Specific DNA fragments for sex identification of Chinese sturgeon and their application

Abstract

The present invention belongs to the field of fish sex identification in the field of aquaculture, and specifically relates to a specific DNA fragment and application for sex identification of a spoonbill sturgeon. The present invention successfully screens a female spoonbill sturgeon sex-specific DNA fragment through high-throughput sequencing and comparative genomic methods, and designs primers to accurately and quickly identify its sex, and discloses its primer sequence, PCR reaction system and conditions. The identification method of the present invention is simple, fast, accurate, and has minimal damage to the fish body, which solves the problem of sex identification of a spoonbill sturgeon and will contribute to the development of the spoonbill sturgeon breeding industry.

Description

Technical Field

[0001] The invention belongs to the field of fish sex identification in the field of aquaculture, and in particular relates to a specific DNA fragment for sex identification of a paddlefish and an application thereof. Background Art

[0002] The spoonbill sturgeon belongs to the order Acipenseriformes and the family Acipenseridae. Its diet is similar to that of bighead carp, feeding on plankton. Its breeding cost is low, and its eggs can be made into caviar with high economic value. Sex identification of spoonbill sturgeons during breeding is of great significance in commercial fish production, broodstock breeding and caviar production, which can reduce breeding costs and improve breeding efficiency. Sturgeons are characterized by fast growth and long sexual maturity, and the secondary sexual characteristics of male and female individuals are not obvious. In the early stages of their development, it is impossible to distinguish between males and females from their morphology. At present, the sex identification of sturgeons is mainly carried out by ultrasound, extra-abdominal surgery and abdominal puncture at home and abroad (Chen Xihua et al., 2004; Lu Hongshen et al., 2019).

[0003] Unlike higher bony fish, sturgeons have experienced multiple genome doublings during their evolution. The genera Pseudosphagidae and Pseudosphagidae of the family Acipenser, as well as the genera Pseudosphagidae, Pseudosphagidae and Pseudosphagidae of the family Acipenser, are all tetraploid, with a model chromosome number of about 120 and a DNA content of about 4.00 pg (Ludwig et al., 2001; Zeng et al., 2014; Dong et al., 2015). The polyploid nature of sturgeon chromosomes increases the difficulty of genome sequencing and the difficulty of screening for sex chromosomes and sex-determining genes in sturgeons. With the development of molecular biology technology, researchers have detected the genomic differences between male and female individuals of various sturgeons through ISSR, AFLP and RAPD molecular markers, but no sex-specific DNA molecular markers have been detected for sturgeons (Wuertz et al., 2006; Keyvanshokooh et al., 2007; McCormick et al., 2008; Yarmohammadi et al., 2011; Liu Cui, 2011; Liu Xueqing et al., 2015). With the rapid development of high-throughput sequencing technology, specific molecular markers for identifying the sex of sturgeons can be obtained through whole genome sequencing and comparative genomics analysis. At present, sex-specific markers have been screened in Chinese sturgeon, Acipenser dabryanus, Acipenser schrenckii, Sterculia schrenckii, Western hybrid (Acipenser siberianus ♀×Acipenser schrenckii ♂), European sturgeon, Acipenser siberianus, Acipenser russianus and Acipenser splenicus, and an efficient, convenient and accurate sex identification method has been established.

[0004] The present invention invents a female sex-specific marker for spoonbill sturgeon based on low-coverage whole genome sequencing and comparative genomics. Summary of the invention

[0005] The object of the present invention is to provide a specific DNA fragment SSM1 for sex identification of spoonbill sturgeon, wherein the DNA fragment SSM1 is shown as SEQ ID NO.1.

[0006] Another object of the present invention is to provide primers designed for the sequence shown in SEQ ID NO.1.

[0007] Another object of the present invention is to provide an application of a reagent for detecting the sequence shown in SEQ ID NO.1 in the sex identification of Chinese paddlefish, thereby solving the problem of early sex identification of Chinese crab and contributing to the development of Chinese crab breeding industry.

[0008] The last object of the present invention is to provide a method for sex identification of spoonbill sturgeon, which is simple and has an accuracy rate of 100%.

[0009] In order to achieve the above object, the present invention adopts the following technical measures:

[0010] A specific DNA fragment for sex identification of paddlefish, wherein the nucleotide sequence of the DNA fragment is shown in SEQ ID NO.1.

[0011] The protection scope of the present invention also includes:

[0012] A reagent for detecting the specific DNA fragment for sex identification of the above-mentioned spoonbill;

[0013] The reagents described above are preferably PCR primers.

[0014] The primers described above are preferably F: GTTATGCCATAAATTAGACCA and R: TCCGTTATAATAAAGTCTAGC.

[0015] The present invention provides one of the primer pairs for detecting the sequence shown in SEQ ID NO.1, and other primer pairs that increase or decrease bases can also detect the sequence.

[0016] Application of a reagent for detecting the sequence shown in SEQ ID NO.1 in sex identification of paddlefish.

[0017] A method for identifying the sex of a spoonbill sturgeon is provided, which is determined by detecting whether the spoonbill sturgeon genome contains the polynucleotide sequence shown in SEQ ID NO.1; if the polynucleotide shown in SEQ ID NO.1 is contained, the individual is a female.

[0018] The detection methods include but are not limited to currently available genome sequencing and PCR methods.

[0019] Compared with the prior art, the present invention has the following advantages and effects:

[0020] The sex-specific DNA molecule fragment provided by the present invention can verify the sex of the spoonbill sturgeon with 100% accuracy by conventional PCR amplification. Compared with previous surgical operations or ultrasonic testing, this technology has the advantages of being accurate, simple, fast, and less harmful to the fish body, thus providing help for the spoonbill sturgeon breeding industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a schematic diagram of the results of the female sex-specific DNA fragment SSM1 in the genetic sex identification of the Chinese sturgeon;

[0022] In the figure, lanes 1-12 represent that all female individuals can amplify a 90 bp specific band, and lanes 13-24 represent that no band can be amplified in male individuals. C represents the negative control, and M represents the DL2000 DNA marker. DETAILED DESCRIPTION

[0023] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art; the reagents or materials described, unless otherwise specified, are all from commercial channels.

[0024] Embodiment 1:

[0025] Obtaining specific DNA fragments for sex identification of Chinese sturgeon:

[0026] Twelve male and female spoonbill sturgeons were identified using paraffin sections of gonadal tissue, and their whole genome DNA was extracted. Sequencing libraries were constructed and sequenced on the Illumina sequencing platform to obtain whole genome sequencing data of male and female spoonbill sturgeons. Female sex-specific DNA fragments were obtained through comparative genomics analysis, and corresponding primers were designed to verify their effectiveness in the population. Finally, a female-specific DNA fragment (SEQ ID NO.1) was obtained, and no homologous sequences were found through comparison with the GenBank database.

[0027] Embodiment 2:

[0028] Method for using specific DNA fragments for sex identification of spoonbill sturgeon:

[0029] 1) Design primers for the sequence shown in SEQ ID NO.1:

[0030] F:GTTATGCCATAAATTAGACCA and R:TCCGTTATAATAAAGTCTAGC.

[0031] 2) PCR amplification:

[0032] The reaction system is about 50 ng of template DNA; 1.5 U of Taq polymerase; 2.5 μl of 10× amplification buffer; 200 μM concentrations of the four dNTPs; 0.2 μM final concentrations of the upstream and downstream primers; and ddH2O supplemented to 25 μl.

[0033] The PCR reaction conditions corresponding to the primers are: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 50°C for 30 s, extension at 72°C for 15 s, 35 cycles; final extension at 72°C for 7 min; and storage at 4°C.

[0034] After the PCR amplification is completed, 2% agarose gel is prepared for electrophoresis detection. The amplified specific bands are female individuals, and the unamplified specific bands are male individuals.

[0035] Embodiment 3:

[0036] Application of specific DNA fragments in sex identification of Chinese sturgeon:

[0037] 1) Twelve fin ray tissue samples of known male and female Sturgeons were stored in anhydrous ethanol, and their genomic DNA was extracted using the high salt method, diluted to 50 ng / μL and stored at -20℃ for later use;

[0038] 2) performing PCR amplification on the above-mentioned P. spatholobi DNA sample using the method of Example 2;

[0039] 3) The amplification results are as follows:

[0040] Figure 1 The amplification results of the spoonbill are shown: lanes 1-12 in the figure show that all female individuals can amplify a 90bp specific band, and lanes 13-24 show that no band can be amplified in male individuals. C represents the negative control, and M represents the DL2000 DNA marker.

Claims

1. Use of a reagent for detecting a specific DNA fragment for sex identification of a spoonbill in sex identification of a spoonbill, wherein the nucleotide sequence of the DNA fragment is shown in SEQ ID NO.

1.

2. The use according to claim 1, wherein the reagent is a PCR primer.

3. The use according to claim 2, wherein the PCR primers are: F: GTTATGCCATAAATTAGACCA and R: TCCGTTATAATAAAGTCTAGC.

4. A method for identifying the sex of a spoonbill, comprising detecting whether the spoonbill genome contains the polynucleotide sequence shown in SEQ ID NO.1; if the polynucleotide sequence shown in SEQ ID NO.1 is contained, the individual is a female.

Images