Kit for specific detection of new coronavirus variant JN.1 and application

Abstract

The invention discloses a kit for specific detection of a new coronavirus variant JN.1 and application, and relates to the technical field of biomedical detection.The kit comprises a primer probe set for detecting the new coronavirus variant JN.1. The kit can specifically detect a new coronavirus JN.1 strain. Compared with the existing fluorescent quantitative PCR detection method, the method has the advantages of high accuracy and high detection speed, and has high clinical practical value.

Description

Technical Field

[0001] The present invention relates to the field of biomedical detection technology, and in particular to a novel coronavirus JN.1 rapid detection kit based on recombinase polymerase amplification (RPA) technology. Background Art

[0002] The JN.1 variant is a second-generation sub-branch of the BA.2.86 variant of the new coronavirus, with a faster transmission speed. Since it was first discovered in Luxembourg, the prevalence of JN.1 has grown rapidly worldwide. As of early December 2023, its share of the global prevalent strains has reached about 30%, showing its strong transmission ability. On December 19, 2023, the World Health Organization listed JN.1 as a new coronavirus variant that needs attention (mainly S gene mutation). As of August 2024, the number of new coronavirus infection cases has increased at an alarming rate, with the positive rate of the new coronavirus accounting for more than 60%, especially its sub-branches (XDV.1 and KP.2 variants). This change has undoubtedly aroused widespread public concern and made many people shudder. At the same time, experts in the scientific community have also issued a warning about this phenomenon, saying that the current main prevalent strain is the JN.1 variant, and the significantly increased infection rate has put great pressure on the medical system. Therefore, timely detection of the JN.1 variant is crucial to monitoring its transmission trend and assessing its impact on public health security.

[0003] In addition, the detection of JN.1 variants can also help evaluate the effectiveness of existing prevention and control measures. Although the JN.1 variant may have a certain ability to escape immunity, studies have shown that the new coronavirus vaccine containing the XBB.1.5 component is still effective against it, indicating that vaccination can provide certain protection. Therefore, by detecting the JN.1 variant, we can understand the effectiveness of prevention and control measures such as vaccination and provide a scientific basis for future prevention and control strategies.

[0004] In summary, the detection of the JN.1 variant is of great significance for timely understanding its spread, evaluating its impact on public health safety, and providing a scientific basis for prevention and control measures.

[0005] In order to accurately identify the JN.1 variant of the new coronavirus, molecular real-time diagnostic methods including RT-PCR (Reverse Transcription-Polymerase Chain Reaction) are usually used. For example, some domestic companies and scientific research institutions have developed PCR detection reagents for JN.1. Although fluorescent quantitative PCR is the preferred solution for virus detection at this stage, it has the following limitations: (1) It is easy to produce aerosol contamination, resulting in false positive results. It requires professionally trained technicians with PCR job certificates, professional PCR certification laboratories, and expensive temperature change control analysis instruments; (2) Traditional fluorescent quantitative PCR sample nucleic acid extraction and amplification detection are carried out in two steps, and it takes at least 1.5-2 hours from sampling to issuing test results. Although multiplex PCR real-time amplification technology based on a single target gene has been recently developed, its amplification detection process of up to 90 to 120 minutes and the strict requirements on experimental equipment and experimental personnel are obviously not suitable for rapid detection. Summary of the invention

[0006] The purpose of the present invention is to address the deficiencies in the prior art and provide a kit, primer pair, amplification system and application for the specific detection of the new coronavirus variant JN.1. The present invention has the characteristics of high accuracy and fast detection speed, and can specifically detect the new coronavirus JN.1.

[0007] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are particularly adopted:

[0008] The present invention provides a novel coronavirus JN.1 rapid detection kit, which comprises a primer probe set for detecting novel coronavirus JN.1.

[0009] Furthermore, the primers in the primer probe set for detecting the new coronavirus JN.1 include:

[0010] JN.1:

[0011] The nucleotide sequence of the upstream primer is shown in SEQ ID No. 1;

[0012] SEQ ID No.1: GACCTTGACCGGTGCACCACTTTTGATGATG

[0013] The nucleotide sequence of the downstream primer is shown in SEQ ID No. 2;

[0014] CCCCTCATAGATGAAGTATGTTGAGTGTAAT

[0015] Preferably, the probe used in the novel coronavirus JN.1 primer probe set is an intermediate-modified fluorescent probe;

[0016] The sequence of the probe in the novel coronavirus JN.1 primer probe set is shown in SEQ ID No. 3;

[0017] Novel coronavirus strain JN.1S gene:

[0018] SEQ ID No.3: GACCGGTGCACCACTTTTGATGATGTTCA-

[0019] AGC / i6FAMdT / C / idSp / iBHQ1dT / AATTACACTCAACAT(C3 Spacer)

[0020] Furthermore, the application method comprises the following steps:

[0021] Providing RNA of the sample to be tested, and then performing isothermal amplification using the above-mentioned primer pair, amplification kit and rapid detection kit for specific detection of the novel coronavirus variant JN.1;

[0022] Preferably, the sample to be tested includes at least one of the JN.1 liquid indoor quality control products.

[0023] Furthermore, the initial concentration of primers in the multi-enzyme isothermal amplification reaction system is 2-50 mmol / L, and the initial concentration of magnesium acetate is 50-280 mmol / L.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] 1. The novel coronavirus variant JN.1 rapid detection kit based on recombinase polymerase amplification technology (RPA) provided by the present invention can be widely used in the clinical detection of the novel coronavirus variant JN.1.

[0026] 2. The present invention integrates the primer probe set into a single amplification system to achieve the micro-quantification of the real-time rapid amplification detection system, provide technical support for the identification of the unknown new coronavirus variant JN.1, and achieve early typing, early detection, and early treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0028] Figure 1This is the sensitivity measurement curve of the real-time RT-RPA of the new coronavirus variant JN.1 in Example 3. DETAILED DESCRIPTION

[0029] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] According to one aspect of the present invention, a primer pair, an amplification kit and an application for specific detection of the novel coronavirus variant JN.1, the kit comprising a primer probe set for detecting JN.1; compared with the existing fluorescent quantitative PCR detection method, it has the advantages of high accuracy and fast detection speed.

[0031] Specifically, the beneficial effects of this application can be summarized as follows:

[0032] (1) The present invention uses the S gene as the detection target, designs RPA detection primers and probes, and then establishes a detection method based on isothermal amplification.

[0033] (2) The RPA primers and probes for detecting JN.1 of the present invention can be used to complete the detection of the new coronavirus variant JN.1 in clinical patients or outpatient screening. The kit of the present invention has the characteristics of specificity, low price, sensitivity, and portability. The kit of the present invention can effectively and specifically detect single-reaction single-copy and above new coronavirus variants JN.1.

[0034] (3) Using the RPA primers and probes of the present invention for detection, one or more different fluorescent signals can be detected in one reaction, and multiple samples can be detected simultaneously, which effectively simplifies the system design and avoids problems such as inaccuracy caused by different sample optical inspection times.

[0035] (4) Compared with the "gold standard" real-time fluorescence quantitative PCR, the detection accuracy and sensitivity of the kit of the present invention are higher, and the detection can be completed within 20 minutes.

[0036] (5) The present invention uses the S gene of the novel coronavirus variant JN.1 as the detection target to design RPA detection primers and probes for detection with high accuracy.

[0037] (6) The present invention uses multiple enzymes in an optimized ratio and freeze-drying to form dry enzyme powder and amplification tubes, eliminating the reverse transcription process, optimizing the detection time and operation steps, and making the method simpler.

[0038] (7) The RPA primers and probes of the present invention have been tested and verified by throat swab samples of real clinical patients, with a compliance rate of 100%, very high accuracy and specificity, and more convincing clinical application test results.

[0039] In a preferred embodiment of the present invention, the kit includes a primer probe set for detecting the novel coronavirus variant JN.1. The kit can be used to detect the novel coronavirus variant JN.1 with high accuracy and high speed, and the results can be obtained in about 20 minutes.

[0040] It should be noted that the modification sites of the fluorescent probe of the present application include:

[0041] FAM is a fluorescent group;

[0042] Further fluorescent groups may also be Texas Red, TAMRA, ROX, HEX and JOE.

[0043] BHQ1 is the quenching group;

[0044] THF tetrahydrofuran modification site;

[0045] Spacer C3 is a 3' end spacer modification.

[0046] According to one aspect of the present invention, the above-mentioned primer pair, amplification kit and application for specific detection of novel coronavirus variant JN.1 are used to detect novel coronavirus variant JN.1;

[0047] It should be noted that the above-mentioned primer pair, amplification kit and application for specific detection of the new coronavirus variant JN.1 in this application are for non-therapeutic purposes.

[0048] In a preferred embodiment of the present invention, the application method comprises the following steps:

[0049] Providing RNA of the sample to be tested, and then performing multi-enzyme isothermal amplification using the above-mentioned primer pair, amplification kit and application detection kit for specific detection of the new coronavirus variant JN.1;

[0050] In the above-mentioned preferred embodiment, the sample to be tested includes at least one liquid indoor quality control product of the new coronavirus variant JN.1 (RNA).

[0051] In the above preferred embodiment, the initial concentration of primers in the multi-enzyme isothermal amplification reaction system is 2-10 mmol / L, and the initial concentration of magnesium acetate is 50-280 mmol / L.

[0052] Preferably, the method for using the kit comprises the following steps:

[0053] (1) RNA template extraction: extract RNA from the sample to be tested;

[0054] (2) RPA amplification reaction: using the RNA extracted in step (1) as a template and using the RPA primers and probes in the kit, an RPA amplification reaction is performed in an RPA reaction tube;

[0055] (3) Fluorescence detection and analysis of RPA amplification products.

[0056] It should be noted that the above kit includes an amplification reaction system containing a primer probe set for detecting the novel coronavirus variant JN.1. Specifically, the reaction system of this RPA amplification reaction is calculated as follows in 50 μL:

[0057] Template RNA 1.0~10μL;

[0058] Upstream primer 1.0~5.0μL;

[0059] Downstream primer 1.0~5.0μL;

[0060] Probe primer 0.5-5 μL;

[0061] Rehydration Buffer 29.5 μL;

[0062] Magnesium acetate 0.5-2.5 μL;

[0063] RNase-free water: sterile deionized water to make up to 50 μL;

[0064] The initial concentrations of the upstream primer and the downstream primer are both 1-10 mmol / L, and the initial concentration of magnesium acetate is 50-280 mmol / L.

[0065] Furthermore, the temperature of the PRA amplification reaction is 25° C. to 42° C., and the amplification time is 1 to 60 min, preferably 39° C. for 3 to 15 min.

[0066] More preferably, the fluorescence detection analysis can utilize any instrument that can identify and collect fluorescence signals, and its luminescent genes include but are not limited to FAM channels, and also include fluorescent detection groups such as Cy3, Cy5, Texas Red, Alexa Flour, ROX, and all series of JOE.

[0067] More preferably, any device capable of controlling temperature may be used for the isothermal reaction, including but not limited to a water bath, a thermostat, a visual thermostat, etc.

[0068] The technical solution of the present invention will be further described below in conjunction with specific embodiments and data.

[0069] Note: In the present invention, unless otherwise clearly defined, the term target gene should be understood as the entire gene fragment. The gene is not limited to the fragment involved in the primer probe, but can also be other regions of the gene for which primers can be designed.

[0070] In the present invention, the fluorescent probe is not limited to FAM, but can also be other fluorescent excitation groups such as GFP, Texas Red, DAPI, AlexaFluor@488, FITC, Cy3, Cy5, Cy7, ROX, JOE and Alexa Fluor@750.

[0071] In the present invention, the test sample can be at least one of a viral nucleic acid template, a throat swab, a viral culture fluid, and sputum containing the novel coronavirus variant JN.1. For ordinary technicians in the field or relevant testing personnel, the specific meanings of the above terms in the present invention can be understood according to specific circumstances.

[0072] In the present invention, the dry powder enzyme components: Bsu DNA polymerase, single-stranded DNA binding protein SSB, recombinase Cre capable of binding to single-stranded nucleic acid (oligonucleotide primer) and reverse transcriptase are all commercially available products.

[0073] In the following examples, the reagents, instruments, etc. used can all be purchased through commercial channels.

[0074] Example 1 Primer and probe design.

[0075] Based on the S gene base sequence of the new coronavirus variant JN.1 published by NCBI, we searched and compared highly specific gene base sequences, artificially and creatively designed primers according to the primer design principles, and verified the GC content and other parameters of the designed primers to ensure that they reached the optimal range.

[0076] At the same time, the corresponding probes were designed according to the design principles of RPA probe primers. The designed multiple sets of primers were sent to Shanghai Jierui Bioengineering Co., Ltd. for synthesis. After the primers were obtained, RNase-free water was added to dilute them to 10mmol / μL for use.

[0077] Specifically, the primers and probes for the novel coronavirus JN.1S gene are as follows:

[0078]

[0079]

[0080] The above-mentioned primers and probes can be used to detect the S gene of the new coronavirus JN.1.

[0081] Example 2 RPA amplification system.

[0082] A kit for specific detection of the novel coronavirus variant JN.1 and its application, the kit comprising the primers and probes of Example 1;

[0083] The kit also includes a rehydration buffer, magnesium acetate, RNase-free water, sterile deionized water, an RNA extraction kit (QIAamp Viral RNA Kits (50)), and dry powder enzymes; the dry powder enzymes are freeze-dried powders of a certain ratio of BST DNA polymerase, single-stranded DNA binding protein SSB, and recombinase Cre that can bind to single-stranded nucleic acid (oligonucleotide primer).

[0084] It should be noted that the RNA extraction kit is used to extract RNA from the sample to be tested as a template; the RNA extraction kit can adopt a conventional commercially available RNA extraction kit. In this embodiment, the RNA extraction kit used is QIAGEN's RNA extraction kit QIAamp Viral RNA Kits.

[0085] The kit of this embodiment includes the following RPA amplification reaction system:

[0086] An RPA amplification reaction system for detecting the novel coronavirus variant JN.1, the reaction system comprising the primer probe set for detecting the novel coronavirus variant JN.1 in Example 1;

[0087] The RPA amplification system for the S gene of the novel coronavirus JN.1 strain includes, in 50 μL:

[0088] Template DNA 1.0~10μL;

[0089] Upstream primer 1.0~5.0μL;

[0090] Downstream primer 1.0~5.0μL;

[0091] Probe primer 0.5-5 μL;

[0092] Rehydration Buffer 29.5 μL;

[0093] Magnesium acetate 0.5-2.5 μL;

[0094] Dry powder enzyme;

[0095] RNase-free water: sterile deionized water to make up to 50 μL;

[0096] The method for using the kit comprises the following steps:

[0097] (1) RNA template extraction: Extract RNA from the sample to be tested, and use RNase-free deionized water as a negative control;

[0098] (2) RPA amplification reaction: Using the RNA extracted in step (1) as a template and using the RPA primers and probes in the kit, an RPA amplification reaction is performed in an RPA reaction tube.

[0099] Example 3 Sensitivity detection of RPA primers.

[0100] (1) Provide the kit of Example 2, and add each reagent according to the following reaction system, specifically including:

[0101] Add 2.1 μL of upstream primer, 2.1 μL of downstream primer, 0.6 μL of probe, 29.5 μL of rehydration buffer, and 3.2 μL of RNase-free sterile deionized water to the MIA amplification tube (containing dry powder enzyme) respectively. After the dry powder in the amplification tube is completely dissolved, add 10 μL of template, centrifuge instantly at 2,000 rpm, and add 2.5 μL of activator magnesium acetate.

[0102] (2) Immediately place the reaction tube in an instrument that has been set up in advance to collect fluorescence signals. The RPA reaction conditions are 39°C, the reaction time is 10 minutes, and the fluorescence signal is collected every 30 seconds.

[0103] The specific sensitivity of fluorescence signal detection is shown in the figure Figure 1 As shown, the novel coronavirus JN.1 amplified fluorescence signal can be detected in as fast as 4.5 minutes, and the detection sensitivity can reach 4 copies / μL within 10 minutes.

[0104] Example 4 Specific detection of RPA primers.

[0105] The novel coronavirus variant JN.1 and PBS buffer were selected as templates for RPA primer specificity verification. The RNA of the novel coronavirus variant JN.1 was directly extracted using the purchased kit, and its concentration was measured and converted into copy number. The concentration gradient was then diluted 10 times, including 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL and 1copy / / L.

[0106] A kit of Example 2 is provided, and each reagent of the sample is added according to the following reaction system, specifically including: adding 2.1 μL of upstream primer, 2.1 μL of downstream primer, 0.6 μL of probe primer, 29.5 μL of rehydration buffer (Rehydration Buffer), and 3.2 μL of RNase-free sterile deionized water to the RPA amplification tube, adding 10 μL of template after the dry powder in the amplification tube is completely dissolved, centrifuging instantly at 2,000 rpm, and adding 2.5 μL of activator magnesium acetate.

[0107] Immediately place the reaction tube in an instrument that has been set up in advance to collect fluorescence signals. The RPA reaction conditions are 39°C, the reaction time is 20 minutes, and the fluorescence signal is collected every 30 seconds.

[0108] The results of specific specificity tests are shown in Table 1. Common bacteria and viruses isolated from oral sputum and respiratory tract, including H1N1, H3N2, rhinovirus, respiratory syncytial virus, Mycoplasma pneumoniae, and the original strain (α strain) of the new coronavirus, the delta variant of the new coronavirus, etc. (see Appendix 1 for details) were selected for routine culture, and finally the concentration was measured, the nucleic acid was extracted and converted into copy number, so that the concentration reached 10 5 The DNA templates were extracted using the genome extraction kit produced by Qiagen. After the nucleic acid templates were extracted, the concentration of the nucleic acid templates was uniformly adjusted to 10 5 copies / μL, and nonspecific amplification detection was performed using the kit and RPA amplification method described in Example 2. As shown in Table 1, the new coronavirus primer amplification test only detected the new coronavirus JN.1 variant, and the others were negative, and no nonspecific amplification occurred.

[0109] Table 1:

[0110] Nucleic acid type judge Novel coronavirus JN.1 variant + Original strain of novel coronavirus - Novel Coronavirus Delta Strain - Influenza H1N1 virus - Influenza H3N2 virus - Rhinovirus - Respiratory syncytial virus - Mycoplasma pneumoniae -

[0111] In Table 1, "+" represents the occurrence of amplification, and "-" represents the absence of amplification.

[0112] Example 5 Comparative verification of the RPA method and the fluorescent quantitative PCR method.

[0113] Select the new coronavirus JN.1(10 4 copies / μL) were used as templates for RPA amplification and fluorescence quantitative PCR method for correlation verification.

[0114] The RPA reaction was performed according to the following reaction system for adding various reagents, wherein the primers and probes for gene detection were not mixed and added, but amplified separately, specifically including: adding 2.1 μL of upstream primer, 2.1 μL of downstream primer, 0.6 μL of probe primer, 29.5 μL of rehydration buffer, and 3.2 μL of RNase-free sterile deionized water to the MIA amplification tube, and adding 10 μL of template after the dry powder in the amplification tube was completely dissolved, centrifuged instantly at 2,000 rpm, and adding 2.5 μL of activator magnesium acetate.

[0115] Immediately place the RPA reaction tube in an instrument that has been set up in advance to collect fluorescence signals. The MIA reaction conditions are 39°C, the reaction time is 20 minutes, and the fluorescence signal is collected every 30 seconds.

[0116] Fluorescence quantitative PCR reaction, according to the detection primers and probes recommended by WHO, and using commercial quantitative detection kit for amplification, the reaction system is:

[0117] S gene:

[0118]

[0119]

[0120] The reaction conditions were: PCR enzyme activation (pre-denaturation) for 15 min at 95°C;

[0121] Cyclic Amplification:

[0122]

[0123] Table 2 shows the RPA method of this embodiment for detecting various variant strains of the new coronavirus that have been clinically confirmed by PCR. It can be seen from Table 2 that this method can detect the presence of the new coronavirus JN.1 within 5 minutes and complete the viral gene detection within 10 minutes; the analysis of the accuracy fitting results with the quantitative PCR amplification results showed that there was no significant difference between the RPA method detection results of this embodiment and the fluorescent quantitative PCR detection results, and the fitting rate was 100%. At present, the gold standard for nucleic acid detection is still fluorescent quantitative PCR, indicating that the detection efficiency of the method we established is the same as the detection accuracy of fluorescent quantitative PCR, but the detection time is greatly shortened, and it only targets the JN.1 variant.

[0124] Table 2 Clinical sample testing

[0125]

[0126]

[0127]

[0128] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A kit for specific detection of the novel coronavirus variant JN.1, It is characterized in that The kit includes a primer probe set for detecting the novel coronavirus JN.1; The primer probe set for detecting the novel coronavirus JN.1 includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID No.1; SEQ ID No.1: GACCTTGACCGGTGCACCACTTTTGATGATG The nucleotide sequence of the downstream primer is shown in SEQ ID No.2; SEQ ID No.2:CCCCTCATAGATGAAGTATGTTGAGTGTAAT 2. A kit for specific detection of the novel coronavirus variant JN.1 according to claim 1, It is characterized in that The probe in the primer probe set for specific detection of the novel coronavirus variant JN.1 is a modified fluorescent probe; The sequence of the probe in the probe set for detecting JN.1 is shown in SEQ ID No.3; S gene: SEQ ID No.3: GACCGGTGCACCACTTTTGATGATGTTCA- AGC / i6FAMdT / C / idSp / iBHQ1dT / AATTACACTCAACAT(C3 Spacer) 3. A kit according to claim 1 or 2 and its use in detecting the specificity of the new coronavirus variant JN.

1.

4. The use according to claim 3, It is characterized in that The detection method comprises the following steps: The nucleic acid of the sample to be tested is provided, and then isothermal amplification is performed using the kit described in claim 1 or 2.

5. The use according to claim 3, It is characterized in that The sample to be tested includes at least one of a nasal swab, a throat swab, and sputum.

6. The use according to claim 3, It is characterized in that In the isothermal amplification reaction system, the initial concentration of the amplification primers is 2-40 mmol / L, and the initial concentration of magnesium acetate is 50-280 mmol / L.

Images