Establishment method and application of soybean NLRs disease-resistant gene rapid identification system

Abstract

The invention relates to an establishment method and application of a soybean NLRs disease-resistant gene rapid identification system. The establishment method comprises the following steps: constructing an expression vector with pathogenic microorganism effect protein and an expression vector carrying soybean candidate NLRs disease-resistant genes; respectively adding into an agrobacterium GV3101 strain, and carrying out electrotransformation to obtain two carrier bacterial liquids; a pathogen effector and an NLRs anti-disease gene from soybean are simultaneously expressed in two-week-old cowpea pair cotyledons through an agrobacterium-mediated transient expression system, and after the cowpea pair cotyledons are placed at 22 DEG C for 5 days, the allergic necrosis phenotype on the leaves is observed to judge whether the NLRs are key anti-disease genes for identifying corresponding pathogenic microorganism effector proteins or not. According to the invention, cowpea is compatible with more soybean NLRs disease-resistant genes capable of identifying pathogenic microorganisms through indirect regulatory factors, so that the cowpea is more suitable for high-throughput screening of the soybean NLRs disease-resistant genes, and the cloning time of the traditional soybean NLRs disease-resistant genes is greatly shortened; and an important technical system is provided for large-scale excavation of the soybean NLRs disease-resistant gene and subsequent soybean disease-resistant breeding.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to a method for establishing a rapid identification system for soybean NLRs disease resistance genes and its application. Background Art

[0002] Using disease-resistant genes for disease-resistant breeding is one of the most effective means of preventing and controlling crop diseases. Among them, the most valuable and widely used is a class of disease-resistant genes called nucleotide-binding domain and leucine-rich repeat proteins (NLRs). This class of genes is the largest class of disease-resistant genes in plants. NLRs disease-resistant genes activate host resistance to pathogens by recognizing various pathogen effectors, usually accompanied by hypersensitive response (HR). Although it has been nearly 30 years since the first NLRs disease-resistant gene was cloned, the subsequent cloning of NLRs has been very slow due to the huge workload of traditional cloning methods. So far, only more than 400 NLRs disease-resistant genes have been cloned in all plants, and only 8 NLR disease-resistant genes have been identified in soybean crops. Soybean is currently the most important oil crop in my country and an important source of animal feed protein. Soybean diseases caused by pathogenic microorganisms are one of the important factors limiting soybean production. Among them, soybean virus diseases are common in major production areas in my country, seriously threatening the increase in soybean production capacity. However, the resistant varieties currently planted are very single, so identifying new disease-resistant genes and cultivating new resistant varieties are very important for my country's soybean production safety.

[0003] Compared with food crops such as rice, the number of cloned NLRs disease resistance genes in soybean is the least. One of the reasons is that the soybean genome is complex and there is a lack of more effective means to identify disease resistance genes. Previously, researchers used the Agrobacterium-mediated transient gene expression system to study the interaction between pathogen effectors and NLRs disease resistance genes, and found that the simultaneous expression of pathogen effectors and disease resistance genes will produce a hypersensitive necrosis reaction (HR). Later, based on the principle that NLRs disease resistance genes recognize pathogen effectors to produce a hypersensitive necrosis reaction, vectors carrying NLRs disease resistance genes and vectors carrying pathogen effectors were co-expressed in Nicotiana benthamiana through Agrobacterium-mediated co-expression, and then effective NLRs disease resistance genes were screened by whether HR appeared, thereby saving a lot of time in identifying NLRs disease resistance genes. Although most previous studies have shown that transient co-expression of NLRs and pathogen effectors in Nicotiana benthamiana (a plant of the Solanaceae family) can be used to rapidly identify NLRs disease resistance genes, Nicotiana benthamiana and soybean are quite different species. There is a certain probability that Nicotiana benthamiana lacks the regulatory factors required for the function of soybean NLRs disease resistance genes, and thus misses many indirectly identified NLRs disease resistance genes. Therefore, Nicotiana benthamiana is not suitable for the precise identification and high-throughput screening of soybean NLRs disease resistance genes.

[0004] Because soybean leaves cannot effectively express genes transiently, it is impossible to quickly identify NLRs disease resistance genes on soybeans through transient gene expression. The present invention found through Agrobacterium-mediated transient gene expression system experiments that cowpea cotyledons can effectively express genes transiently and express viral effector proteins, which can stimulate cowpea's own NLR disease resistance genes to induce a strong allergic necrosis reaction ( Figure 1 ). Cowpea and soybean belong to the same leguminous plant family and have a close evolutionary relationship with soybean. Therefore, establishing a rapid identification system for NLR disease resistance genes in cowpea is of great significance for the high-throughput rapid screening of soybean NLR disease resistance genes and subsequent soybean disease resistance breeding. Summary of the invention

[0005] Technical problem to be solved: Based on the problem that the prior art can only use Nicotiana benthamiana to identify disease-resistant genes that directly identify pathogens, and cannot cover all soybean NLRs disease-resistant genes, cowpea belongs to the same legume family as soybean, has more regulatory factors unique to legumes, and is compatible with soybean NLRs disease-resistant genes that identify pathogenic microorganisms through indirect regulatory factors; the present invention finds that cowpea cotyledons can effectively express genes transiently, so based on the Agrobacterium transient expression system on cowpea, the present invention provides a method for establishing a soybean NLRs disease-resistant gene rapid identification system and its application, which can be used for rapid identification and large-scale screening of soybean NLRs disease-resistant genes, and can also be extended to the identification of NLRs disease-resistant genes of other legumes.

[0006] Technical solution: A method for establishing a rapid identification system for soybean NLRs disease resistance genes, the steps are as follows:

[0007] Step 1: Material preparation: construct a vector with pathogenic microorganism effectors and an expression vector carrying soybean NLRs disease resistance genes;

[0008] Step 2: Electroporation transformation of Agrobacterium: The constructed vector with pathogen effector and the expression vector carrying soybean NLRs disease resistance gene were added to Agrobacterium tumefaciens GV3101 strain for electroporation to obtain two vector bacterial solutions; then the two vector bacterial solutions were respectively aspirated to liquid LB medium for culture, and the bacterial solutions were used after culture at 220 rpm for 16 hours;

[0009] Step 3: Plant cowpeas, and after growing for 2 weeks, select plants that have just grown two opposite cotyledons for use;

[0010] Step 4: Treatment of Agrobacterium and infiltration of cowpea plants. Centrifuge the culture solution after step 2, collect the cells, discard the supernatant, suspend the cells with the treatment solution and adjust the OD 600 To 1.2, two Agrobacterium treatment solutions are obtained. The treatment solutions are placed in a 28°C constant temperature incubator away from light and allowed to stand for 1 hour. Then, the two Agrobacterium treatment solutions are mixed at a volume ratio of 1:1 to obtain an Agrobacterium treatment solution mixed system. Then, the Agrobacterium treatment solution mixed system is sucked up with a syringe and slowly pushed into the planned infiltration area on the back of the cotyledon. Do not use too much force to avoid mechanical damage. Place at 22°C for 5 days.

[0011] Step 5: Observe the allergic necrosis reaction phenotype on the leaves to determine whether the NLRs candidate disease resistance gene recognizes pathogenic microorganism effectors.

[0012] Preferably, the vector carrying the pathogenic microorganism effector in step 1 is an infectious clone carrying the complete viral sequence, and the infectious clone is an expression vector of the full-length genome sequence of soybean mosaic virus with the effector.

[0013] Preferably, the expression vector carrying the candidate disease resistance gene of the legume plant in step 1 is an expression vector having the full-length cDNA of the disease resistance candidate gene at the soybean mosaic virus resistance Rsv1 site.

[0014] Preferably, the Agrobacterium tumefaciens strain in step 2 is Agrobacterium tumefaciens strain GV3101.

[0015] Preferably, in the step 2, two carrier bacterial solutions are respectively aspirated into the culture medium for culture, and the bacterial solutions are set aside after culture, specifically as follows: the two carrier bacterial solutions are respectively added into the non-resistant LB culture medium, the volume ratio of each carrier bacterial solution to the LB culture medium is 1:800, and cultured in a shaker at 28°C and 220rpm for 3h; then the bacterial solutions are respectively aspirated, evenly spread on the LB solid culture medium plate containing kanamycin and rifamycin resistance, and cultured inverted in a constant temperature incubator at 28°C for 2 days; after 2 days, a single colony of Agrobacterium is picked up and added into the liquid LB culture medium with kanamycin / rifamycin resistance, and cultured in a shaker at 28°C and 220rpm overnight.

[0016] Preferably, after the culture, glycerol is added to the bacterial solution to obtain glycerol bacteria, which are stored in a -80°C refrigerator. When used, the glycerol bacteria need to be picked out and streaked onto a kanamycin / rifamycin LB solid culture medium plate and cultured overnight at 28°C. The next day, a single colony is picked out and added to the corresponding resistance LB liquid culture medium and cultured overnight at 28°C and 220rpm in a shaker.

[0017] Preferably, the method for planting cowpea in step three is as follows: black soil and vermiculite are mixed in a mass ratio of 6:4 and then put into a plastic cup; a cowpea seed is placed in a plastic cup filled with soil and covered with a thin layer of soil; the greenhouse growth conditions are set to 25° C., 16 h of light, and grown for 2 weeks, until the cowpea grows two opposite cotyledons for use.

[0018] Preferably, the treatment liquid in step 4 is MMA, 50 mL, and the specific formula is as follows: 0.5M MES 1 mL, 1MMgCl2 500uL, 100mMAS 50uL, and ddH2O is added to make up to 50 mL.

[0019] Preferably, when the mixed system of the Agrobacterium treatment solution is sucked up with a syringe and pushed into the planned infiltration area on the back of the leaf in step 4, if some cowpea leaves are difficult to infiltrate, the leaves are first punched with a needle, and then the syringe is used to align the holes for injection.

[0020] Based on the application of the above method in identifying soybean NLRs disease resistance genes.

[0021] In early experiments, the applicant discovered that the cotyledons of the legume plant cowpea can effectively express genes transiently and express the effector protein 2a of cucumber mosaic virus, which can stimulate the cowpea's own NLRs disease resistance genes to induce a strong allergic necrosis reaction ( Figure 1 ), indicating that it has the ability to transiently express genes through Agrobacterium in cowpea and can induce a strong allergic necrosis reaction.

[0022] Therefore, the applicant used Agrobacterium-mediated method to infiltrate the infectious clone of soybean mosaic virus (SMV) and multiple NLRs disease resistance genes at the Rsv1 resistance locus roughly located on soybean variety PI96983 (operation diagram as shown in FIG. Figure 2 ), and SMV and one of the candidate genes showed a strong allergic necrosis reaction ( Figure 4 ), and the expression of the virus tagged with green fluorescent protein can be seen in the inoculated area by inverted fluorescence microscopy ( Figure 3 ), but on the contrary, no hypersensitivity necrosis reaction was observed between the NLRs resistance gene and SMV in Nicotiana benthamiana ( Figure 5 ).

[0023] The present invention establishes a soybean NLRs disease resistance gene rapid identification system on cowpea for the first time, using the Agrobacterium infiltration method to co-infiltrate the soybean mosaic virus full-length cDNA infectious clone carrying the effector and the soybean NLRs candidate disease resistance gene overexpression vector, and observes the hypersensitive necrosis reaction (HR) on the leaves at 22°C for 5 days. And the applicant has used the NLRs disease resistance gene rapid identification system on cowpea to identify the major disease resistance gene of soybean mosaic virus resistance site Rsv1, and the major gene was not identified in Nicotiana benthamiana, indicating that the cowpea system is indeed compatible with the disease resistance genes missed by the Nicotiana benthamiana identification system.

[0024] Beneficial effects: 1. The present invention provides a legume plant cowpea that grows fast, has a short planting cycle, is easy to operate and convenient to infiltrate with Agrobacterium, which can speed up the progress of the experiment. The cowpea has a short growth cycle and a short waiting time for use. When infiltrating cowpea with Agrobacterium, it only needs to be two weeks old, while it takes about a month to infiltrate Nicotiana benthamiana.

[0025] 2. The soybean NLRs disease resistance gene rapid identification system on cowpea provided by the present invention can perform high-throughput screening of soybean NLRs disease resistance genes. Because cowpea and soybean belong to the same leguminous plant family and have a close evolutionary relationship with soybean, the cowpea system will have a similar signal pathway and can be compatible with soybean NLR disease resistance genes that recognize pathogenic microorganisms through indirect regulatory factors. Currently, only about half of the cloned disease resistance genes are in the mode of disease resistance genes directly recognizing pathogen effectors. Therefore, the soybean NLRs disease resistance gene rapid identification system on cowpea greatly improves the working accuracy and can better find the main effect gene of the resistance site.

[0026] 3. The infectious clones in the soybean NLRs disease resistance gene rapid identification system provided by the present invention can be replaced with other pathogenic microorganism effector proteins, and the soybean NLRs disease resistance genes can also be replaced with NLRs disease resistance genes of other leguminous crops. Therefore, it can be expanded to large-scale identification of NLRs disease resistance genes of other leguminous plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The effector protein 2a of cucumber mosaic virus (CMV) and the negative control green fluorescent protein (GFP) were infiltrated into the cotyledons of 2-week-old cowpea. The results showed that the expression of CMV effector protein 2a caused a strong hypersensitive necrosis reaction in cowpea, while green fluorescent protein GFP did not cause necrosis.

[0028] Figure 2 a is to construct a vector with pathogen effectors and an expression vector carrying the NLRs disease resistance gene at the Rsv1 locus. The target fragments of the two vectors are driven by the 35s promoter; Figure 2 b is a flow chart of a specific implementation method of the disease resistance gene identification system on cowpea;

[0029] Figure 3 The expression of SMV infectious clones with green fluorescent protein tags in the inoculated area of ​​cowpea leaves;

[0030] Figure 4 The results of infiltration of Rsv1 candidate gene 13g190800 on cowpea leaves. (a) is the original image of cowpea leaves after infiltration, and (b) is the image of cowpea leaves irradiated under ultraviolet light after infiltration. The expression vector carrying Rsv1 disease resistance candidate gene p2300-190800 and the SMV full-length cDNA infectious clone with viral effectors produced hypersensitive necrosis after co-infiltration, and the control group infiltrated with p2300-190800 and SMV separately did not show hypersensitive necrosis. EV is an empty plant expression vector without any target gene, and CMV2a is a positive control that causes hypersensitive necrosis.

[0031] Figure 5 This is the result of infiltrating Rsv1 candidate gene 13g190800 on Nicotiana benthamiana leaves. As can be seen from the figure, no allergic necrosis reaction occurred after co-infiltration of Rsv1 disease resistance candidate gene p2300-190800 and SMV infectious clone, indicating that the identification system of cowpea is indeed compatible with the identification of more soybean NLRs disease resistance genes; as a positive control, co-expression of Solanaceae NLR disease resistance gene Sw-5b and tomato spotted wilt virus effector protein NSm caused a strong allergic necrosis reaction on Nicotiana benthamiana leaves. DETAILED DESCRIPTION

[0032] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments.

[0033] In the embodiments of this specification:

[0034] Escherichia coli DH5α competent cells and Agrobacterium tumefaciens competent cells GV3101 were purchased from Shanghai Biotechnology Co., Ltd.

[0035] LB medium (200 mL): Tryptone (tryptone) 2g, Yeast extract (yeast extract) 1g, NaCl (sodium chloride) 2g, add pure water to make up to 200mL; add Agar (agar) 3g when preparing solid culture medium.

[0036] Kanamycin (50 mg / mL) was prepared with water; rifamycin (25 mg / mL) was prepared with anhydrous ethanol.

[0037] The cowpea variety used was Vigna serrata.

[0038] Agrobacterium treatment solution (MMA, 50 mL): 0.5 M MES (2-morpholineethanesulfonic acid) 1 mL, 1 M MgCl2 (magnesium chloride) 500 uL, 100 mM AAS (acetosyringone) 50 uL, add ddH2O to make up to 50 mL.

[0039] Example 1

[0040] This example provides a method for establishing a rapid identification system for soybean NLRs disease resistance genes and its application, see Figure 2 ,

[0041] Here are the steps:

[0042] Step 1: ① construct a vector with pathogenic microorganism effectors, in this embodiment, a SMV infectious clone with a complete virus sequence, specifically the SMV infectious clone pCB301-SMVSC7-GFP, the construction method of pCB301-SMVSC7 refers to the patent publication CN 111440818 B (soybean mosaic virus infectious cloning vector and Agrobacterium strain capable of infecting tobacco and its application, Nanjing Agricultural University, Zhi Haijian, etc.), in order to facilitate subsequent observation, a green fluorescent protein tag GFP is inserted into the tail of pCB301-SMVSC7 by conventional methods;

[0043] ②Construction of expression vector carrying soybean NLRs disease resistance gene:

[0044] In this embodiment, the candidate disease resistance gene 13g190800 (sequence as shown in SEQ ID No. 1) of the soybean mosaic virus Rsv1 site on the soybean variety PI96983 was cloned, and the p2300-190800 expression vector was constructed using the gene. In the process of constructing the vector, the method of enzyme ligation was used, and the protective base and the restriction site were added to the 5' end of the forward primer and the 3' end of the reverse primer, and the cDNA of PI96983 was used as a template to amplify the complete 13g190800 fragment with the protective base and the restriction site. Afterwards, the restriction endonucleases Sac I and BamH I (NEB) were used according to the 50uL system (Sac I 1μL, BamH I 1μL, rCutsmart Buffer 5μL, fragments or plasmids 15μL or 8μL, pure water was added to 50μL) to respectively enzyme-cut the previously amplified fragment and the expression vector pCAM2300s-flag-strep, so that the two produced sticky ends. Then use Takara's T4DNALigase (2011A) to add fragments, ligase, and restriction plasmid, so that the fragments can be loaded onto the restriction plasmid under the action of T4 ligase. Then select the correct recombinant vector for subsequent experiments through colony PCR and sequencing. The details are as follows:

[0045] (1) Total RNA was extracted from the leaves of PI96983 using the Beijing Tiangen Plant Total RNA Extraction Kit (DP432), and the total RNA was finally eluted according to the instructions (DP432-20170329). According to the specific primer 190800-R 1μL, 10mM dNTP mix 1uL, 10μL total RNA system was mixed at 65℃ for 5 minutes and then placed on ice. Then, the reverse transcription kit of Promega was used, and the following volume (M-MLV 5×buffer 5μL, Recombinant RNaseInhibitor 1.6μL, M-MLV RT 1μL, RNase-free ddH2O 5.4μL) was mixed to 25uL, and placed in a PCR instrument and set to 42℃ for 60 minutes and 72℃ for 15 minutes. After the program was completed, it was directly placed on ice for use.

[0046] (2) Cloning of the NLRs disease resistance gene 13g190800 at the soybean mosaic virus Rsv1 locus in soybean variety PI96983 The cDNA obtained by reverse transcription was amplified using the following primers:

[0047] 190800-SacI-F:TTTCGCGAGCTCATGGCACTAGAATTGGTCGG(SEQ ID No.3)

[0048] 190800-BamHI-R:CGCGGATCCCCTTATATCCACGTCTTCAATGTGA(SEQ ID No.4)

[0049] The reverse transcribed cDNA was used as a template and amplified using a 50 μL system of Phanta Max Super-Fidelity DNA Polymerase (Novozyme P505-d1) (2×PhantaMax Buffer 25uL, dNTP Mix (10mM each) 1uL, upstream primer (10μM) 2uL, downstream primer (10μM) 2uL, Phanta Max Super-Fidelity DNA Polymerase 1uL, 20×PI96983 cDNA 1uL, ddH2O to 50uL), the amplification program was 95°C for 5 minutes; 35 cycles of 95°C for 15 seconds, 56°C for 30 seconds, and 72°C for 2 minutes and 30 seconds; 72°C for 5 minutes; the PCR product was subjected to agarose gel electrophoresis, and a fragment of about 3.2kb was cut out for recovery and purification.

[0050] (3) The previously amplified fragment and the expression vector pCAM2300s-flag-strep (sequence see SEQ ID No. 2) were double-digested with restriction endonucleases Sac I and BamH I (NEB). The mixed sample was placed in a 37°C constant temperature incubator for 3 hours according to a 50uL system (Sac I 1μL, BamH I 1μL, rCutsmart Buffer 5μL, fragment or plasmid 15μL or 8μuL respectively, and pure water was added to 50μL). After that, agarose gel electrophoresis was performed to detect a single band, and the gel was cut, recovered and purified to obtain the p2300-190800 expression vector.

[0051] Step 2: Electroporation transformation of Agrobacterium (Agrobacterium strain GV3101)

[0052] a) Pipette 1 μl of the constructed SMV infectious clone, p2300-190800, and the CMV2a expression vector p2300-CMV2a (positive control, see Figure 1, only the expression of 2a protein caused a strong allergic necrosis reaction in cowpea) and pCAM2300s-flag-strep empty vector (no gene was expressed, used as a control in subsequent experiments to exclude the influence of Agrobacterium on the experiment) were added to the prepared Agrobacterium competent cells (GV3101 strain) respectively, and the centrifuge tube wall was flicked to mix the system. Among them, p2300-CMV2a is an existing vector, and its construction method can be found in the public document "The 2aprotein ofCucumber mosaic virus induces a hypersensitive response incowpeaindependently ofits replicase activity." (The 2aprotein ofCucumber mosaic virus induces a hypersensitive response), the website is https: / / doi.org / 10.1016 / j.virusres.2012.10.007);

[0053] b) adding the above systems to clean and sterilized electroporation cups respectively, and performing electroporation using an electroporator in the Agrobacterium electroporation mode; c) adding 800 μl of antibiotic-free LB medium respectively, and culturing in a shaker at 28°C and 220 rpm for 3 h;

[0054] d) 100 μl of bacterial solution was taken respectively and evenly spread on LB solid culture medium plates containing 50 mg / mL kanamycin and 25 mg / mL rifamycin resistance, and then inverted and cultured in a 28°C constant temperature incubator for 2 days.

[0055] e) After 2 days, a single colony of Agrobacterium was picked and added to 5 ml of liquid LB medium with kanamycin / rifamycin resistance, and cultured overnight in a shaker at 28°C and 220 rpm.

[0056] f) Pipette 600 μl of bacterial solution, add 300 μl of 60% glycerol and store in a -80°C refrigerator.

[0057] Step 3: Cowpea Planting

[0058] a) Mix black soil and vermiculite in a mass ratio of 6:4 and put them into a plastic cup;

[0059] b) Place a cowpea seed in a plastic cup filled with soil and cover it with a thin layer of soil;

[0060] c) The greenhouse growth conditions are set at 25°C and 16 hours of light. After about 2 weeks of growth, the cowpea will grow two opposite cotyledons for use (use before the third and fourth leaves grow, otherwise the cotyledons are too old and the expression effect is not good).

[0061] Step 4: Treatment of Agrobacterium and infiltration of cowpea plants

[0062] a) Before Agrobacterium treatment, activation is required. The preserved SMV infectious clones, p2300-190800, CMV2a expression vectors and empty vector glycerol bacteria are streaked onto LB solid medium plates containing 50 mg / mL kanamycin and 25 mg / mL rifamycin resistance and cultured overnight. The next day, a single colony is picked and added to 5 ml of LB liquid medium with corresponding resistance and cultured overnight.

[0063] b) Add the Agrobacterium liquid of the four vectors into 2 mL centrifuge tubes respectively, and centrifuge at 6000 rpm for 5 min to collect the bacteria; discard the supernatant and repeat once;

[0064] c) Discard the supernatant, use 2 mL of Agrobacterium treatment solution (MMA) to suspend the bacteria and adjust the OD 600 to 1.2, put in 28℃

[0065] Place in a constant temperature incubator away from light for 1 h;

[0066] d) SMV, p2300-190800 and empty vector were mixed in a 1:1 ratio in pairs (if the infectivity of the infectious clone is poor, more processing solution of the infectious clone can be appropriately added). SMV and p2300-190800 were co-infiltrated as the experimental group of this experiment, the empty vector, SMV and p2300-190800 were co-infiltrated as the control group of this experiment, and CMV2a alone was infiltrated as a positive control.

[0067] e) Use a 1 ml syringe to absorb the mixed system of Agrobacterium treatment solution prepared above, hold the index finger of one hand against the front of the cowpea leaf, and use the syringe with one hand to push the Agrobacterium treatment solution system into the planned infiltration area on the back of the leaf one by one. If some cowpea leaves are difficult to infiltrate, you can first use a needle to punch holes in the leaves, and then use the syringe to align the holes for injection.

[0068] f) After 5 days at 22 degrees Celsius (this temperature has a great influence on the phenotypic results of HR, so each different infectious clone needs to explore the appropriate temperature), the phenotype on the leaves can be observed to determine whether the candidate disease resistance gene recognizes SMV and produces HR. Figure 4 The candidate gene 13g190800 co-infiltrated with the full-length infectious clone of SMV produced a hypersensitive necrosis phenotype similar to the positive control CMV2a, preliminarily indicating that 13g190800, as an effective NLRs disease resistance gene, recognized SMV and initiated downstream immune responses. The control groups of p2300-190800 vector and empty vector (EV) did not show a necrotic phenotype, further excluding the possibility of immune self-activation of the disease resistance gene.

[0069] g) Microscopic preparation of cowpea leaves infiltrated with SMV-infectious clones and empty vectors. Since a green fluorescent protein tag is inserted into the SMV-infectious clone, the green fluorescence intensity can be observed by an inverted fluorescence microscope to determine the expression of the SMV-infectious clone. Figure 3 As shown, SMV infectious clones were well expressed.

[0070] h) Finally, we used the same method to infiltrate the candidate gene 13g190800 with the SMV infectious clone in N. benthamiana. The results showed that p2300-190800 could not produce a hypersensitive necrosis reaction with the full-length SMV infectious clone in N. benthamiana (see Figure 5 ). The reported tomato NLR disease resistance gene Sw-5b and the mobile protein NSm of tomato spotted wilt virus co-infiltration induced a strong hypersensitive necrosis reaction in Nicotiana benthamiana. This result illustrates the advantage of cowpea as a soybean NLRs disease resistance gene identification system.

[0071] Finally, it should be noted that the above implementation modes are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned implementation modes, a person of ordinary skill in the art should understand that the technical solutions described in the aforementioned implementation modes can still be modified, or some or all of the technical features therein can be replaced by equivalents. However, these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the implementation modes of the present invention.

Claims

1. A method for establishing a rapid identification system for soybean NLRs disease resistance genes, characterized in that: Here are the steps: Step 1: Material preparation: construct a vector with pathogenic microorganism effectors and an expression vector carrying soybean candidate NLRs disease resistance genes; Step 2: Electroporation transformation of Agrobacterium: The constructed vector with pathogen effector and the expression vector carrying the candidate disease resistance gene of soybean are added to Agrobacterium tumefaciens GV3101 strain for electroporation to obtain two vector bacterial solutions; then the two vector bacterial solutions are respectively aspirated to liquid LB medium for culture, and the bacterial solutions are used after culturing at 220 rpm for 16 hours; Step 3: Plant cowpeas, and after growing for 2 weeks, select plants that have just grown two opposite cotyledons for use; Step 4: Treatment of Agrobacterium and infiltration of cowpea plants. Centrifuge the culture solution after step 2, collect the cells, discard the supernatant, suspend the cells with the treatment solution and adjust the OD 600 To 1.2, two Agrobacterium treatment solutions are obtained, and the treatment solutions are placed in a 28°C constant temperature incubator away from light for 1 hour, and then the two Agrobacterium treatment solutions are mixed at a volume ratio of 1:1 to obtain an Agrobacterium treatment solution mixed system, and then the Agrobacterium treatment solution mixed system is sucked with a syringe and slowly pushed into the planned infiltration area on the back of the cotyledon, and placed at 22°C for 5 days; Step 5: Observe the allergic necrosis reaction phenotype on the leaves to determine whether the NLRs candidate disease resistance gene recognizes pathogenic microorganism effectors.

2. The method for establishing a rapid identification system of soybean NLRs disease resistance genes according to claim 1, characterized in that: The vector carrying the pathogenic microorganism effector in step 1 is an infectious clone carrying a complete viral sequence, and the infectious clone is an expression vector of the full-length genome sequence of soybean mosaic virus containing viral effector proteins.

3. The method for establishing a rapid identification system of soybean NLRs disease resistance genes according to claim 1, characterized in that: The expression vector carrying the candidate disease resistance gene of leguminous plants in step 1 is a vector having soybean mosaic virus resistance Rsv1 Expression vector of full-length cDNA of candidate NLRs disease resistance gene at the site.

4. The method for establishing a rapid identification system of soybean NLRs disease resistance genes according to claim 1, characterized in that: The Agrobacterium tumefaciens strain in step 2 is Agrobacterium tumefaciens strain GV3101.

5. The method for establishing a rapid identification system of soybean NLRs disease resistance genes according to claim 1, characterized in that: In the step 2, the two carrier bacterial liquids are respectively aspirated into the culture medium for cultivation, and the bacterial liquids are set aside after cultivation, specifically as follows: the two carrier bacterial liquids are respectively added into the non-resistant LB culture medium, the volume ratio of each carrier bacterial liquid to the LB culture medium is 1:800, and the culture is carried out in a shaker at 28°C and 220rpm for 3h; then the bacterial liquids are respectively aspirated, and evenly spread on the LB solid culture medium plate containing kanamycin and rifamycin resistance, and inverted in a constant temperature incubator at 28°C for 2 days; after 2 days, a single colony of Agrobacterium is picked up and added into the liquid LB culture medium with kanamycin / rifamycin resistance, and cultured in a shaker at 28°C and 220rpm overnight.

6. The method for establishing a rapid identification system of soybean NLRs disease resistance genes according to claim 5, characterized in that: After culture, glycerol was added to the bacterial solution to obtain glycerol bacteria, which were stored in a -80°C refrigerator. When used, the glycerol bacteria needed to be picked out and streaked onto a kanamycin / rifamycin LB solid culture medium plate and cultured overnight at 28°C. The next day, a single colony was picked out and added to the corresponding resistance LB liquid culture medium and cultured overnight at 28°C in a shaker at 220 rpm.

7. The method for establishing a rapid identification system of soybean NLRs disease resistance genes according to claim 1, characterized in that: The method for planting cowpea in step three is as follows: black soil and vermiculite are mixed in a mass ratio of 6:4 and then put into a plastic cup; a cowpea seed is placed in a plastic cup filled with soil and covered with a thin layer of soil; the greenhouse growth conditions are set to 25° C., 16 h of light, and grown for 2 weeks, and the cowpea grows two opposite cotyledons for use.

8. The method for establishing a rapid identification system of soybean NLRs disease resistance genes according to claim 1, characterized in that: The treatment solution in step 4 is MMA, 50 mL. The specific formula is as follows: 0.5M MES 1 mL, 1M MgCl2 500uL, 100mMAS 50uL, add ddH2O to make up to 50 mL.

9. The method for establishing a rapid identification system of soybean NLRs disease resistance genes according to claim 1, characterized in that: In the step 4, when the mixed system of the Agrobacterium treatment solution is sucked by a syringe and pushed into the planned infiltration area on the back of the leaf, if some cowpea leaves are difficult to infiltrate, the leaves are first punched with a needle, and then the syringe is used to align the holes for injection.

10. Use of the method according to any one of claims 1 to 9 in identifying soybean NLRs disease resistance genes.

Images