and the library construction can be directly carried out without purification. This step can reduce the experimental operation process and complete the entire library construction experiment in one EP tube, which is conducive to the construction of the subsequent automation platform.

[0013] Beneficial Effects

[0014] 1. The functional "secondary antibody-BT:SA:BT-Tn5 / Mnase and secondary antibody-BT:SA-Tn5 / Mnase complex" enables Tn5 / Mnase to be firmly captured by the secondary antibody. The binding degree between Tn5 / Mnase enzyme and the secondary antibody is much stronger than that between PA / PG-Tn5 and the secondary antibody. This significantly reduces the background of negative controls in the CUT&Tag and CUT&Run experiments, greatly reducing the false positives in the CUT&Tag and CUT&Run technologies.

[0015] 2. The overall effective data accounts for a large proportion, and the signal enrichment of experimental data has increased significantly ( Figure 5 ).

[0016] 3. The overall CUT&Tag and CUT&Run experiment time was reduced by 6 hours, improving the overall efficiency of the experiment.

[0017] 4. SA modification and BT modification are used to construct complexes, which makes it possible to integrate eukaryotic proteins and prokaryotic proteins while retaining their original activity. In particular, immune-related proteins involve VDJ rearrangement and abundant post-transcriptional modifications. Direct expression of related proteins in prokaryotic systems does not have immune activity. SA modification allows immune-related proteins to be expressed in the original host and then combined with other prokaryotic proteins to obtain biologically active eukaryotic protein-prokaryotic protein complexes, which show accurate target location in the CUT&Tag experiment and have obvious signal enrichment in the TSS region of the target gene ( Figure 5 ).

[0018] Implementation

[0019] The present invention relates to the following embodiments.

[0020] 1. A biotin:avidin-based secondary antibody:transposase complex represented by the following formula:

[0021] Transposase-avidin:(biotin-secondary antibody) n , where n is 1, 2, 3, or 4.

[0022] 2. The complex of embodiment 1, wherein the avidin is streptavidin.

[0023] 3. The complex of embodiment 1, wherein the transposase is Tn5 transposase.

[0024] 4. A mixture of the complex of any one of embodiments 1 to 3, which is represented by the following formula:

[0025] Transposase-avidin:(biotin-secondary antibody) p , where p is greater than 1 and less than 4.

[0026] 5. A biotin:avidin-based secondary antibody:transposase complex represented by the following formula:

[0027] (Transposase-Biotin) m :Avidin:(Biotin-Secondary Antibody) n , wherein m and n are each independently 1, 2 or 3,

[0028] And m+n is less than or equal to 4.

[0029] 6. The complex of embodiment 5, wherein the avidin is streptavidin.

[0030] 7. The complex of embodiment 5, wherein the transposase is Tn5 transposase.

[0031] 8. The complex of embodiment 5, wherein the biotin is attached to an oligonucleotide of the transposome, optionally the oligonucleotide is a partially paired 5'-phos-CTGTCTCTTATACACAT BT CT BT -3' (SEQ ID NO:

[0032] 12) and 5′-TCGT BT CGGCAGCGTCAGATGTGTAT BT AAGAGACAG-3′ (SEQ ID NO: 195) and / or partially paired 5′-phos-CTGTCTCTTATACACAT BT CT BT -3' (SEQ ID NO: 12) and 5'-GTCTCGTGGGCT BT CGGAGATGTGTAT BT AAGAGACAG-3

[0033] (SEQ ID NO: 297), or the oligonucleotide is a partially paired 5'-phos-CT BT GTCTCTTAT BT ACACATCT-3' (SEQ ID NO: 29) and 5'-TCGTCGGCAGCGTCAGATGTGT BT AT BT AAGAGACAG-3′ (SEQ ID NO:

[0034] 215) and / or partially paired 5'-phos-CT BT GTCTCTTAT BT ACACATCT-3' (SEQ ID NO: 29) and 5'-GTCT BT CGTGGGCT BTCGGAGATGTGTATAAGAGACAG-3′

[0035] (SEQ ID NO: 317), T BT indicates biotinylated T.

[0036] 9. A mixture of the complex according to any one of embodiments 5 to 8, which is represented by the following formula:

[0037] (Transposase-Biotin) q :Avidin:(Biotin-Secondary Antibody) p , where p and q are each greater than or equal to 1 and less than or equal to 3, and q+p is less than or equal to 4.

[0038] 10. A method for detecting the interaction between a target protein and DNA in a cell, comprising:

[0039] (1) Incubate cells with primary antibodies against the target protein;

[0040] (2) incubating the cells with the complex of any one of embodiments 1-3 and 5-8 or the mixture of embodiments 4 or 9, wherein the secondary antibody in the complex is a secondary antibody specific for the primary antibody, and allows the transposase to act on the cell genome;

[0041] (3) amplification of cellular DNA;

[0042] (4) purifying the amplified DNA; and

[0043] (5) Sequencing the amplified DNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 : Chip-Seq technology schematic;

[0045] Figure 2 : Schematic diagram of CUT&Tag experiment;

[0046] Figure 3 : The IgG negative control of the conventional CUT&Tag experiment has obvious signal enrichment in the TSS region;

[0047] Figure 4 : Signal comparison of three groups of negative control libraries (IgG+secondary antibody+pG-Tn5, IgG+secondary antibody: pG-Tn5 and IgG+secondary antibody-BT: SA-Tn5) in Example 2;

[0048] Figure 5 : Comparison of real signals of six groups of samples in Example 2;

[0049] Figure 6: Comparison of the distribution of the reference library (primary antibody + secondary antibody + pG-Tn5, primary antibody + secondary antibody: pG-Tn5) and the test library (primary antibody + secondary antibody-BT: SA-Tn5) in Example 2;

[0050] Figure 7 : Signal diagram of negative control (IgG+secondary antibody-BT:SA:BT-Tn5-1, IgG+secondary antibody-BT:SA:BT-Tn5-2) in Example 3;

[0051] Figure 8 : Comparison of real signals of eight groups of samples in Example 3;

[0052] Fig. 9 : Distribution diagram of four groups of libraries in Example 3. DETAILED DESCRIPTION OF THE INVENTION

[0053] In one aspect, the present invention provides a biotin:avidin-based secondary antibody:transposase complex, which is represented by the following formula:

[0054] Transposase-avidin:(biotin-secondary antibody) n , where n is 1, 2, 3 or 4. n is the number of secondary antibody molecules loaded by the transposase molecule.

[0055] In one embodiment, the avidin is streptavidin or neutravidin. In one embodiment, the transposase is Tn5 transposase.

[0056] In one aspect, the present invention provides a mixture of the above-mentioned complex, which is represented by the following formula:

[0057] Transposase-avidin:(biotin-secondary antibody) p , where p is the average biotin-secondary antibody loading of transposase-avidin, which is greater than 1 and less than 4. p is the average number of secondary antibody molecules loaded by transposase molecules in the mixture.

[0058] In one aspect, the present invention provides a method for preparing the above-mentioned complex or mixture, comprising: expressing a transposase-avidin fusion protein in Escherichia coli;

[0059] biotinylated secondary antibody; and mixing the transposase-avidin fusion protein and the biotinylated secondary antibody at a molar ratio of 1:n'.

[0060] In one embodiment, n'=n. In one embodiment, n'>n. In one embodiment, n'=p. In one embodiment, n'>p. In one embodiment, n'>4, for example n'=5. In one embodiment, the molar ratio of the transposase-avidin fusion protein to the biotinylated secondary antibody is such that there is no free (i.e., not bound to the biotinylated secondary antibody) transposase-avidin. In one embodiment, the molar ratio of the transposase-avidin fusion protein to the biotinylated secondary antibody is such that the avidin in the transposase-avidin is saturated with the biotin in the biotin-secondary antibody.

[0061] In one aspect, the present invention provides a biotin:avidin-based secondary antibody:transposase complex, which is represented by the following formula:

[0062] (Transposase-Biotin) m :Avidin:(Biotin-Secondary Antibody) n , wherein m and n are each independently 1, 2 or 3, and m+n is less than or equal to 4, such as m+n=2, 3 or 4. For example, m=1, n=1, 2 or 3; m=2, n=1 or 2; m=3, n=1. For another example, n=1, m=1, 2 or 3; n=2, m=1 or 2; n=3, m=1. m is the number of transposase molecules loaded by the avidin molecule, and n is the number of secondary antibody molecules loaded by the avidin molecule.

[0063] In one embodiment, the avidin is streptavidin or neutravidin. In one embodiment, the transposase is Tn5 transposase. In one embodiment, the biotin is attached to the oligonucleotide of the transpososome. In one embodiment, the transposase molecule (or related oligonucleotide) is loaded with one or more biotin molecules, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more. In one embodiment, the oligonucleotide is as shown in CTGTCTCTTATACACATCT (SEQ ID NO: 1). In one embodiment, the oligonucleotide is as shown in any one of SEQ ID NOs: 4-182. In one embodiment, the oligonucleotide is as shown in TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (SEQ ID NO: 2). In one embodiment, the oligonucleotide is as shown in any one of SEQ ID NOs: 183-284. In one embodiment, the oligonucleotide is as shown in GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQ ID NO: 3). In one embodiment, the oligonucleotide is as set forth in any one of SEQ ID NOs: 285-464. In one embodiment, SEQ ID NO: 1 is partially paired with SEQ ID NO: 2. In one embodiment, any one of SEQ ID NOs: 4182 is paired with a portion of any one of SEQ ID NOs: 183-284. In one embodiment, SEQ ID NO: 1 is partially paired with SEQ ID NO: 3. In one embodiment, any one of SEQ ID NOs: 4-182 is paired with a portion of any one of SEQ ID NOs: 285-464. In one embodiment, the transposase is complexed with the partially paired SEQ ID NOs: 1 and SEQ ID NO: 2. In one embodiment, the transposase is complexed with the partially paired SEQ ID NOs: 4-182 and any one of SEQ ID NOs: 183-284. In one embodiment, the transposase is complexed with the partially paired SEQ ID NOs: 1 and SEQ ID NO: 3. In one embodiment, the transposase is complexed with the partially paired SEQ ID NOs: 4-182 and any one of SEQ ID NOs: 285-464. In one embodiment, the transposase is complexed with a portion of SEQ ID NO:1 and SEQ ID NO:2 and with a portion of SEQ ID NO:1 and SEQ ID NO:3.In one embodiment, the transposase is complexed with a partially paired SEQ ID NO: 4-182 and any one of SEQ ID NO: 183-284 and with a partially paired SEQ ID NO: 4-182 and any one of SEQ ID NO: 285-464. In one embodiment, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 are each independently attached with one or more biotin molecules, such as 1, 2, 3, 4, 5, 6, 7, 8 or more. In one embodiment, the oligonucleotide is a partially paired 5'-phos-CTGTCTCTTATACACAT. BT CT BT -3' (SEQ ID NO: 12) and 5'-TCGT BT CGGCAGCGTCAGATGTGTAT BT AAGAGACAG-3′ (SEQ ID NO: 195) and / or partially paired 5′-phos-CTGTCTCTTATACACAT BT CT BT -3'(SEQ IDNO:12) and 5'-GTCTCGTGGGCT BT CGGAGATGTGTAT BT AAGAGACAG-3 (SEQ ID NO: 297), or the oligonucleotide is a partially paired 5'-phos-CT BT GTCTCTTAT BT ACACATCT-3' (SEQ ID NO: 29) and 5'-TCGTCGGCAGCGTCAGATGTGT BT AT BT AAGAGACAG-3′ (SEQ ID NO: 215) and / or partially paired 5′-phos-CT BT GTCTCTTAT BT ACACATCT-3' (SEQ ID NO: 29) and 5'-GTCT BT CGTGGGCT BT CGGAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 317), T BT indicates biotinylated T.

[0064] In one aspect, the present invention provides a mixture of the above-mentioned complex, which is represented by the following formula:

[0065] (Transposase-Biotin) q :Avidin:(Biotin-Secondary Antibody) p, wherein p and q are each greater than or equal to 1 and less than or equal to 3, and q+p is less than or equal to 4, for example, q+p≈2, 3, or 4. For example, q≈1, p≈1, 2, or 3; q≈2, p≈1 or 2; q≈3, p≈1. For another example, p≈1, q≈1, 2, or 3; p≈2, q≈1 or 2; p≈3, q≈1. q is the average number of transposase molecules loaded by the avidin molecules in the mixture, and p is the average number of secondary antibody molecules loaded by the avidin molecules in the mixture.

[0066] In one aspect, the present invention provides a method for preparing the above-mentioned complex or mixture, comprising: a biotinylated secondary antibody;

[0067] Biotinylated transposase;

[0068] Avidin and biotinylated secondary antibody were mixed at a molar ratio of 1:n' to obtain an intermediate;

[0069] and

[0070] The intermediate was mixed with the biotinylated transposase at a molar ratio of 1:m'.

[0071] In one aspect, the present invention provides a method for preparing the above-mentioned complex or mixture, comprising: a biotinylated secondary antibody;

[0072] Biotinylated transposase;

[0073] Avidin and biotinylated transposase were mixed at a molar ratio of 1:m' to obtain an intermediate;

[0074] and

[0075] The intermediate was mixed with the biotinylated secondary antibody at a molar ratio of 1:n'.

[0076] In one aspect, the present invention provides a method for preparing the above-mentioned complex or mixture, comprising: a biotinylated secondary antibody;

[0077] Biotinylated transposase;

[0078] and mixing biotinylated transposase, avidin, and biotinylated secondary antibody at a molar ratio of m':1:n'.

[0079] In one embodiment, n'=n. In one embodiment, n'>n. In one embodiment, n'=p. In one embodiment, n'>p. In one embodiment, n'<4, such as n'<3, such as n'<2, such as n'=1, 2 or 3. In one embodiment, n'>4. In one embodiment, m'=m. In one embodiment, m'>m. In one embodiment, m'=q. In one embodiment, m'>q. In one embodiment, m'<4, such as m'<3, such as m'<2, such as m'=1, 2 or 3. In one embodiment, m'>4. In one embodiment, in the case of n'=1, m'≤3, such as m'<3. In one embodiment, in the case of n'=2, m'≤2, such as m'<2. In one embodiment, in the case of n'=3, m'≤1, such as m'<1. In one embodiment, in the case of m'=1, n'≤3, such as n'<3. In one embodiment, in the case of m'=2, n'≤2, such as n'<2. In one embodiment, when m'=3, n'≤1, for example n'<1. In one embodiment, n'>4 and m'>4. In one embodiment, the above molar ratio is such that there is no free (ie not bound to the biotinylated secondary antibody) biotinylated transposase.

[0080] In one embodiment, the numerical values ​​of the present invention include an error of ±20%, ±10% or ±5%.

[0081] In one aspect, the present invention provides a method for detecting the interaction between a target protein and DNA in a cell, comprising:

[0082] (1) Incubate cells with primary antibodies against the target protein;

[0083] (2) incubating the cells with the complex or mixture, wherein the secondary antibody in the complex is specific to the primary antibody, and allowing the transposase to act on the cell genome;

[0084] (3) amplification of cellular DNA;

[0085] (4) purifying the amplified DNA; and

[0086] (5) Sequencing the amplified DNA.

[0087] In one embodiment, the method of the present invention directly amplifies cellular DNA without extracting and purifying cellular DNA.

[0088] In one embodiment, the target protein is AAF, ab1, ADA2, ADA-NF1, AF-1, AFP1, AhR, AIIN3, ALL-1, α-CBF, α-CP1, α-CP2a, α-CP2b, αHo, αH2-αFB, Alx-4, aMEF-2, AML1, AML1a, AML1b, AML1c, AML1δN, AML2, AML3, AML3a, AML3b, AMY-1L, A-Myb, ANF, AP-1, AP-2αA, AP-2αB, AP-2β, AP-2γ, AP-3(1), AP-3(2), AP-4, AP-5, APC, AR, AREB 6, Arnt, Arnt (774M form), ARP-1, ATBF1-A, ATBF1-B, ATF, ATF-1, ATF-2, ATF-3, ATF-3δZIP, ATF-a, ATF-aδ, ATPF1, Barhl1, Barhl2, Barx1, Barx2, Bcl-3, BCL-6, BD73, β-catenin, Bin1, B-Myb, BP1, BP2, brahma, BRCA1, Brn-3a, Brn-3b, Brn-4, BTEB, BTEB2, B-TFIID, C / EBPα, C / EBPβ, C / EBPδ, CACC binding factor, Cart-1 、CBF(4), CBF(5), CBP, CCAAT-binding factor, CCMT-binding factor, CCF, CCG1, CCK-1a, CCK-1b, CD28RC, cdk2, cdk9, Cdx-1, CDX2, Cdx-4, CFF, ChxlO, CLIM1, CLIM2, CNBP, CoS, COUP, CP1, CP1A, CP1C, CP2, CPBP, CPE-binding protein, CREB, CREB-2, CRE-BP1, CRE-BPa, CREMα, CRF, Crx, CSBP-1, CTCF, CTF, CTF-1, CTF-2, CTF-3, CTF-5, CTF- 7. CUP, CUTL1, Cx, Cyclin A, Cyclin T1, Cyclin T2, Cyclin T2a, Cyclin T2b, DAP, DAX1, DB1, DBF4, DBP, DbpA, DbpAv, DbpB, DDB, DDB-1, DDB-2, DEF, δCREB, δMax, DF-1, DF-2, DF-3, Dlx-1, Dlx-2, Dlx-3, Dlx4 (long isoform), Dlx-4 (short isoform, Dlx-5, Dlx-6, DP-1, DP-2, DSIF, DSIF-p14, DSIF-p160, DTF, DUX1, DUX2, DUX3,DUX4, E, E12, E2F, E2F+E4, E2F+p107, E2F-1, E2F-2, E2F-3, E2F-4, E2F-5, E2F-6, E47, E4BP4, E4F, E4F1, E4TF2, EAR2, EBP-80, EC2, EF1, EF-C, EGR1, EGR 2. EGR3, EIIaE-A, EIIaE-B, EIIaE-Cα, EIIaE-Cβ, EivF, EIf-1, EIk-1, Emx-1, Emx-2, Emx-2, En-1, En-2, ENH-bind.prot., ENKTF-1, EPAS1, εF1, ER, Erg -1, Erg-2, ERR1, ERR2, ETF, Ets-1, Ets-1δVil, Ets-2, Evx-1, F2F, Factor 2, Factorname, FBP, f-EBP, FKBP59, FKHL18, FKHRL1P2, Fli-1, Fos, FOXB1, FOXC1, FOXC2, FOXD1, FOXD2, FOXD3, FOXD4, FOXE1, FOXE3, FOXF1, FOXF2, FOXG1a, FOXG1b, FOXG1c, FOXH1, FOXI1, FOXJ1a, FOXJ1b, FOXJ2 (long isoform), FOXJ2 (short isoform), FOXJ3, FOXK1a, FOXK1b, FOXK1c, FOXL1, FOXM1a, FOXM1b, FOXM1c, FOXN1, FOXN2, FOXN3, FOXO1a, FOXO1b, FOX02, FOX03a, FOX03b, FOX04, FOXP1, FOXP3, F ra-1, Fra-2, FTF, FTS, G factor, G6 factor, GABP, GABP-α, GABP-β1, GABP-β2, GADD153, GAF, γCMT, γCAC1, γCAC2, GATA-1, GATA-2, GATA-3, GATA-4, GATA-5, GATA- 6. Gbx-1, Gbx-2, GCF, GCMa, GCNS, GF1, GLI, GLI3, GRα, GRβ, GRF-1, Gsc, Gsc1, GT-IC, GT-IIA, GT-IIBα, GT-IIBβ, H1TF1, H1TF2, H2RIIBP, H4TF-1, H4TF-2, HAND1, HAND2, HB9, HDAC1, HDAC2, HDAC3, hDaxx, heat-induced factor, HEB, HEB1-p67, HEB1-p94, HEF-1B, HEF-1T, HEF-4C, HEN1, HEN2, Hesx1, Hex, HIF-1, HIF-1α,HIF-1β, HiNF-A, HiNF-B, HINF-C, HINF-D, HiNF-D3, HiNF-E, HiNF-P, HIP1, HIV-EP2, Hlf, HLTF, HLTF(Met123), HLX, HMBP, HMG I, HMG I(Y), HMGY, HMGI-C, HNF-1A, HNF-IB, HNF-1C, HNF-3, HNF-3α, HNF-3β, HNF-3γ, HNF4, HNF-4α, HNF4α1, HNF-4α2, HNF-4α3, HNF-4α4, HNF4γ, HNF-6α, hnRNPK, HOX11, HOXA1, HOXA10, HOXA10PL2, HOXA11, HOXA13, HOXA2, HOXA3, HOXA4, HOXA5, HOXA6, HOXA7, HOXA9A, HOXA9B, HOXB-1, HOXB13, HOXB2, HOXB3, HOXB4, HOXBS, HOXB6, HOXA5, HOXB7, HOXB8, HOXB9, HOXC10, HOXC11, HOXC12, HOXC13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXD10, HOXD11, HOXD12, HOXD13, HOXD3, HOXD4, HOXD8, HOXD9, Hp55, Hp65, HPX42B, HrpF, HSF, HSF1(long), HSF1(short), HSF2, hsp56, Hsp90, IBP-1, ICER-II, ICER-liγ, ICSBP, Id1, Id1H', Id2, Id3, Id3 / Heir-1, IF1, IgPE-1, IgPE-2, IgPE-3, IκB, IκB-α, IκB-β, IκBR, II-1RF, IL-6RE-BP, 11-6RF, INSAF, IPF1, IRF-1, IRF-2, B, IRX2a, Irx-3, Irx-4, ISGF-1, ISGF-3, ISGF3α, ISGF-3γ, lst-1, ITF, ITF-1, ITF-2, JRF, Jun, JunB, JunD, κy factor, KBP-1, KER1, KER-1, Kox1, KRF-1, Ku autoantigen, KUP, LBP-1, LBP-1a, LBX1, LCR-F1, LEF-1, LEF-1B, LF-A1, LHX1, LHX2, LHX3a, LHX3b, LHXS, LHX6.1a, LHX6.1b, LIT-1, Lmo1, Lmo2, LMX1A, LMX1B, L-My1(long form), L-My1(short form), L-My2, LSFLXRα, LyF-1, Lyl-1, M factor, Mad1, MASH-1, Max1, Max2, MAZ, MAZ1, MB67, MBF1, MBF2, MBF3, MBP-1(1), MBP-1(2), MBP-2, MDBP, MEF-2, MEF-2B, MEF-2C (433AA form), MEF-2C (465AA form), MEF-2C (473M form), MEF-2C / δ32 (441AA form), MEF-2D00, MEF-2D0B, MEF-2DA0, MEF-2DAO, MEF-2DAB, MEF-2DA'B, Meis-1, Meis-2a, Meis-2b, Meis-2c, Meis-2d, Meis-2e, Meis3, Meox1, Meox1a, Meox2, MHox (K-2), Mi, MIF-1, Miz-1, MM-1, MOP3, MR, Msx-1, Msx-2, MTB-Zf, MTF-1, mtTF1, Mxil, Myb, Myc, Myc1, Myf-3, Myf-4, Myf-5, Myf-6, MyoD, MZF-1, NCI, NC2, NCX, NELF, NER1, Net, NF Ill-a, NF NF-1, NF-1A, NF-1B, NF-1X, NF-4FA, NF-4FB, NF-4FC, NF-A, NF-AB, NFAT-1, NF-AT3, NF-Atc, NF-Atp, NF-Atx, NfβA, NF-CLEOa, NF-CLEOb, NFδE3A, NFδE3B, NFδE3C, NFδE4A, NFδE4B, NFδE4C, Nfe, NF-E, NFE2, NF-E2p45, NF-E3, NFE-6, NF-Gma, NF-GMb, NF-IL-2A, NF-IL-2B, NF-jun, NF-κB, NF-κB (like), NF-κB1, NF-κB1 precursor, NF-κB2, NF-κB2 (p49), NF-κB2 precursor, NF-κE1, NF-κE2, NF-κE3, NF-MHCIIA, NF-MHCIIB, NF-muE1, NF-muE2, NF-muE3, NF-S, NF-X, NF-X1, NF-X2, NF-X3, NFXc, NF-YA, NF-Zc, NF-Zz, NHP-1, NHP-2, NHP3, NHP4, NKX2-5, NKX2B, NKX2C, NKX2G, NKX3A, NKX3Av1, NKX3Av2, NKX3Av3, NKX3Av4, NKX3B, NKX6A, Nmi, N-Myc, N-Oct-2α, N-Oct-2βN-Oct-3, N-Oct-4, N-Oct-5a, N-Oct-5b, NP-TCII, NR2E3, NR4A2, Nrf1, Nrf-1, Nrf2, NRF-2β1, NRF-2γ1, NRL, NRSF form 1, NRSF form 2, NTF, 02, OCA-B, Oct-1, Oct-2, Oct-2.1, Oct-2B, Oct-2C, Oct-4A, Oct4B, Oct-5, Oct-6, Octa-factor, octameric-binding factor, oct-B2, oct-B3, Otx1, Otx2, OZF, p107, p130, p28 regulator, p300, p38 erg, p45, p49erg, p53, p55, p55erg, p65δ, p67, Pax-1, Pax-2, Pax-3, Pax-3A, Pax-3B, Pax-4, Pax-5, Pax-6, Pax-6 / Pd-5a, Pax-7, Pax-8, Pax-8a, Pax- 8b, Pax-8c, Pax-8d, Pax-8e, Pax-8f, Pax-9, Pbx-1a, Pbx-1b, Pbx-2, Pbx-3a, Pbx-3b, PC2, PC4, PC5, PEA3, PEBP2α, PEBP2β, Pit-1, PITX1, PITX2, PITX3 , PKNOX1, PLZF, POB, Pontin52, PPARα, PPARβ, PPARγ1, PPARγ2, PPUR, PR, PRA, pRb, PRD1-BF1, PRDI-BFc, Prop-1, PSE1, P-TEFb, PTF, PTFα, PTFβ, PTFδ, PTFγ, Pubox binding factor, Pubox binding factor (BJA-B), PU.1, PuF, Pur factor, R1, R2, RAR-α1, RAR-β, RAR-β2, RAR-γ, RAR-γ1, RBP60, RBP-Jκ, Rel, RelA, RelB, RFX, RFX1, RFX 2. RFX3, RFXS, RF-Y, RORα1, RORα2, RORα3, RORβ, RORγ, Rox, RPF1, RPGα, RREB-1, RSRFC4, RSRFC9, RVF, RXR-α, RXR-β, SAP-1a, SAP-1b, SF-1, SHOX2a, SH OX2b, SHOXa, SHOXb, SHP, SIII-p110, SIII-p15, SIII-p18, SIM', Six-1, Six-2, Six-3, Six-4, Six-5, Six-6, SMAD-1, SMAD-2, SMAD-3, SMAD-4, SMAD-5,SOX-11, SOX-12, Sox-4, Sox-5, SOX-9, Sp1, Sp2, Sp3, Sp4, Sph factor, Spi-B, SPIN, SRCAP, SREBP-1a, SREBP-1b, SREBP-1c, SREBP-2, SRE-ZBP, SRF, SRY, SRP1, Staf-50, STAT1α, STAT1β, STAT2, STAT3, STAT4, STAT6, T3R, T3R-α1, T3R-α2, T3R-β, TAF(I)110, TAF(I)48, TAF(I)63, TAF(II)100, TAF(II)125, TAF(II)135, TAF(II)170, TAF(II)18, TAF(II)20, TAF(II)250, TAF(II)250Δ, TAF(II)28, TAF(II)30, TAF(II)31, TAF(II)55, TAF(II)70-α, TAF(II)70-β, TAF(II)70-γ, TAF-I, TAF-II, TAF-L, Tal-1, Tal-1β, Tal-2, TAR factor, TBP, TBXIA, TBXIB, TBX2, TBX4, TBXS (long isoform), TBXS (short isoform), TCF, TCF-1, TCF-1A, TCF-1B, TCF-1C, TCF-1D, TCF-1E, TCF-1F, TCF-1G, TCF-2α, TCF-3, TCF-4, TCF-4(K), TCF-4B, TCF-4E, TCFβ1, TEF-1, TEF-2, tel, TFE3, TFEB, TFIIA, TFIIA-αβ precursor, TFIIA-α / β precursor, TFIIA-γ, TFIIB, TFIID, TFIIE, TFIIE-α, TFIIE-β, TFIIF, TFIIF-α, TFIIF-β, TFIIH, TFIIH*, TFIIH-CAK, TFIIH-cyclin H, TFIIH-ERCC2 / CAK, TFIIH-MAT1, TFIIH-M015, TFIIH-p34, TFIIH-p44, TFIIH-p62, TFIIH-p80, TFIIH-p90, TFII-I, Tf-LF1, Tf-LF2, TGIF, TGIF2, TGT3, THRA1, TIF2, TLE1, TLX3, TMF, TR2, TR2-11, TR2-9, TR3, TR4, TRAP, TREB-1, TREB-2, TREB-3, TREF1, TREF2, TRF(2), TTF-1, TXRE BP, TxREF, UBF, UBP-1, UEF-1UEF-2, UEF-3, UEF-4, USF1, USF2, USF2b, Vav, Vax-2, VDR, vHNF-1A, vHNF1B, vHNF-1C, VITF, WSTF, WT1, WT1I, WT1I-KTS, WT1I-d el2, WT1-KTS, WT1-del2, X2BP, XBP-1, 2. ATF2, ASXL1, BAP1, bc110, Bmil, BRG1, CARM1, KAT3A / CBP, CDC73, CHD1, CHD2, CTCF, DNMT1, DOTL1, EHMT1, ESET, EZH1, EZH2, F BXL10, FRP(Plu-1), HDAC1, HDAC2, HMGA1, hnRNPA1, HP1γ, Hset1b, Jarid1A, Jarid1C, KIAA1718JHDM1D, KAT5, KMT4, LSD1, NFKB P100, NSD2, MBD2, MBD3, MLL2, MLL4, P300, pRB, RbAP46 / 48, RBP1, RbBP5, RINGIB, RNApolII PS2, RNApolII PS5, ROC1, sap30, setDB1, Sf3b1, SIRT1, Sirt6, SMYD1, SP1, SUV39H1, SUZ12, TCF4, TET1, TRRAP, TRX2, WDR5, H3K27me3, H3k4me3, WDR77, and / or YY1.

[0089] In one embodiment, the secondary antibody is goat anti-mouse, goat anti-rat, goat anti-rabbit, goat anti-donkey, goat anti-chicken, goat anti-human, goat anti-guinea pig, rabbit anti-mouse, rabbit anti-rat, rabbit anti-goat, rabbit anti-donkey, rabbit anti-human, rabbit anti-guinea pig, rabbit anti-chicken, mouse anti-rabbit, mouse anti-rat, mouse anti-donkey, mouse anti-chicken, mouse anti-human, mouse anti-guinea pig, mouse anti-goat, rat anti-rabbit, rat anti-mouse, rat anti-donkey, rat anti-chicken, rat anti-human, rat anti-guinea pig, mouse anti-goat, donkey anti-rabbit, donkey anti-rat, donkey anti-mouse, donkey anti-chicken, donkey anti-human, donkey anti-guinea pig, donkey anti-goat, chicken anti-rabbit, chicken anti-rat, chicken anti-donkey, chicken anti-mouse, chicken anti-human, chicken anti-guinea pig, chicken anti-goat, guinea pig anti-rabbit, guinea pig anti-rat, guinea pig anti-donkey, guinea pig anti-chicken, guinea pig anti-human, guinea pig anti-mouse, guinea pig anti-goat.

[0090] Best Mode (Example)

[0091] Embodiment 1:

[0092] Preparation of transposase-streptavidin

[0093] Any method known in the art can be used to generate a transposase-streptavidin fusion protein. For example, a Tn5-streptavidin fusion protein can be recombinantly expressed in E. coli.

[0094] Preparation of transposase-biotin

[0095] Any method known in the art can be used to biotinylate the transposase. For example, Tn5 (Vazyme, Catalog No. S601) can be labeled with NHS-activated biotin (Invitrogen, Catalog No. 2174564). See, for example, Muraoka et al., Analytical Biochemistry, 557, 46-58, 2018.

[0096] Any method known in the art can also be used to synthesize oligonucleotides modified with biotin to form a complex with the transposase (see "Assembly of transposase-biotin:avidin:biotin-secondary antibody, Scheme 2" below).

[0097] Preparation of secondary antibody-biotin

[0098] The secondary antibody can be biotinylated using any method known in the art. For example, goat anti-rabbit IgG H&L secondary antibody (Abcam, Catalog No. ab6702) can be labeled with NHS-activated biotin (Invitrogen, Catalog No. 2174564). See, for example, Muraoka et al., Analytical Biochemistry, 557, 46-58, 2018.

[0099] Transposase-avidin:biotin-secondary antibody assembly

[0100] The transposase-streptavidin fusion protein was mixed with the biotinylated secondary antibody at a molar ratio of 1:5 in PBS and incubated for 1 hour at room temperature.

[0101] Transposase-biotin:avidin:biotin-secondary antibody assembly, Scheme 1

[0102] Streptavidin (Invitrogen, Cat. No. S888) and biotinylated secondary antibody were mixed in PBS at a molar ratio of 1:1 and incubated at room temperature for 1 hour to obtain an intermediate avidin:biotin-secondary antibody. The intermediate and biotinylated transposase were mixed in PBS at a molar ratio of 5:7 and incubated at room temperature for 1 hour.

[0103] Transposase-biotin:avidin:biotin-secondary antibody assembly, Scheme 2

[0104] Biotin-modified primers were synthesized at Sangon Biotechnology Co., Ltd.: Primer A, Primer B, Primer C (see Appendix). Primer A, Primer B, Primer C were dissolved in PBS to 10 μM. 10 μl Primer A + 10 μl Primer B were used to form reaction 1, and 10 μl Primer A + 10 μl Primer C were used to form reaction 2. Reaction 1 and reaction 2 were vortexed and thoroughly mixed, and the solution was briefly centrifuged to return to the bottom of the tube. The tube was placed in a PCR instrument and the following reaction procedure was performed:

[0105]

[0106]

[0107] After the reaction is completed, the product of reaction 1 and the product of reaction 2 are mixed in equal volumes and named AdapterMix.

[0108] Then add the following reaction components in the sterilized PCR tube in sequence:

[0109] Components 2μg preparation system Tn5 (500 ng / μl) 4μl AdapterMix 7μl PBS 39μl

[0110] Use a pipette to gently pipette 20 times to mix thoroughly, and place at 30°C for 1 hour. The reaction product is named BT-Tn5 and stored at -30 to -15°C.

[0111] The biotin-labeled secondary antibody, namely secondary antibody-BT, was incubated with SA protein and BT-Tn5 at a molar ratio of 5:7:7 in PBS at room temperature for 1 h and was named: secondary antibody-BT:SA:BT-Tn5 complex.

[0112] Among them, the secondary antibody-BT:SA:BT-Tn5-1 is primer A (5'-phos-CTGTCTCTTATACACAT BT CT BT -3')+primerB(5'-TCGT BT CGGCAGCGTCAGATGTGTAT BT AAGAGACAG-3′)+primer C(5′-GTCTCGTGGGCT BT CGGAGATGTGTAT BT AAGAGACAG-3); Secondary antibody-BT:SA:BT-Tn5-2 is primer A (5'-phos-CT BT GTCTCTTAT BT ACACATCT-3')+primer B(5'-TCGTCGGCAGCGTCAGATGTGTBT AT BT AAGAGACAG-3′)+primer C(5′-GTCT BT CGTGGGCT BT CGGAGATGTGTATAAGAGACAG-3′).

[0113] Secondary antibody: assembly of pG-Tn5

[0114] The secondary antibody was diluted 1:100 using 100 μL of Dig-Wash buffer (from Novozyme product TD901), and 0.58 μL of 6.88 μM pG-Tn5 (from Novozyme product TD901) was added, and incubated at room temperature for 60 minutes at 200 rpm to obtain a pre-incubated secondary antibody: pG-TN5 complex.

[0115] Embodiment 2:

[0116] This example uses H3k4me3 histone modification as an exemplary analysis target, and uses the "secondary antibody-BT:SA-Tn5 complex" and the conventional "pG-Tn5 complex" for experimental comparison to illustrate the method steps and beneficial effects of the present invention.

[0117] Among them, the library construction reagents in this example are all from the Hyperactive In-Situ ChIP Library Prep Kit for Illumina (pG-Tn5) (Cat. No. TD901) kit of Nanjing Novogene Biotech Co., Ltd., and the specific experimental steps are as follows:

[0118] The buffer solution was prepared and the ConA beads were treated before use according to the seventh and ninth parts of the TD901 kit instructions. The secondary antibody-BT:SA-Tn5 complex was constructed according to Example 1.

[0119] 1. Collect cells

[0120] Take the same 6 Hela cell samples, 100 μl each (about 100,000 Hela cells), centrifuge at 2500 rpm for 3 min at room temperature, and discard the supernatant. Add 500 μl of Wash Buffer to each sample at room temperature to resuspend the cells, centrifuge at 2500 rpm for 3 min, and discard the supernatant for subsequent experiments.

[0121] Among them, the first Hela cell sample used Anti-Histone H3 (mono methyl K4) antibody (abcam, catalog number ab8895) as the primary antibody and pG-Tn5 complex to construct the first reference library (sample 1); the second Hela cell sample used Rabbit (DA1E) mAb IgG (Cell Signaling Technology, catalog number 66362S) as the primary antibody and pG-Tn5 complex to construct the first negative control library (sample 2).

[0122] The third Hela cell sample used Anti-Histone H3 (mono methyl K4) antibody as the primary antibody and the secondary antibody: pG-Tn5 complex to construct the second reference library (sample 3); the fourth Hela cell sample used Rabbit (DA1E) mAb IgG as the primary antibody and the secondary antibody: pG-Tn5 complex to construct the second negative control library (sample 4).

[0123] The fifth Hela cell sample used Anti-Histone H3 (mono methyl K4) antibody as the primary antibody and the secondary antibody-BT:SA-Tn5 complex for test library construction (sample 5); the sixth Hela cell sample used Rabbit (DA1E) mAb IgG as the primary antibody and the secondary antibody-BT:SA-Tn5 complex for the third negative control library construction (sample 6).

[0124] 2. Incubation of cells with ConA beads

[0125] According to Section 9 of the TD901 product manual, the four cell samples were incubated with ConA beads respectively.

[0126] 3. Primary Antibody Incubation

[0127] According to the individual samples, 50 μl of pre-cooled Antibody Buffer was added, the cells were resuspended, vortexed gently to mix, and placed on ice.

[0128] Add 1 μl of Anti-Histone H3 (monomethyl K4) antibody to the EP tubes of the first, third, and fifth samples, vortex gently to mix, and incubate with rotation at room temperature for 2 h.

[0129] Add 1 μl of Rabbit (DA1E) mAb IgG to the EP tubes of the second, fourth, and sixth samples, vortex gently to mix, and incubate with rotation at room temperature for 2 h.

[0130] 4. Secondary Antibody and / or Tn5 Incubation

[0131] According to Section 9 of the TD901 product manual, the six samples after primary antibody incubation were incubated with secondary antibodies.

[0132] Among them, the first and second samples were incubated with goat anti-rabbit IgG H&L secondary antibody; the third and fourth samples were incubated with secondary antibody: pG-Tn5 complex; the fifth and sixth samples were incubated with secondary antibody-BT: SA-Tn5 complex.

[0133] The first and second samples after incubation with the secondary antibody need to be incubated with pG-Tn5 according to Section 9 of the TD901 product manual.

[0134] Because the complexes incubated with the secondary antibody for the fifth and sixth samples contained Tn5 transposomes, the secondary antibody-BT:SA-Tn5 complex library construction method shortened the transposome incubation time by 1 hour compared to the conventional pG-Tn5 complex library construction method, and the secondary antibody-BT:SA-Tn5 complex library construction method did not require additional rinsing of excess secondary antibodies, thus shortening the overall experimental time by 1 hour.

[0135] 5. Fragmentation reaction

[0136] The fifth and sixth samples incubated with the secondary antibody-BT:SA-Tn5 complex, the first and second samples incubated with pG-Tn5, and the third and fourth samples incubated with the secondary antibody:pG-Tn5 complex were subjected to fragmentation reaction and incubated at 37°C for 1 hour.

[0137] 6. DNA extraction and purification

[0138] According to Part 9 of the TD901 product manual, DNA was extracted and purified from the first and second samples after fragmentation; the third, fourth, fifth, and sixth samples after fragmentation did not require DNA extraction and purification, and 30 μl 1×TE was directly added to the samples for direct PCR amplification reaction.

[0139] The fifth and sixth samples did not require DNA extraction and purification, so the time was shortened by nearly 3 hours compared to the first and second samples that required extraction and purification.

[0140] 7. Library Amplification

[0141] According to the ninth part of the TD901 product manual, the library was amplified, wherein the P5 / P7 primers used the TruePrep Index Kit V2 for Illumina kit (Cat. No. TD202) of Nanjing Novozyme Biotech Co., Ltd.

[0142] 8. PCR product purification

[0143] The PCR amplified product was purified by magnetic beads according to Part 9 of the TD901 product manual, wherein the magnetic beads used were VAHTS DNA CleanBeads kit (Cat. No. N411) from Nanjing Novozymes Biotech Co., Ltd.

[0144] 9. Library quality detection

[0145] The prepared library was tested for library length distribution on Agilent 2100 Bioanalyzer ( Figure 6 ), it can be found that both the pG-Tn5 group (i.e., sample 1) and the secondary antibody-BT:SA-Tn5 group (i.e., sample 5) have obvious ladder-shaped library distribution, indicating that the secondary antibody-BT:SA-Tn5 technical solution can also build the library normally, but the ladder peak of the secondary antibody:PG-Tn5 group (i.e., sample 3) is not obvious, indicating that it may affect the cutting efficiency of Tn5 enzyme on chromatin.

[0146] 13. Next-generation sequencing

[0147] The library was diluted to 5 ng / ul, and 15 μl was sent to Nanjing Shihe Gene Biotechnology Co., Ltd. for sequencing using the HiseqX sequencing instrument.

[0148] Sequencing results

[0149] The offline data showed that in the negative control IgG experimental group, compared with the pG-Tn5 experimental scheme (sample 2) and the secondary antibody: PG-Tn5 experimental scheme (sample 4), the IgG signal of the secondary antibody-BT:SA-Tn5 experimental scheme (sample 6) was randomly distributed, which reduced the false positive signal in the TSS region ( Figure 4 ); IGV view shows that the positive signal of the secondary antibody-BT:SA-Tn5 group (sample 5) is more enriched, and the false positive signal of the IgG control (sample 6) is reduced ( Figure 5 ); The library peaks showed that the secondary antibody-BT:SA-Tn5 group (sample 5) and the pG-Tn5 group (sample 1) both had a nucleosome ladder distribution, while the secondary antibody:PG-Tn5 group (sample 3) had no obvious nucleosome ladder distribution, suggesting that it may affect the efficiency of Tn5 enzyme in cutting chromatin ( Figure 6 ).

[0150] Similar experimental results were obtained by targeting CTCF transcription factor, H3K27me3 and H3k4me3 histone modifications.

[0151] Embodiment 3:

[0152] In this example, H3k4me3 histone modification is used as an exemplary analysis target, and experimental comparisons are performed using "secondary antibody-BT:SA:BT-Tn5-1 complex", "secondary antibody-BT:SA:BT-Tn5-2 complex", "secondary antibody-BT:SA-Tn5 complex" and conventional "pG-Tn5 complex" to illustrate the method steps and beneficial effects of the present invention.

[0153] Among them, the experimental steps of the "secondary antibody-BT:SA-Tn5 complex" and the conventional "pG-Tn5 complex" groups are the same as those in Example 2; the experimental steps of the "secondary antibody-BT:SA:BT-Tn5-1 complex" and the "secondary antibody-BT:SA:BT-Tn5-2 complex" are the same as those of the "secondary antibody-BT:SA-Tn5 complex" group in Example 2, the only difference being that the "secondary antibody-BT:SA-Tn5 complex" is replaced by the "secondary antibody-BT:SA:BT-Tn5-1 complex" or the "secondary antibody-BT:SA:BT-Tn5-2 complex".

[0154] Sequencing results

[0155] The offline data showed that in the negative control IgG experimental group, the IgG of the "secondary antibody-BT:SA:BT-Tn5-1 complex" and the "secondary antibody-BT:SA:BT-Tn5-2 complex" had no obvious TSS enrichment ( Figure 7 ); IGV view shows that compared with the conventional "pG-Tn5 complex" (primary antibody + secondary antibody + pG-Tn5), the primary antibody + secondary antibody-BT:SA:BT-Tn5-1 complex and the primary antibody + secondary antibody-BT:SA:BT-Tn5-2 complex and primary antibody + secondary antibody-BT:SA-Tn5 can effectively reduce the IgG background and increase the specific signal of the antibody ( Figure 8 ); The library peaks showed that the libraries all had obvious nucleosome ladder distribution, indicating that the complexes constructed by different modification methods could be successfully constructed ( Fig. 9 ).

[0156] Similar experimental results were obtained by targeting CTCF transcription factor, H3K27me3 and H3k4me3 histone modifications.

[0157] Appendix: Transposome oligonucleotide sequence (the bold, italic, and underlined bases are biotin-modified bases)

[0158] PrimerA includes SEQ ID NO: 1, SEQ ID NO: 4 to SEQ ID NO: 182

[0159] Primer B includes SEQ ID NO: 2, SEQ ID NOs: 183 to 284. Primer C includes SEQ ID NO: 3, SEQ ID NOs: 285 to 464. SEQ ID NO: 1

[0160] CTGTCTCTTATACACATCT

[0161] SEQ ID NO: 2

[0162] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

[0163] SEQ ID NO: 3

[0164] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

[0165] SEQ ID NO: 4

[0166]

[0167] SEQ ID NO: 5

[0168]

[0169] SEQ ID NO: 6

[0170]

[0171] SEQ ID NO: 7

[0172]

[0173] SEQ ID NO: 8

[0174]

[0175] SEQ ID NO: 9

[0176]

[0177] SEQ ID NO: 10

[0178]

[0179] SEQ ID NO: 11

[0180]

[0181] SEQ ID NO: 12

[0182]

[0183] SEQ ID NO:13

[0184]

[0185] SEQ ID NO:14

[0186]

[0187] SEQ ID NO:15

[0188]

[0189] SEQ ID NO:16

[0190]

[0191] SEQ ID NO:17

[0192]

[0193] SEQ ID NO:18

[0194]

[0195] SEQ ID NO:19

[0196]

[0197] SEQ ID NO:20

[0198]

[0199] SEQ ID NO:21

[0200]

[0201] SEQ ID NO:22

[0202]

[0203] SEQ ID NO:23

[0204]

[0205] SEQ ID NO:24

[0206]

[0207] SEQ ID NO:25

[0208]

[0209] SEQ ID NO:26

[0210]

[0211] SEQ ID NO:27

[0212]

[0213] SEQ ID NO:28

[0214]

[0215] SEQ ID NO:29

[0216]

[0217] SEQ ID NO:30

[0218]

[0219] SEQ ID NO:31

[0220]

[0221] SEQ ID NO:32

[0222]

[0223] SEQ ID NO:33

[0224]

[0225] SEQ ID NO:34

[0226]

[0227] SEQ ID NO:35

[0228]

[0229] SEQ ID NO:36

[0230]

[0231] SEQ ID NO:37

[0232]

[0233] SEQ ID NO:38

[0234]

[0235] SEQ ID NO:39

[0236]

[0237] SEQ ID NO:40

[0238]

[0239] SEQ ID NO:41

[0240]

[0241] SEQ ID NO:42

[0242]

[0243] SEQ ID NO:43

[0244]

[0245] SEQ ID NO:44

[0246]

[0247] SEQ ID NO:45

[0248]

[0249] SEQ ID NO:46

[0250]

[0251] SEQ ID NO:47

[0252]

[0253] SEQ ID NO:48

[0254]

[0255] SEQ ID NO:49

[0256]

[0257] SEQ ID NO:50

[0258]

[0259] SEQ ID NO:51

[0260]

[0261] SEQ ID NO:52

[0262]

[0263] SEQ ID NO:53

[0264]

[0265] SEQ ID NO:54

[0266]

[0267] SEQ ID NO:55

[0268]

[0269] SEQ ID NO:56

[0270]

[0271] SEQ ID NO:57

[0272]

[0273] SEQ ID NO:58

[0274]

[0275] SEQ ID NO:59

[0276]

[0277] SEQ ID NO:60

[0278]

[0279] SEQ ID NO:61

[0280]

[0281] SEQ ID NO:62

[0282]

[0283] SEQ ID NO:63

[0284]

[0285] SEQ ID NO:64

[0286]

[0287] SEQ ID NO:65

[0288]

[0289] SEQ ID NO:66

[0290]

[0291] SEQ ID NO:67

[0292]

[0293] SEQ ID NO:68

[0294]

[0295] SEQ ID NO:69

[0296]

[0297] SEQ ID NO:70

[0298]

[0299] SEQ ID NO:71

[0300]

[0301] SEQ ID NO:72

[0302]

[0303] SEQ ID NO:73

[0304]

[0305] SEQ ID NO:74

[0306]

[0307] SEQ ID NO:75

[0308]

[0309] SEQ ID NO:76

[0310]

[0311] SEQ ID NO:77

[0312]

[0313] SEQ ID NO:78

[0314]

[0315] SEQ ID NO:79

[0316]

[0317] SEQ ID NO:80

[0318]

[0319] SEQ ID NO:81

[0320]

[0321] SEQ ID NO:82

[0322]

[0323] SEQ ID NO:83

[0324]

[0325] SEQ ID NO:84

[0326]

[0327] SEQ ID NO:85

[0328]

[0329] SEQ ID NO:86

[0330]

[0331] SEQ ID NO:87

[0332]

[0333] SEQ ID NO:88

[0334]

[0335] SEQ ID NO:89

[0336]

[0337] SEQ ID NO:90

[0338]

[0339] SEQ ID NO:91

[0340]

[0341] SEQ ID NO:92

[0342]

[0343] SEQ ID NO:93

[0344]

[0345] SEQ ID NO:94

[0346]

[0347] SEQ ID NO:95

[0348]

[0349] SEQ ID NO:96

[0350]

[0351] SEQ ID NO:97

[0352]

[0353] SEQ ID NO:98

[0354]

[0355] SEQ ID NO:99

[0356]

[0357] SEQ ID NO:100

[0358]

[0359] SEQ ID NO:101

[0360]

[0361] SEQ ID NO:102

[0362]

[0363] SEQ ID NO:103

[0364]

[0365] SEQ ID NO:104

[0366]

[0367] SEQ ID NO:105

[0368]

[0369] SEQ ID NO:106

[0370]

[0371] SEQ ID NO:107

[0372]

[0373] SEQ ID NO:108

[0374]

[0375] SEQ ID NO:109

[0376]

[0377] SEQ ID NO:110

[0378]

[0379] SEQ ID NO:111

[0380]

[0381] SEQ ID NO:112

[0382]

[0383] SEQ ID NO:113

[0384]

[0385] SEQ ID NO:114

[0386]

[0387] SEQ ID NO:115

[0388]

[0389] SEQ ID NO:116

[0390]

[0391] SEQ ID NO:117

[0392]

[0393] SEQ ID NO:118

[0394]

[0395] SEQ ID NO:119

[0396]

[0397] SEQ ID NO:120

[0398]

[0399] SEQ ID NO:121

[0400]

[0401] SEQ ID NO:122

[0402]

[0403] SEQ ID NO:123

[0404]

[0405] SEQ ID NO:124

[0406]

[0407] SEQ ID NO:125

[0408]

[0409] SEQ ID NO:126

[0410]

[0411] SEQ ID NO:127

[0412]

[0413] SEQ ID NO:128

[0414]

[0415] SEQ ID NO:129

[0416]

[0417] SEQ ID NO:130

[0418]

[0419] SEQ ID NO:131

[0420]

[0421] SEQ ID NO:132

[0422]

[0423] SEQ ID NO:133

[0424]

[0425] SEQ ID NO:134

[0426]

[0427] SEQ ID NO:135

[0428]

[0429] SEQ ID NO:136

[0430]

[0431] SEQ ID NO:137

[0432]

[0433] SEQ ID NO:138

[0434]

[0435] SEQ ID NO:139

[0436]

[0437] SEQ ID NO:140

[0438]

[0439] SEQ ID NO:141

[0440]

[0441] SEQ ID NO:142

[0442]

[0443] SEQ ID NO:143

[0444]

[0445] SEQ ID NO:144

[0446]

[0447] SEQ ID NO:145

[0448]

[0449] SEQ ID NO:146

[0450]

[0451] SEQ ID NO:147

[0452]

[0453] SEQ ID NO:148

[0454]

[0455] SEQ ID NO:149

[0456]

[0457] SEQ ID NO:150

[0458]

[0459] SEQ ID NO:151

[0460]

[0461] SEQ ID NO:152

[0462]

[0463] SEQ ID NO:153

[0464]

[0465] SEQ ID NO:154

[0466]

[0467] SEQ ID NO:155

[0468]

[0469] SEQ ID NO:156

[0470]

[0471] SEQ ID NO:157

[0472]

[0473] SEQ ID NO:158

[0474]

[0475] SEQ ID NO:159

[0476]

[0477] SEQ ID NO:160

[0478]

[0479] SEQ ID NO:161

[0480]

[0481] SEQ ID NO:162

[0482]

[0483] SEQ ID NO:163

[0484]

[0485] SEQ ID NO:164

[0486]

[0487] SEQ ID NO:165

[0488]

[0489] SEQ ID NO:166

[0490]

[0491] SEQ ID NO:167

[0492]

[0493] SEQ ID NO:168

[0494]

[0495] SEQ ID NO:169

[0496]

[0497] SEQ ID NO:170

[0498]

[0499] SEQ ID NO:171

[0500]

[0501] SEQ ID NO:172

[0502]

[0503] SEQ ID NO:173

[0504]

[0505] SEQ ID NO:174

[0506]

[0507] SEQ ID NO:175

[0508]

[0509] SEQ ID NO:176

[0510]

[0511] SEQ ID NO:177

[0512]

[0513] SEQ ID NO:178

[0514]

[0515] SEQ ID NO:179

[0516]

[0517] SEQ ID NO:180

[0518]

[0519] SEQ ID NO:181

[0520]

[0521] SEQ ID NO:182

[0522]

[0523] SEQ ID NO:183

[0524]

[0525] SEQ ID NO:184

[0526]

[0527] SEQ ID NO:185

[0528]

[0529] SEQ ID NO:186

[0530]

[0531] SEQ ID NO:187

[0532]

[0533] SEQ ID NO:188

[0534]

[0535] SEQ ID NO:189

[0536]

[0537] SEQ ID NO:190

[0538]

[0539] SEQ ID NO:191

[0540]

[0541] SEQ ID NO:192

[0542]

[0543] SEQ ID NO:193

[0544]

[0545] SEQ ID NO:194

[0546]

[0547] SEQ ID NO:195

[0548]

[0549] SEQ ID NO:196

[0550]

[0551] SEQ ID NO:197

[0552]

[0553] SEQ ID NO:198

[0554]

[0555] SEQ ID NO:199

[0556]

[0557] SEQ ID NO:200

[0558]

[0559] SEQ ID NO:201

[0560]

[0561] SEQ ID NO:202

[0562]

[0563] SEQ ID NO:203

[0564]

[0565] SEQ ID NO:204

[0566]

[0567] SEQ ID NO:205

[0568]

[0569] SEQ ID NO:206

[0570]

[0571] SEQ ID NO:207

[0572]

[0573] SEQ ID NO:208

[0574]

[0575] SEQ ID NO:209

[0576]

[0577] SEQ ID NO:210

[0578]

[0579] SEQ ID NO:211

[0580]

[0581] SEQ ID NO:212

[0582]

[0583] SEQ ID NO:213

[0584]

[0585] SEQ ID NO:214

[0586]

[0587] SEQ ID NO:215

[0588]

[0589] SEQ ID NO:216

[0590]

[0591] SEQ ID NO:217

[0592]

[0593] SEQ ID NO:218

[0594]

[0595] SEQ ID NO:219

[0596]

[0597] SEQ ID NO:220

[0598]

[0599] SEQ ID NO:221

[0600]

[0601] SEQ ID NO:222

[0602]

[0603] SEQ ID NO:223

[0604]

[0605] SEQ ID NO:224

[0606]

[0607] SEQ ID NO:225

[0608]

[0609] SEQ ID NO:226

[0610]

[0611] SEQ ID NO:227

[0612]

[0613] SEQ ID NO:228

[0614]

[0615] SEQ ID NO:229

[0616]

[0617] SEQ ID NO:230

[0618]

[0619] SEQ ID NO:231

[0620]

[0621] SEQ ID NO:232

[0622]

[0623] SEQ ID NO:233

[0624]

[0625] SEQ ID NO:234

[0626]

[0627] SEQ ID NO:235

[0628]

[0629] SEQ ID NO:236

[0630]

[0631] SEQ ID NO:237

[0632]

[0633] SEQ ID NO:238

[0634]

[0635] SEQ ID NO:239

[0636]

[0637] SEQ ID NO:240

[0638]

[0639] SEQ ID NO:241

[0640]

[0641] SEQ ID NO:242

[0642]

[0643] SEQ ID NO:243

[0644]

[0645] SEQ ID NO:244

[0646]

[0647] SEQ ID NO:245

[0648]

[0649] SEQ ID NO:246

[0650]

[0651] SEQ ID NO:247

[0652]

[0653] SEQ ID NO:248

[0654]

[0655] SEQ ID NO:249

[0656]

[0657] SEQ ID NO:250

[0658]

[0659] SEQ ID NO:251

[0660]

[0661] SEQ ID NO:252

[0662]

[0663] SEQ ID NO:253

[0664]

[0665] SEQ ID NO:254

[0666]

[0667] SEQ ID NO:255

[0668]

[0669] SEQ ID NO:256

[0670]

[0671] SEQ ID NO:257

[0672]

[0673] SEQ ID NO:258

[0674]

[0675] SEQ ID NO:259

[0676]

[0677] SEQ ID NO:260

[0678]

[0679] SEQ ID NO:261

[0680]

[0681] SEQ ID NO:262

[0682]

[0683] SEQ ID NO:263

[0684]

[0685] SEQ ID NO:264

[0686]

[0687] SEQ ID NO:265

[0688]

[0689] SEQ ID NO:266

[0690]

[0691] SEQ ID NO:267

[0692]

[0693] SEQ ID NO:268

[0694]

[0695] SEQ ID NO:269

[0696]

[0697] SEQ ID NO:270

[0698]

[0699] SEQ ID NO:271

[0700]

[0701] SEQ ID NO:272

[0702]

[0703] SEQ ID NO:273

[0704]

[0705] SEQ ID NO:274

[0706]

[0707] SEQ ID NO:275

[0708]

[0709] SEQ ID NO:276

[0710]

[0711] SEQ ID NO:277

[0712]

[0713] SEQ ID NO:278

[0714]

[0715] SEQ ID NO:279

[0716]

[0717] SEQ ID NO:280

[0718]

[0719] SEQ ID NO:281

[0720]

[0721] SEQ ID NO:282

[0722]

[0723] SEQ ID NO:283

[0724]

[0725] SEQ ID NO:284

[0726]

[0727] SEQ ID NO:285

[0728]

[0729] SEQ ID NO:286

[0730]

[0731] SEQ ID NO:287

[0732]

[0733] SEQ ID NO:288

[0734]

[0735] SEQ ID NO:289

[0736]

[0737] SEQ ID NO:290

[0738]

[0739] SEQ ID NO:291

[0740]

[0741] SEQ ID NO:292

[0742]

[0743] SEQ ID NO:293

[0744]

[0745] SEQ ID NO:294

[0746]

[0747] SEQ ID NO:295

[0748]

[0749] SEQ ID NO:296

[0750]

[0751] SEQ ID NO:297

[0752]

[0753] SEQ ID NO:298

[0754]

[0755] SEQ ID NO:299

[0756]

[0757] SEQ ID NO:300

[0758]

[0759] SEQ ID NO:301

[0760]

[0761] SEQ ID NO:302

[0762]

[0763] SEQ ID NO:303

[0764]

[0765] SEQ ID NO:304

[0766]

[0767] SEQ ID NO:305

[0768]

[0769] SEQ ID NO:306

[0770]

[0771] SEQ ID NO:307

[0772]

[0773] SEQ ID NO:308

[0774]

[0775] SEQ ID NO:309

[0776]

[0777] SEQ ID NO:310

[0778]

[0779] SEQ ID NO:311

[0780]

[0781] SEQ ID NO:312

[0782]

[0783] SEQ ID NO:313

[0784]

[0785] SEQ ID NO:314

[0786]

[0787] SEQ ID NO:315

[0788]

[0789] SEQ ID NO:316

[0790]

[0791] SEQ ID NO:317

[0792]

[0793] SEQ ID NO:318

[0794]

[0795] SEQ ID NO:319

[0796]

[0797] SEQ ID NO:320

[0798]

[0799] SEQ ID NO:321

[0800]

[0801] SEQ ID NO:322

[0802]

[0803] SEQ ID NO:323

[0804]

[0805] SEQ ID NO:324

[0806]

[0807] SEQ ID NO:325

[0808]

[0809] SEQ ID NO:326

[0810]

[0811] SEQ ID NO:327

[0812]

[0813] SEQ ID NO:328

[0814]

[0815] SEQ ID NO:329

[0816]

[0817] SEQ ID NO:330

[0818]

[0819] SEQ ID NO:331

[0820]

[0821] SEQ ID NO:332

[0822]

[0823] SEQ ID NO:333

[0824]

[0825] SEQ ID NO:334

[0826]

[0827] SEQ ID NO:335

[0828]

[0829] SEQ ID NO:336

[0830]

[0831] SEQ ID NO:337

[0832]

[0833] SEQ ID NO:338

[0834]

[0835] SEQ ID NO:339

[0836]

[0837] SEQ ID NO:340

[0838]

[0839] SEQ ID NO:341

[0840]

[0841] SEQ ID NO:342

[0842]

[0843] SEQ ID NO:343

[0844]

[0845] SEQ ID NO:344

[0846]

[0847] SEQ ID NO:345

[0848]

[0849] SEQ ID NO:346

[0850]

[0851] SEQ ID NO:347

[0852]

[0853] SEQ ID NO:348

[0854]

[0855] SEQ ID NO:349

[0856]

[0857] SEQ ID NO:350

[0858]

[0859] SEQ ID NO:351

[0860]

[0861] SEQ ID NO:352

[0862]

[0863] SEQ ID NO:353

[0864]

[0865] SEQ ID NO:354

[0866]

[0867] SEQ ID NO:355

[0868]

[0869] SEQ ID NO:356

[0870]

[0871] SEQ ID NO:357

[0872]

[0873] SEQ ID NO:358

[0874]

[0875] SEQ ID NO:359

[0876]

[0877] SEQ ID NO:360

[0878]

[0879] SEQ ID NO:361

[0880]

[0881] SEQ ID NO:362

[0882]

[0883] SEQ ID NO:363

[0884]

[0885] SEQ ID NO:364

[0886]

[0887] SEQ ID NO:365

[0888]

[0889] SEQ ID NO:366

[0890]

[0891] SEQ ID NO:367

[0892]

[0893] SEQ ID NO:368

[0894]

[0895] SEQ ID NO:369

[0896]

[0897] SEQ ID NO:370

[0898]

[0899] SEQ ID NO:371

[0900]

[0901] SEQ ID NO:372

[0902]

[0903] SEQ ID NO:373

[0904]

[0905] SEQ ID NO:374

[0906]

[0907] SEQ ID NO:375

[0908]

[0909] SEQ ID NO:376

[0910]

[0911] SEQ ID NO:377

[0912]

[0913] SEQ ID NO:378

[0914]

[0915] SEQ ID NO:379

[0916]

[0917] SEQ ID NO:380

[0918]

[0919] SEQ ID NO:381

[0920]

[0921] SEQ ID NO:382

[0922]

[0923] SEQ ID NO:383

[0924]

[0925] SEQ ID NO:384

[0926]

[0927] SEQ ID NO:385

[0928]

[0929] SEQ ID NO:386

[0930]

[0931] SEQ ID NO:387

[0932]

[0933] SEQ ID NO:388

[0934]

[0935] SEQ ID NO:389

[0936]

[0937] SEQ ID NO:390

[0938]

[0939] SEQ ID NO:391

[0940]

[0941] SEQ ID NO:392

[0942]

[0943] SEQ ID NO:393

[0944]

[0945] SEQ ID NO:394

[0946]

[0947] SEQ ID NO:395

[0948]

[0949] SEQ ID NO:396

[0950]

[0951] SEQ ID NO:397

[0952]

[0953] SEQ ID NO:398

[0954]

[0955] SEQ ID NO:399

[0956]

[0957] SEQ ID NO:400

[0958]

[0959] SEQ ID NO:401

[0960]

[0961] SEQ ID NO:402

[0962]

[0963] SEQ ID NO:403

[0964]

[0965] SEQ ID NO:404

[0966]

[0967] SEQ ID NO:405

[0968]

[0969] SEQ ID NO:406

[0970]

[0971] SEQ ID NO:407

[0972]

[0973] SEQ ID NO:408

[0974]

[0975] SEQ ID NO:409

[0976]

[0977] SEQ ID NO:410

[0978]

[0979] SEQ ID NO:411

[0980]

[0981] SEQ ID NO:412

[0982]

[0983] SEQ ID NO:413

[0984]

[0985] SEQ ID NO:414

[0986]

[0987] SEQ ID NO:415

[0988]

[0989] SEQ ID NO:416

[0990]

[0991] SEQ ID NO:417

[0992]

[0993] SEQ ID NO:418

[0994]

[0995] SEQ ID NO:419

[0996]

[0997] SEQ ID NO:420

[0998]

[0999] SEQ ID NO:421

[1000]

[1001] SEQ ID NO:422

[1002]

[1003] SEQ ID NO:423

[1004]

[1005] SEQ ID NO:424

[1006]

[1007] SEQ ID NO:425

[1008]

[1009] SEQ ID NO:426

[1010]

[1011] SEQ ID NO:427

[1012]

[1013] SEQ ID NO:428

[1014]

[1015] SEQ ID NO:429

[1016]

[1017] SEQ ID NO:430

[1018]

[1019] SEQ ID NO:431

[1020]

[1021] SEQ ID NO:432

[1022]

[1023] SEQ ID NO:433

[1024]

[1025] SEQ ID NO:434

[1026]

[1027] SEQ ID NO:435

[1028]

[1029] SEQ ID NO:436

[1030]

[1031] SEQ ID NO:437

[1032]

[1033] SEQ ID NO:438

[1034]

[1035] SEQ ID NO:439

[1036]

[1037] SEQ ID NO:440

[1038]

[1039] SEQ ID NO:441

[1040]

[1041] SEQ ID NO:442

[1042]

[1043] SEQ ID NO:443

[1044]

[1045] SEQ ID NO:444

[1046]

[1047] SEQ ID NO:445

[1048]

[1049] SEQ ID NO:446

[1050]

[1051] SEQ ID NO:447

[1052]

[1053] SEQ ID NO:448

[1054]

[1055] SEQ ID NO:449

[1056]

[1057] SEQ ID NO:450

[1058]

[1059] SEQ ID NO:451

[1060]

[1061] SEQ ID NO:452

[1062]

[1063] SEQ ID NO:453

[1064]

[1065] SEQ ID NO:454

[1066]

[1067] SEQ ID NO:455

[1068]

[1069] SEQ ID NO:456

[1070]

[1071] SEQ ID NO:457

[1072]

[1073] SEQ ID NO:458

[1074]

[1075] SEQ ID NO:459

[1076]

[1077] SEQ ID NO:460

[1078]

[1079] SEQ ID NO:461

[1080]

[1081] SEQ ID NO:462

[1082]

[1083] SEQ ID NO:463

[1084]

[1085] SEQ ID NO:464

[1086]

Claims

1. A biotin:avidin-based secondary antibody:transposase complex represented by the following formula: Transposase-avidin:(biotin-secondary antibody) n , wherein n is 1, 2, 3 or 4, the avidin is streptavidin, and the transposase is Tn5 transposase.

2. The mixture of the complex of claim 1, which is represented by the following formula: transposase-avidin:(biotin-secondary antibody) p , where p is the average biotin-secondary antibody loading of transposase-avidin, which is greater than 1 and less than 4.

3. A biotin:avidin-based secondary antibody:transposase complex represented by the following formula: (Transposase-Biotin) m :Avidin:(Biotin-Secondary Antibody) n , wherein m and n are each independently 1, 2 or 3, and m+n is less than or equal to 4, the avidin is streptavidin, and the transposase is Tn5 transposase.

4. The complex of claim 3, wherein the biotin is attached to an oligonucleotide of the transposome, the oligonucleotide being a partially paired 5'-phos-CTGTCTCTTATACACAT BT CT BT -3′ and 5′-TCGT BT CGGCAGCGTCAGATGTGTAT BT AAGAGACAG-3′ and / or partially paired 5′-phos-CTGTCTCTTATACACAT BT CT BT -3′ and 5′-GTCTCGTGGGCT BT CGGAGATGTGTAT BT AAGAGACAG-3, or, the oligonucleotide is partially paired with 5'-phos-CT BT GTCTCTTAT BT ACACATCT-3′ and 5′-TCGTCGGCAGCGTCAGATGTGT BT AT BT AAGAGACAG-3′ and / or partially paired 5′-phos-CT BT GTCTCTTAT BT ACACATCT-3′ and 5′-GTCT BT CGTGGGCT BT CGGAGATGTGTATAAGAGACAG-3′,T BT indicates biotinylated T.

5. The mixture of the complexes according to any one of claims 3 to 4, which is represented by the following formula: (transposase-biotin) q :Avidin:(Biotin-Secondary Antibody) p , where q is the average number of transposase molecules loaded by the avidin molecules in the mixture, p is the average number of secondary antibody molecules loaded by the avidin molecules in the mixture, p and q are each greater than or equal to 1 and less than or equal to 3, and q+p is less than or equal to 4.

6. A method for detecting the interaction between a target protein and DNA in a cell, comprising: (1) Incubate cells with primary antibodies against the target protein; (2) incubating the cells incubated with the primary antibody with the complex of any one of claims 1 and 3-4 or the mixture of claim 2 or 5, wherein the secondary antibody in the complex or mixture is specific for the primary antibody and allows the transposase to act on the cell genome; (3) amplification of cellular DNA; (4) purifying the amplified DNA; and (5) Sequencing the amplified DNA.

Images