Bacteria with lipid metabolism disease improving capacity and application thereof

Abstract

The invention belongs to the field of microorganisms and the technical field of medicines, and particularly relates to a bacterium capable of improving lipid metabolism diseases and application of the bacterium. The bacterium capable of improving the lipid metabolism disease is lactobacillus gasseri SPUB4211, has been preserved in the China General Microbiological Culture Collection Center on October 30, 2023, and has the preservation number of CGMCC NO.28809. The lactobacillus gasseri SPUB4211 has been preserved in the China General Microbiological Culture Collection Center; or the lactobacillus gasseri SPUB4209 is preserved in the China General Microbiological Culture Collection Center on October 30, 2023, and the preservation number is CGMCC (China General Microbiological Culture Collection Center) NO.28808. The lactobacillus gasseri SPUB4209 has been preserved in the China General Microbiological Culture Collection Center). The lactobacillus gasseri SPUB4211 and the lactobacillus gasseri SPUB4209 provided by the invention have relatively strong lipid metabolism improving capability, and are verified by respectively detecting biochemical indexes of serum and biochemical indexes in liver of mice in a high fat diet induced hyperlipidemia model and a non-alcoholic fatty liver disease model and by liver tissue slices, and the lactobacillus gasseri SPUB4211 and the lactobacillus gasseri SPUB4209 have good artificial gastric juice, good anti-inflammatory and anti-inflammatory effects and good anti-inflammatory and anti-inflammatory effects. And artificial intestinal juice tolerance.

Description

Technical Field

[0001] The present invention belongs to the field of microorganisms and medical technology, and specifically relates to bacteria capable of improving lipid metabolism diseases and applications thereof. Background Art

[0002] Hyperlipidemia is a very common lipid metabolism disease worldwide, which is mainly characterized by high levels of lipid circulation in the blood. It usually does not cause serious symptoms, but has the potential to develop into serious diseases such as cardiovascular disease and non-alcoholic fatty liver disease (NAFLD). Patients with hyperlipidemia are twice as likely to develop atherosclerotic cardiovascular disease (ASCVD) as those with controlled serum total cholesterol (TC) levels. Without proper treatment, it may eventually lead to death.

[0003] Hyperlipidemia can be divided into two categories: primary and secondary. Secondary hyperlipidemia often occurs in lipid metabolism disorders (diabetes, hypertension, myxedema, hypothyroidism, obesity, liver and kidney diseases, adrenal hyperfunction). Dyslipidemia can lead to microcirculatory disorders. Dyslipidemia caused by fat metabolism disorders and the activation of "positive lipid metabolism" refers to a symptom of poor blood quality and blood circulation disorders in the human blood circulation system. That is, the four dyslipidemias in plasma, such as high total triglycerides (TG), high total cholesterol (T-CHO), high low-density lipoprotein cholesterol (LDL-C), and low high-density lipoprotein cholesterol (HDL-C), appear, namely hyperlipidemia.

[0004] However, over the past two decades, an increasing number of studies have acknowledged the intrinsic relationship between the gut microbiome and human health, not only revealing microbial insights into the etiology of lipid metabolic diseases, but also opening new avenues for the development of gut microbiome-based therapeutic strategies. Candidate bacteria that contribute to lipid metabolic homeostasis are lacking, especially those with proven physiological functions and elucidated mechanisms. Therefore, addressing these knowledge gaps will help develop novel live biopharmaceuticals for the treatment of hyperlipidemia.

[0005] In clinical practice, the drugs used to treat hyperlipidemia are mainly statins and resins that lower serum total cholesterol and low-density lipoprotein cholesterol, and fibrates and niacin drugs that are mainly used to lower serum triglycerides. Therefore, it is meaningful to study a new drug to relieve hyperlipidemia.

[0006] Non-alcoholic fatty liver disease (NAFLD) is a very common chronic liver disease described as fat accumulation and inflammation in liver cells caused by anything other than alcohol. Over time, inflammation in the liver may progress to a more serious liver disorder called non-alcoholic steatohepatitis (NASH), with fat further accumulating in the liver and forming liver fibrosis. When fibrotic tissue replaces liver cells, it will lead to cirrhosis, in which the liver stops functioning normally, resulting in death.

[0007] The exact cause of NAFLD is still unclear, but the risk is higher in patients with obesity and metabolic syndrome. Metabolic syndrome refers to a clinical syndrome in which multiple metabolic abnormalities coexist, including increased abdominal fat, insulin resistance, impaired glucose tolerance (type 2 diabetes), dyslipidemia (such as abnormally elevated levels of low-density lipoprotein cholesterol and triglycerides), hypertension, and hyperlipidemia. Therefore, controlling weight, blood sugar, and blood lipids is important for reducing the risk of non-alcoholic fatty liver disease.

[0008] In clinical practice, there is no specific drug for the treatment of NAFLD. Increasing physical activity, improving diet, controlling blood sugar, blood pressure and blood lipids with drugs, and taking weight loss-related surgeries (such as sleeve gastrectomy) can slow down or even reverse the progression of NAFLD. However, it is difficult for modern people to avoid factors that induce NAFLD, such as high-sugar and high-fat diets and lack of exercise, and weight loss surgery often brings risks. Therefore, it is meaningful to study a new drug to alleviate NAFLD.

[0009] Probiotics are widely distributed in nature. They are microorganisms that can improve intestinal flora, produce active compounds, and have beneficial effects on the host. Currently, the most widely used probiotics are Lactobacillus and Bifidobacterium. Probiotics are physiological bacteria that can produce a variety of physiological effects in the human intestine, but their specific medicinal mechanisms are not yet clear. Therefore, it is of great significance to use probiotics as living biological drugs in drug research and development.

[0010] It is reported that a variety of probiotics have been used in the treatment of hyperlipidemia. For example, Yuyu et al. (2017) found that the changes in intestinal microbial flora caused by Lactobacillus plantarum HNU082 were related to the occurrence and development of hyperlipidemia. Bifidobacterium, Lactobacillus, and Akkermansia increased significantly in the intestine, and pyruvate metabolism, glycerophospholipid metabolism, propionate metabolism, and fatty acid biosynthesis were enriched. [1] Zhang et al. (2020) found that vaginal Lactobacillus FN3 and animal Bifidobacterium lactis subspecies F1-7 could reduce TG and TC in the liver, increase total bile acid in feces, and regulate bile acid metabolism by downregulating farnesoid X receptor [2]Wu et al. (2023) found that 12-methylmyristic acid is the active metabolite of Blautia producta for the treatment of hyperlipidemia [3] .

[0011] It is reported that a variety of probiotics have been used in the treatment of NAFLD. For example, Stephan C. Bischoff et al. (2014) found that Lactobacillus rhamnosus GG can reduce liver fat and inflammation, increase beneficial bacteria in the intestine, restore tight junction proteins, and improve intestinal barrier function. [4] Xue et al. (2017) found that Bifidobacterium infantis, Lactobacillus acidopilus, and Bacillus cereus can downregulate the LPS / TLR4 signaling pathway, improve intestinal flora imbalance and intestinal barrier function, reduce body weight, and reduce the expression of TNFα and IL-18 and the levels of ALT, AST, GGT, and ALP. [5] Hae-Jeung Lee et al. (2020) found that Lactobacillus plantarum ATG-K2 and ATG-K6 can regulate intestinal flora, downregulate genes related to neonatal lipogenesis, reduce body weight and liver lipid accumulation, increase the content of antioxidant enzymes (SOD, GPx, CAT) in serum, and reduce ALT and AST levels. [6] Zhao et al. (2020) found that Bifidobacterium lactis V9 can reduce ALT, AST, TLR4, and TLR9 levels, reduce liver steatosis and liver damage, reduce serum glucose levels and the accumulation of liver triglycerides and free fatty acids, restore liver phosphorylation-AMPK and PPAR-α levels, reduce SREBP-1c and FAS expression, and reduce liver inflammation by inhibiting the synthesis of inflammatory cytokines (IL-6, IL-1β, TNFα). [7] Zheng et al. (2015) found that Lactobacillus rhamnosus GG and Lactobacillus plantarum WCFS1 can reduce the level of intestinal endotoxemia and the expression of inflammatory cytokines and improve intestinal barrier function. [8] .

[0012] Although many probiotics have been used in the research on the treatment of hyperlipidemia and NAFLD, the discussion on the mechanism is still not in-depth enough, making it difficult to conduct further drug research.

[0013] Therefore, in-depth research on Lactobacillus gasseri is of great significance for developing new drugs to treat hyperlipidemia and improve NAFLD and broaden the treatment methods for hyperlipidemia and NAFLD.

[0014] References

[0015] [1]Shao Y, Huo D, Peng Q, et al.Lactobacillus plantarum HNU082-derivedimprovements in the intestinal microbiome prevent the development ofhyperlipidaemia[J].Food&Function,2017,8(12):4508-4516.

[0016] [2]Liang X, Zhang Z, Zhou

[0017] [3]Xu W, Yu J, Yang Y, et al. Strain-level screening of human gutmicrobes identifies Blautia producta as a new anti-hyperlipidemic probiotic[J]. Gut Microbes, 2023,15(1):2228045.

[0018] [4]Ritze Y, Bárdos G, Claus A, et al. Lactobacillus rhamnosus GG protects against non-alcoholic fatty liver disease in mice[J]. PLoS One, 2014, 9(1):e80169.

[0019] [5]Xue L, He J, Gao N, et al. Probiotics may delay the progression ofnonalcoholic fatty liver disease by restoring the gut microbiota structure and improving intestinal endotoxemia[J]. Scientific Reports, 2017, 7(1):45176.

[0020] [6]Park EJ,Lee YS,Kim SM,et al.Beneficial effects of Lactobacillusplantarum strains on non-alcoholic fatty liver disease in high fat / highfructose diet-fed rats[J / OL]2020,12(2):10.3390 / nu12020542

[0021] [7] Yan Y, Liu C, Zhao S, et al. Probiotic Bifidobacterium lactis V9attenuates hepatic steatosis and inflammation in rats with non-alcoholicfatty liver disease [J]. AMB Express, 2020, 10(1):101.

[0022] [8]Mei L,Tang Y,Li M,et al.Co-administration of cholesterol-loweringprobiotics and anthraquinone from Cassia obtusifolia L.ameliorate non-alcoholic fatty liver[J].PLoS One,2015,10(9):e0138078. Summary of the invention

[0023] The present invention aims to provide bacteria capable of improving lipid metabolism diseases and applications thereof.

[0024] To achieve the above object, the technical solution adopted by the present invention is:

[0025] A bacterium capable of improving lipid metabolism diseases, wherein the bacterium capable of improving hyperlipidemia is Lactobacillus gasseri SPU_B4211, which was deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on October 30, 2023, with the deposit number: CGMCC NO.28809;

[0026] The Lactobacillus gasseri SPU_B4211 is a lactobacillus strain isolated from commercially available Northeastern pickled cabbage, and the steps are as follows:

[0027] (1) Isolating and screening a Lactobacillus strain from commercially available Northeastern pickled cabbage, separating and purifying it, and naming it strain SPU_B4211;

[0028] (2) identifying the strain SPU_B4211 obtained in step (1) as Lactobacillus gasseri through Gram staining, strain morphology, 16S rRNA sequence analysis, and genome analysis;

[0029] Or, Lactobacillus gasseri SPU_B4209, was deposited in the General Microbiology Center of China Culture Collection Administration on October 30, 2023, with the deposit number: CGMCC NO.28808.

[0030] The Lactobacillus gasseri SPU_B4209 is isolated from commercially available Guizhou pickles in the following steps:

[0031] (1) Isolating and screening a Lactobacillus strain from commercially available Guizhou pickles, separating and purifying it, and naming it strain SPU_B4209;

[0032] (2) The strain SPU_B4209 obtained in step (1) was identified as Lactobacillus gasseri by Gram staining, strain morphology, 16S rRNA sequence analysis, and genome analysis;

[0033] An application of the bacteria capable of improving lipid metabolism diseases, and an application of the bacteria in improving lipid metabolism diseases.

[0034] Application of Lactobacillus gasseri SPU_B4211 in improving hyperlipidemia;

[0035] Application of Lactobacillus gasseri SPU_B4209 in improving non-alcoholic fatty liver disease.

[0036] Application of Lactobacillus gasseri SPU_B4211 in the preparation of medicines or foods for improving hyperlipidemia;

[0037] Application of Lactobacillus gasseri SPU_B4209 in the preparation of medicines or foods for improving non-alcoholic fatty liver disease.

[0038] A product capable of improving lipid metabolism diseases, comprising the bacteria.

[0039] The product is a fermentation liquid, a bacterial suspension, or a freeze-dried powder of the bacteria; wherein the bacteria is Lactobacillus gasseri SPU_B4211 or Lactobacillus gasseri SPU_B4209.

[0040] The Lactobacillus gasseri fermentation broth is prepared by inoculating the Lactobacillus gasseri strain SPU_B4211 into an MRS culture medium plate, inverting and anaerobic culturing at 37°C for 48 hours to activate the strain, placing the activated strain in an MRS liquid culture medium, culturing to a logarithmic growth phase, and counting by a dilution plate method. The concentration of the fermentation broth is 1.0×10 11 CFU / mL;

[0041] The bacterial suspension of Lactobacillus gasseri strain SPU_B4211 is prepared by centrifuging the fermentation liquid of Lactobacillus gasseri strain SPU_B4211 obtained above at 4000 rpm to collect bacterial mud, and diluting it with 0.9% physiological saline to obtain a bacterial suspension; wherein the bacterial suspension is resuspended to 1.0×10 11 CFU / mL. The oral concentration of the bacterial suspension is 2.0×10 11 ~4.0×10 11 CFU / kg(BW), the oral concentration of the inactivated bacterial suspension is 2.0×10 11 ~4.0×10 11 CFU / kg(BW).

[0042] The MRS medium is composed of: 7 g beef extract powder, 5 g yeast extract powder, 5 g sodium acetate, 10 g peptone, 3 g triammonium citrate, 20 g glucose, 2 g dipotassium hydrogen phosphate, 0.5 g magnesium sulfate heptahydrate, 0.25 g manganese sulfate tetrahydrate, 1 mL Tween 80, 0.125 g cysteine, distilled water to 1 L, pH 6.8, and sterilized at 115°C for 15 min.

[0043] The strain SPU_B4211 was subjected to animal experiments, and oral administration of the strain SPU_B4211 suspension to intervene in the hyperlipidemia model C57BL / 6 mice induced by a high-fat diet for 12 weeks had the effects of reducing body weight, reducing TG, T-CHO, LDL, ALT, AST, MDA, and blood sugar levels, and restoring insulin resistance.

[0044] The Lactobacillus gasseri fermentation broth is prepared by inoculating the Lactobacillus gasseri strain into an MRS culture medium plate, inverting and anaerobic culturing at 37°C for 48 hours to activate the strain, placing the activated strain into an MRS liquid culture medium, culturing to the logarithmic growth phase, and counting by a dilution plate method. The concentration of the fermentation broth is 1.0×10 10 CFU / mL;

[0045] The Lactobacillus gasseri SPU_B4209 bacterial suspension is prepared by centrifuging the fermentation liquid of the Lactobacillus gasseri strain SPU_B4209 obtained above at 4000 rpm to collect bacterial sludge, diluting it with 0.9% physiological saline to obtain a bacterial suspension, and resuspending it in water to 1.0×10 10 CFU / mL. The oral concentration of the bacterial suspension is 2.0×10 10 ~4.0×10 10 CFU / kg(BW), the oral concentration of the inactivated bacterial suspension is 2.0×10 11 ~4.0×10 11 CFU / kg(BW).

[0046] The MRS medium is composed of: 7 g beef extract powder, 5 g yeast extract powder, 5 g sodium acetate, 10 g peptone, 3 g triammonium citrate, 20 g glucose, 2 g dipotassium hydrogen phosphate, 0.5 g magnesium sulfate heptahydrate, 0.25 g manganese sulfate tetrahydrate, 1 mL Tween 80, 0.125 g cysteine, distilled water to 1 L, pH 6.8, and sterilized at 115°C for 15 min.

[0047] The strain SPU_B4209 was subjected to animal experiments, and oral administration of the strain SPU_B4209 bacterial suspension to intervene in the NAFLD model C57BL / 6 mice induced by a high-fat diet for 12 weeks had the effects of reducing body weight, reducing TG, T-CHO, LDL, ALT, AST, MDA, and blood sugar levels, and restoring insulin resistance.

[0048] The product has the ability to improve hyperlipidemia or improve non-alcoholic fatty liver disease.

[0049] The present invention provides the Lactobacillus gasseri SPU_B4211 capable of improving hyperlipidemia and the Lactobacillus gasseri SPU_B4209 capable of alleviating NAFLD, which have good tolerance to artificial gastric juice and intestinal juice and can be used in the preparation of fermented dairy products, health foods and medicines.

[0050] The present invention provides the above-mentioned Lactobacillus gasseri SPU_B4211 for improving hyperlipidemia and Lactobacillus gasseri SPU_B4209 for alleviating NAFLD, which have strong abilities, and are verified by detecting the biochemical indices in the serum and liver of C57BL / 6 mice with hyperlipidemia induced by a high-fat diet, and the biochemical indices in the serum and liver of C57BL / 6 mice with NAFLD induced by a high-fat diet, and the biochemical indices in the serum and liver of C57BL / 6 mice with NAFLD induced by a high-fat diet, respectively; and have good tolerance to artificial gastric juice and artificial intestinal juice, can be widely used in food and health products, and continue to be studied as drugs, and have the development and application prospects of becoming drugs for improving hyperlipidemia and alleviating NAFLD. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 is the growth curve of Lactobacillus gasseri SPU_B4211 of the present invention;

[0052] Figure 2 is the gastric juice tolerance result of Lactobacillus gasseri SPU_B4211 of the present invention;

[0053] Figure 3 This is the intestinal fluid tolerance result of Lactobacillus gasseri SPU_B4211 of the present invention;

[0054] Figure 4 This is a comparison chart of body weight of C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4211 at week 12;

[0055] Figure 5 This is a comparison of serum triglyceride levels in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4211 at week 12;

[0056] Figure 6 This is a comparison of serum total cholesterol levels in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4211 at week 12;

[0057] Figure 7 This is a comparison chart of serum high-density lipoprotein levels in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4211 at week 12;

[0058] Figure 8 This is a comparison of serum low-density lipoprotein levels in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4211 at week 12;

[0059] Fig. 9 This is a comparison chart of serum aspartate aminotransferase in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4211 at week 12;

[0060] Fig.10 This is a comparison chart of serum alanine aminotransferase in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4211 at week 12;

[0061] Fig.11 This is a comparison of malondialdehyde in the liver of C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4211 at week 12;

[0062] Fig.12 This is a comparison chart of fasting blood glucose in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4211 at week 12;

[0063] Fig.13 This is a comparison chart of glucose tolerance in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4211 at week 12;

[0064] Fig.14 This is a comparison chart of insulin resistance in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4211 at week 12;

[0065] Fig.15 This is the appearance and pathological sections of liver tissue in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4211 at week 12.

[0066] Fig.16 is the growth curve of Lactobacillus gasseri SPU_B4209 of the present invention;

[0067] Fig.17 is the gastric juice tolerance result of Lactobacillus gasseri SPU_B4209 of the present invention;

[0068] Fig.18 is the intestinal fluid tolerance result of Lactobacillus gasseri SPU_B4209 of the present invention;

[0069] Fig.19 This is a comparison chart of body weight of C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4209 at week 12;

[0070] Fig. 20 This is a comparison chart of serum triglyceride levels in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4209 at week 12;

[0071] Fig.21 This is a comparison of serum total cholesterol levels in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4209 at week 12;

[0072] Fig. 22This is a comparison of serum high-density lipoprotein levels in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4209 at week 12;

[0073] Fig.23 This is a comparison of serum low-density lipoprotein levels in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4209 at week 12;

[0074] Fig.24 This is a comparison chart of serum aspartate aminotransferase in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4209 at week 12;

[0075] Fig.25 This is a comparison chart of serum alanine aminotransferase in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4209 at week 12;

[0076] Fig.26 This is a comparison of liver malondialdehyde in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4209 at week 12;

[0077] Fig. 27 This is a comparison chart of fasting blood glucose in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4209 at week 12;

[0078] Fig.28 This is a comparison chart of glucose tolerance in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4209 at week 12;

[0079] Fig.29 This is a comparison chart of insulin resistance in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4209 at week 12;

[0080] Fig.30 This is the appearance and pathological sections of liver tissue in C57BL / 6 mice treated with Lactobacillus gasseri SPU_B4209 at week 12. DETAILED DESCRIPTION

[0081] The present invention is further described in detail below in conjunction with specific embodiments and with reference to the accompanying drawings.

[0082] Example 1 Acquisition of Lactobacillus gasseri CGMCC NO.28809:

[0083] 1. Sample Source

[0084] It comes from commercially purchased Northeastern sauerkraut.

[0085] 2. Isolation of Lactobacillus from Commercially Purchased Northeastern Pickled Cabbage

[0086] Take 5 mL of the supernatant of commercially available Northeastern pickled cabbage and put it into a conical flask containing 45 mL of sterile water. Oscillate for 20 min. This is 10 -1 of sauerkraut suspension; dilute to 10 -2 , 10 -3 , 10 -4 , 10 -5 Afterwards, each dilution was spread on a separate plate, inverted, and cultured anaerobically at 37°C for 48 hours. After culture observation, a single colony was grown and transferred to MRS medium for culture to obtain a single strain SPU_B4211.

[0087] 3. 16S rRNA sequence analysis

[0088] The solid plate with a single bacterial colony was sent to Bioengineering (Shanghai) Co., Ltd. for sequencing. The full length of the whole genome sequence was 2033016bp, of which the full length of the 16S rRNA sequence was 1569bp (see SEQ1). The obtained sequence was submitted to the GenBank database for BLAST analysis and comparison, and it was found that the strain with a high homology to CGMCC NO.28809 belonged to Lactobacillus gasseri, and the strain was preliminarily identified as the Lactobacillus gasseri group.

[0089] The above-mentioned Lactobacillus gasseri SPU_B4211 (Latin name Lactobacillus gasseri) was deposited on October 30, 2023 at the General Microbiology Center of China Culture Collection Administration, located at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with the deposit number CGMCC NO.28809.

[0090] The 16S rRNA sequence is:

[0091] ATGAGAGTTTGATCCTGGCTCAGGACGAACGCTGGCGGCGTGCCTAATACATG

[0092] CAAGTCGAGCGAGCTTGCCTAGATGAA

[0093] TTTGGTGCTTGCACCAAATGAAACTAGATACAAGCGAGCGGCGGACGGGTGA

[0094] GTAACACGTGGGTAACCTGCCCAAGAGA

[0095] CTGGGATAACACCTGGAAACAGATGCTAATACCGGATAACAACACTAGACGCA

[0096] TGTCTAGAGTTTAAAAGATGGTTCTGC

[0097] TATCACTCTTGGATGGACCTGCGGTGCATTAGCTAGTTGGTAAGGTAACGGCTT

[0098] ACCAAGGCAATGATGCATAGCCGAGT

[0099] TGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGG

[0100] GAGGCAGCAGTAGGGAATCTTCCACAAT

[0101] GGACGCAAGTCTGATGGAGCAACGCCGCGTGAGTGAAGAAGGGTTTCGGCT

[0102] CGTAAAGCTCTGTTGGTAGTGAAGAAAGA

[0103] TAGAGGTAGTAACTGGCCTTTATTTGACGGTAATTACTTAGAAAGTCACGGCT

[0104] AACTACGTGCCAGCAGCCGCGGTAATA

[0105] CGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCG

[0106] GTTCAATAAGTCTGATGTGAAAGCCTTC

[0107] GGCTCAACCGGAGAATTGCATCAGAAACTGTTGAACTTGAGTGCAGAAGAGG

[0108] AGAGTGGAACTCCATGTGTAGCGGTGGA

[0109] ATGCGTAGATATATGGAAGAACACCAGTGGCGAAGGCGGCTCTCTGGTCTGCA

[0110] ACTGACGCTGAGGCTCGAAAGCATGGG

[0111] TAGCGAACAGGATTAGATACCCTGGTAGTCCATGCCGTAAACGATGAGTGCTA

[0112] AGTGTTGGGAGGTTTCCGCCTCTCAGT

[0113] GCTGCAGCTAACGCATTAAGCACTCCGCCTGGGGAGTACGACCGCAAGGTTG

[0114] AAACTCAAAGGAATTGACGGGGGCCCGC

[0115] ACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAACCTTACCA

[0116] GGTCTTGACATCCAGTGCAAACCTAAGA

[0117] GATTAGGAGTTCCCTTCGGGGACGCTGAGACAGGTGGTGCATGGCTGTCGTC

[0118] AGCTCGTGTCGTGAGATGTTGGGTTAAG

[0119] TCCCGCAACGAGCGCAACCCTTGTCATTAGTTGCCATCATTAAGTTGGGCACT

[0120] CTAATGAGACTGCCGGTGACAAACCGG

[0121] AGGAAGGTGGGGATGACGTCAAGTCATCATGCCCCTTATGACCTGGGCTACAC

[0122] ACGTGCTACAATGGACGGTACAACGAG

[0123] AAGCGAACCTGCGAAGGCAAGCGGATCTCTGAAAGCCGTTCTCAGTTCGGAC

[0124] TGTAGGCTGCAACTCGCCTACACGAAGC

[0125] TGGAATCGCTAGTAATCGCGGATCAGCACGCCGCGGTGAATACGTTCCCGGGC

[0126] CTTGTACACACCGCCCGTCACACCATG

[0127] AGAGTCTGTAACACCCAAAGCCGGTGGGATAACCTTTATAGGAGTCAGCCGTC

[0128] TAAGGTAGGACAGATGATTAGGGTGAA

[0129] GTCGTAACAAGGTAGCCGTAGGAGAACCTGCGGCTGGATCACCTCCTTT Example 2 Strain screening culture medium and strain suspension preparation method

[0130] 1. Related culture medium formula

[0131] MRS medium is the basic medium for culturing lactobacilli.

[0132] MRS liquid culture medium: beef extract powder 7g, yeast extract powder 5g, sodium acetate 5g, peptone 10g, triammonium citrate 3g, glucose 20g, dipotassium phosphate 2g, magnesium sulfate heptahydrate 0.5g, manganese sulfate tetrahydrate 0.25g, Tween 80 1mL, cysteine ​​0.125g, distilled water to 1L, pH 6.8, sterilize at 115℃ for 15min.

[0133] MRS solid culture medium: beef extract powder 7g, yeast extract powder 5g, sodium acetate 5g, peptone 10g, triammonium citrate 3g, glucose 20g, dipotassium phosphate 2g, magnesium sulfate heptahydrate 0.5g, manganese sulfate tetrahydrate 0.25g, Tween 80 1mL, cysteine ​​0.125g, agar 15g, distilled water to 1L, pH 6.8, sterilize at 115℃ for 15min.

[0134] 2. Preparation method of bacterial suspension

[0135] Lactobacillus gasseri SPU_B4211 was inoculated into a MRS medium plate and incubated anaerobically at 37°C for 48 hours to activate the strain. The activated strain was placed in MRS liquid medium and cultured to the logarithmic growth phase. The growth curve of strain SPU_B4211 is shown in FIG. Figure 1 As shown: the strain reached the logarithmic growth phase in 6 hours. The dilution plate method was used for counting, and the concentration of the fermentation broth was 1.0×10 11 CFU / mL; the fermentation broth was centrifuged at 4000 rpm for 10 min, the supernatant was discarded, the bacteria were collected, and resuspended in 0.9% saline to 1.0×10 10 CFU / mL. The oral concentration of the bacterial suspension is 2.0×10 10 ~4.0×10 10CFU / kg(BW).

[0136] 3. Preparation method of inactivated bacterial suspension

[0137] The bacterial suspension was inactivated in a water bath at 70°C for 1 hour and then used for later use. The oral concentration of the inactivated bacterial suspension was 2.0×10 11 ~4.0×10 11 CFU / kg(BW).

[0138] 4. Gastrointestinal fluid tolerance test

[0139] (1) Preparation of simulated artificial gastric fluid: prepare 2 g / L NaCl solution, adjust the pH to 2, 3, and 4, and sterilize by high pressure at 121°C for 15 min; take pepsin (3 g / L), add it to the NaCl solution to dissolve, filter it through a 0.22 μm filter membrane to sterilize, and store it at 4°C for later use.

[0140] (2) Prepare artificial intestinal fluid: Weigh 6.8 g of potassium dihydrogen phosphate, add 500 mL of water to dissolve, adjust the pH to 6.8 with 0.1 mol / L NaOH solution, and sterilize at 121°C for 15 min. Take 10 g of pancreatic enzyme (≥250 NFU / mg), add appropriate amount of sterile water to dissolve, mix the two solutions, and adjust the volume to 1000 mL to obtain artificial intestinal fluid. Take appropriate amount of solution, add appropriate amount of ox bile salt, so that the bile salt concentration is 0.03%, 0.1%, 0.2%, and 0.3%, respectively, filter through 0.22 μm filter membrane for sterilization, and store at 4°C for use.

[0141] (3) Artificial gastric fluid tolerance test: Take a single colony of SPU_B4211 and inoculate it in 20mL MRS liquid medium, and incubate it at 37℃ for 12h. Inoculate it in MRS liquid medium with 2% inoculum (v / v), and incubate it at 37℃ for 6h. Take four portions of bacterial solution, 30mL each, centrifuge at 8000rpm, 4℃ for 5min, and remove the supernatant for use. Take one portion, resuspend the bacteria with 30mL physiological saline, take 100μl for dilution and spread on the plate, as the bacterial concentration of the bacterial solution at 0min, take the remaining 3 centrifuge tubes with bacteria, add 30mL of artificial gastric fluid, pH 2, 3, 4 respectively, mix well, and take 100μL of artificial gastric fluid containing SPU_B4211 strain from each gradient at 2, 6, 10, 14, 24h for dilution and spread, and incubate it at 37℃ for 48h. Count the single colonies and draw a curve with time as the horizontal axis and CFU as the vertical axis. Figure 2 As shown: It can be seen that SPU_B4211 has poor tolerance at pH 2, good tolerance at pH 3-4, and the tolerance decreases as the pH becomes lower.

[0142] (4) Artificial intestinal fluid tolerance experiment: Take a single colony of SPU_B4211 and inoculate it in 20mL MRS liquid medium, and incubate it at 37℃ for 6h. Inoculate it in MRS liquid medium with 2% inoculum (v / v), and incubate it at 37℃ for 10h. Take five portions of bacterial solution, each 30mL, centrifuge at 8000rpm, 4℃ for 5min, and remove the supernatant. Take one portion, resuspend the bacteria with 30mL physiological saline, take 100μL to dilute and spread on the plate, and use it as the bacterial concentration of the bacterial solution at 0min. Take the remaining 4 centrifuge tubes with bacteria, add 30mL of artificial intestinal fluid, with bile salt concentrations of 0.03%, 0.1%, 0.2%, and 0.3%, respectively, mix well, and take 100μL from each gradient of artificial intestinal fluid containing SPU_B4211 strain at 2, 6, 10, 14, and 24h for dilution and spreading, and incubate it at 37℃ for 48h. Count the single colonies and draw a curve with time as the horizontal axis and CFU as the vertical axis. Figure 3 As shown: It can be seen that SPU_B4211 has poor tolerance under the condition of 0.3% bile salt concentration, and has good tolerance under the condition of 0.03%-0.2% bile salt concentration, and the tolerance decreases with the increase of bile salt concentration.

[0143] Example 3 The improvement effect of strain SPU_B4211 at different feeding doses on the NAFLD model C57BL / 6 mice induced by a high-fat diet.

[0144] 1. Establishment of hyperlipidemia model induced by high-fat diet: The NAFLD model induced by high-fat diet was established by feeding mice with high-fat diet-H10060 (a high-fat purified diet with a fat energy supply ratio of 60%) (purchased from Beijing Huafukang Biotechnology Co., Ltd.). Male C57BL / 6 mice were used as experimental animals, raised at room temperature and allowed to eat freely. After 1 week of adaptive feeding, the model was established for 7 weeks.

[0145] 2. Improvement effect of oral intervention of strain SPU_B4211 on C57BL / 6 mice with hyperlipidemia induced by high-fat diet: After the establishment of the hyperlipidemia model induced by high-fat diet, the mice were divided into 5 groups, 8 mice in each group, and the experimental conditions of each group are shown in Table 1.

[0146] Table 1. Experimental conditions of mice in each group

[0147]

[0148] As described in Table 1, mice in the B4211L group and the B4211P group were fed a high-fat diet all day, and live and killed bacterial suspensions of the strain SPU_B4211 were gavaged to the mice in the B4211L group and the B4211P group every morning for 12 weeks.

[0149] After the 12-week experiment, the body weight of mice in each group was Figure 4 As shown:

[0150] After oral intervention, the body weight of mice in the B4211L and B4211P groups was significantly lower than that in the HFD group, and the body weight decreased from 39.05±4.880g (HFD) to 29.33±1.166g (B4211L) and 29.89±1.085g (B4211P), indicating that it effectively reduced the body weight of mice.

[0151] 3. Determination of biochemical indicators

[0152] The blood was collected from the orbital venous plexus. The collected blood was centrifuged at 3000rpm for 10min to obtain serum. The levels of biochemical indexes in the serum of each group of mice were determined using a triglyceride (TG) detection kit (catalog number: A110-1 Nanjing Jiancheng Bioengineering Institute), a total cholesterol (T-CHO) detection kit (catalog number: A111-1 Nanjing Jiancheng Bioengineering Institute), a high-density lipoprotein (HDL) detection kit (catalog number: A112-1 Nanjing Jiancheng Bioengineering Institute), and a low-density lipoprotein (LDL) detection kit (catalog number: A113-1 Nanjing Jiancheng Bioengineering Institute).

[0153] After the 12-week intervention, the liver tissue was accurately weighed, and 9 volumes of physiological saline were added at a ratio of weight (g): volume (mL) = 1:9. The tissue was chopped and homogenized in an ice-water bath. The supernatant was centrifuged at 3000 rpm for 10 min and the 10% homogenate supernatant was taken for testing. The levels of biochemical indexes in the liver of each group of mice were determined using the aspartate aminotransferase (ALT) detection kit (Cat. No.: C010-2 Nanjing Jiancheng Bioengineering Institute), the alanine aminotransferase (AST) detection kit (Cat. No.: C009-2-1 Nanjing Jiancheng Bioengineering Institute), and the propylene glycol (MDA) detection kit (Cat. No.: A003-1 Nanjing Jiancheng Bioengineering Institute).

[0154] Statistical method for experimental results data: expressed as (x±s), analyzed using Graphpad prism8 statistical software, one-way analysis of variance (ANOVA) was used to compare the means among multiple groups, and independent t-test was used to compare the means between two groups. p<0.05 was considered statistically significant, and p<0.05 was considered significant compared with the HFD group.

[0155] After the 12-week experiment, the levels of TG, T-CHO, HDL, and LDL in the serum of mice in each group were as follows: Figure 5 . Figure 6 . Figure 7 . Figure 8 .As shown:

[0156] After oral intervention, the levels of TG, T-CHO, and LDL in the serum of mice in the B4211L and B4211P groups were significantly lower than those in the HFD group. The TG level in the serum of mice decreased from 1.394±0.1012mmol / L (HFD) to 0.6564±0.1236mmol / L (B4211L) and 0.7758±0.1371mmol / L (B4211P), and the T-CHO level decreased from 5.990±0.4691mmol / L (HFD) to 0.6564±0.1236mmol / L (B4211L) and 0.7758±0.1371mmol / L (B4211P). The levels of LDL in B4211P and B4211L decreased from 2.723±0.6004mmol / L(HFD) to 1.501±0.5979mmol / L(B4211L) and 1.732±0.5154mmol / L(B4211P), indicating that the drug effectively reduces the blood lipid levels in mice.

[0157] The levels of AST, ALT and MDA in the liver of mice in each group were as follows Fig. 9 . Fig.10 . Fig.11 .As shown:

[0158] After oral intervention, the levels of AST, ALT, and MDA in the liver of mice in the B4211L and B4211P groups were significantly lower than those in the HFD group. The AST level decreased from 36.42±3.755 U / gprot (HFD) to 1.131±0.5728 U / gprot (B4211L) and 2.264±0.8253 U / gprot (B4211P), and the ALT level in the liver of mice decreased from 66.93±6.547 U / gprot (HFD) to 36.87±10.26U / gprot(B4211L) and 35.29±8.739U / gprot(B4211P), and MDA levels decreased from 3.581±0.5944nmol / mgprot(HFD) to 10.16±4.844nmol / mgprot(B4211L) and 10.87±3.692nmol / mgprot(B4211P). It can be seen that after intervention, liver damage in mice was alleviated and returned to normal.

[0159] The fasting blood glucose levels of mice in each group were Fig.12 As shown:

[0160] After oral intervention, the fasting blood glucose levels of mice in the B4211L and B4211P groups were significantly lower than those in the HFD group. The fasting blood glucose levels decreased from 7.950±1.548mmol / L (HFD) to 3.533±0.2875mmol / L (B4211L) and 3.483±0.7627mmol / L (B4211P). It can be seen that after the intervention, the fasting blood glucose levels of mice were significantly restored.

[0161] 4. Glucose tolerance test (GTT)

[0162] After 12 hours of fasting, the mice in each group were intraperitoneally injected with 2.5 g / kg of glucose solution according to their body weight. Blood samples were collected at 0 min, 15 min, 30 min, 60 min, and 120 min after the intraperitoneal injection and the glucose content in the blood was measured using a blood glucose meter. Fig.13 As shown: from 0 to 120 minutes, the blood glucose reduction rate of the B4211L group and the B4211P group was significantly faster than that of the HFD group, and glucose tolerance was significantly improved.

[0163] 5. Insulin Resistance Test (ITT)

[0164] After the above glucose tolerance test, mice in each group were intraperitoneally injected with 0.75 U / kg insulin solution according to body weight after 4 hours of fasting. Blood samples were collected at 0 min, 15 min, 30 min, 60 min, and 120 min after intraperitoneal injection and the glucose content in the blood was tested using a blood glucose meter. Fig.14 As shown: from 0 to 120 minutes, the blood glucose increase rate of the B4211L group and the B4211P group was significantly slower than that of the HFD group, indicating that insulin resistance was significantly improved.

[0165] VI. Preparation and Observation of Liver Appearance and Histopathological Sections

[0166] The mice were killed by cervical dislocation, and the livers were removed and photographed before being fixed in cell fixative.

[0167] (1) Rinse: Rinse the fixed kidney tissue repeatedly with PBS for 3 times, each time for 10 min.

[0168] (2) Dehydration: Use gradient ethanol for dehydration: 70% ethanol for 30 min; 80% ethanol for 30 min; 90% ethanol for 30 min; 95% ethanol for 30 min; 95% ethanol for 30 min; anhydrous ethanol for 30 min; anhydrous ethanol for 30 min.

[0169] (3) Transparency: Soak in xylene for 5 minutes.

[0170] (4) Wax dipping: Melt the paraffin in a paraffin cup in a 65°C oven, and place the tissue in the paraffin for 10 minutes. (5) Paraffin embedding: Pour the melted paraffin into the prepared embedding box and quickly place the sample in it. After solidification, take out the paraffin block and store it in a dry place at room temperature for later use.

[0171] (6) Sectioning: Trim the paraffin block into trapezoidal blocks and cut into uniform slices of 4 to 5 μm using a microtome.

[0172] (7) Water bath expansion: Expand the sections in 50°C water and place them on a glass slide.

[0173] (8) Baking: Place the slides in a 37°C constant temperature incubator overnight.

[0174] (9) H&E staining: hematoxylin staining for 10 min; washing with water; differentiation with 1% hydrochloric acid ethanol solution for 10 s; washing with water; anti-blueing with 1% ammonia solution for 10 s; washing with water; staining with 1% eosin for 6 min; washing with water; dehydration with gradient ethanol (low to high); transparentization with xylene; sealing with neutral gum.

[0175] (10) Microscope observation.

[0176] like Fig.15 As shown: Compared with the CON group, the liver of mice in the HFD group was diffusely enlarged and the surface color was obviously yellow. The fat vacuoles in the liver tissue sections increased significantly, with inflammatory cell infiltration, proving the success of the model. After oral intervention, the liver appearance and color of mice in the B4211L group and the B4211P group were normal, the fat vacuoles in the liver tissue sections decreased significantly, and no obvious inflammatory cell infiltration was observed.

[0177] Example 4 Obtaining Lactobacillus gasseri CGMCC NO.28808:

[0178] 1. Sample source

[0179] Sourced from commercially available Guizhou pickles.

[0180] 2. Isolation of Lactobacillus from Commercially Purchased Guizhou Pickles

[0181] Take 5 mL of the supernatant of Guizhou pickles purchased from the market, put it into a triangular flask containing 45 mL of sterile water, and shake it for 20 minutes. This is 10 -1 kimchi suspension; dilute to 10 -2 , 10 -3 , 10 -4 , 10 -5Afterwards, each dilution was spread on a separate plate, inverted, and cultured anaerobically at 37°C for 48 hours. After culture observation, a single colony grew out and was transferred to MRS medium for culture to obtain a single colony SPU_B4209.

[0182] 3. 16S rRNA sequence analysis

[0183] The solid plate with a single bacterial colony was sent to Bioengineering (Shanghai) Co., Ltd. for sequencing. The full length of the whole genome sequence was 1990080bp, of which the full length of the 16S rRNA sequence was 1569bp (see SEQ2). The obtained sequence was submitted to the GenBank database for BLAST analysis and comparison, and it was found that the strain with a high homology to CGMCC NO.28808 belonged to Lactobacillus gasseri, and the strain was preliminarily identified as the Lactobacillus gasseri group.

[0184] The 16S rRNA sequence is

[0185] ATGAGAGTTTGATCCTGGCTCAGGACGAACGCTGGCGGCGTGCCTAATACATG

[0186] CAAGTCGAGCGAGCTTGCCTAGATGAA

[0187] TTTGGTGCTTGCACCAAATGAAACTAGATACAAGCGAGCGGCGGACGGGTGA

[0188] GTAACACGTGGGTAACCTGCCCAAGAGA

[0189] CTGGGATAACACCTGGAAACAGATGCTAATACCGGATAACAACACTAGACGCA

[0190] TGTCTAGAGTTTAAAAGATGGTTCTGC

[0191] TATCACTCTTGGATGGACCTGCGGTGCATTAGCTAGTTGGTAAGGTAACGGCTT

[0192] ACCAAGGCAATGATGCATAGCCGAGT

[0193] TGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGG

[0194] GAGGCAGCAGTAGGGAATCTTCCACAAT

[0195] GGACGCAAGTCTGATGGAGCAACGCCGCGTGAGTGAAGAAGGGTTTCGGCT

[0196] CGTAAAGCTCTGTTGGTAGTGAAGAAAGA

[0197] TAGAGGTAGTAACTGGCCTTTATTTGACGGTAATTACTTAGAAAGTCACGGCT

[0198] AACTACGTGCCAGCAGCCGCGGTAATA

[0199] CGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCG

[0200] GTTCAATAAGTCTGATGTGAAAGCCTTC

[0201] GGCTCAACCGGAGAATTGCATCAGAAACTGTTGAACTTGAGTGCAGAAGAGG

[0202] AGAGTGGAACTCCATGTGTAGCGGTGGA

[0203] ATGCGTAGATATATGGAAGAACACCAGTGGCGAAGGCGGCTCTCTGGTCTGCA

[0204] ACTGACGCTGAGGCTCGAAAGCATGGG

[0205] TAGCGAACAGGATTAGATACCCTGGTAGTCCATGCCGTAAACGATGAGTGCTA

[0206] AGTGTTGGGAGGTTTCCGCCTCTCAGT

[0207] GCTGCAGCTAACGCATTAAGCACTCCGCCTGGGGAGTACGACCGCAAGGTTG

[0208] AAACTCAAAGGAATTGACGGGGGCCCGC

[0209] ACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAACCTTACCA

[0210] GGTCTTGACATCCAGTGCAAACCTAAGA

[0211] GATTAGGAGTTCCCTTCGGGGACGCTGAGACAGGTGGTGCATGGCTGTCGTC

[0212] AGCTCGTGTCGTGAGATGTTGGGTTAAG

[0213] TCCCGCAACGAGCGCAACCCTTGTCATTAGTTGCCATCATTAAGTTGGGCACT

[0214] CTAATGAGACTGCCGGTGACAAACCGG

[0215] AGGAAGGTGGGGATGACGTCAAGTCATCATGCCCCTTATGACCTGGGCTACAC

[0216] ACGTGCTACAATGGACGGTACAACGAG

[0217] AAGCGAACCTGCGAAGGCAAGCGGATCTCTGAAAGCCGTTCTCAGTTCGGAC

[0218] TGTAGGCTGCAACTCGCCTACACGAAGC

[0219] TGGAATCGCTAGTAATCGCGGATCAGCACGCCGCGGTGAATACGTTCCCGGGC

[0220] CTTGTACACACCGCCCGTCACACCATG

[0221] AGAGTCTGTAACACCCAAAGCCGGTGGGATAACCTTTATAGGAGTCAGCCGTC

[0222] TAAGGTAGGACAGATGATTAGGGTGAA

[0223] GTCGTAACAAGGTAGCCGTAGGAGAACCTGCGGCTGGATCACCTCCTTT

[0224] Lactobacillus gasseri SPU_B4209 (Latin name Lactobacillus gasseri) was deposited on October 30, 2023 at the General Microbiology Center of China Culture Collection Administration, located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with the deposit number CGMCC NO.28808.

[0225] Example 5 Method for preparing bacterial suspension

[0226] The culture medium used for preparing the bacterial suspension is as described in Example 2, and is specifically prepared as follows:

[0227] Bacterial suspension preparation method

[0228] Lactobacillus gasseri SPU_B4209 was inoculated into a MRS medium plate and incubated anaerobically at 37°C for 48 hours to activate the strain. The activated strain was placed in MRS liquid medium and cultured to the logarithmic growth phase. The growth curve of strain SPU_B4209 is shown in FIG. Fig.16 . As shown: the strain reached the logarithmic growth phase in 6 hours. The dilution plate method was used for counting, and the concentration of the fermentation broth was 1.0×10 10 CFU / mL; the fermentation broth was centrifuged at 4000 rpm for 10 min, the supernatant was discarded, the bacteria were collected, and resuspended in 0.9% saline to 1.0×10 9 CFU / mL. The oral concentration of the bacterial suspension is 2.0×10 10 ~4.0×10 10 CFU / kg(BW).

[0229] Preparation method of inactivated bacteria suspension

[0230] The bacterial suspension was inactivated in a water bath at 70°C for 1 hour and then used for later use. The oral concentration of the inactivated bacterial suspension was 2.0×10 11 ~4.0×10 11 CFU / kg(BW).

[0231] Gastrointestinal fluid tolerance test

[0232] (1) Preparation of simulated artificial gastric fluid: prepare 2 g / L NaCl solution, adjust the pH to 2, 3, and 4, and sterilize by high pressure at 121°C for 15 min; take pepsin (3 g / L), add it to the NaCl solution to dissolve, filter it through a 0.22 μm filter membrane to sterilize, and store it at 4°C for later use.

[0233] (2) Prepare artificial intestinal fluid: Weigh 6.8 g of potassium dihydrogen phosphate, add 500 mL of water to dissolve, adjust the pH to 6.8 with 0.1 mol / L NaOH solution, and sterilize at 121°C for 15 min. Take 10 g of pancreatic enzyme (≥250 NFU / mg), add appropriate amount of sterile water to dissolve, mix the two solutions, and adjust the volume to 1000 mL to obtain artificial intestinal fluid. Take appropriate amount of solution, add appropriate amount of ox bile salt, so that the bile salt concentration is 0.03%, 0.1%, 0.2%, and 0.3%, respectively, filter through 0.22 μm filter membrane for sterilization, and store at 4°C for use.

[0234] (3) Artificial gastric fluid tolerance test: Take a single colony of SPU_B4209 and inoculate it in 20mL MRS liquid medium, and incubate it at 37℃ for 12h. Then inoculate it in MRS liquid medium with 2% inoculum (v / v), and incubate it at 37℃ for 6h. Take four portions of bacterial solution, 30mL each, centrifuge at 8000rpm, 4℃ for 5min, and remove the supernatant for use. Take one portion, resuspend the bacteria with 30mL physiological saline, take 100μl for dilution and spread on the plate, and use it as the bacterial concentration of the bacterial solution at 0min. Take the remaining 3 centrifuge tubes with bacteria, add 30mL of artificial gastric fluid, pH 2, 3, 4, respectively, mix well, and take 100μL of artificial gastric fluid containing SPU_B4209 strain from each gradient at 2, 6, 10, 14, 24h for dilution and spread, and incubate it at 37℃ for 48h. Count the single colonies and draw a curve with time as the horizontal axis and CFU as the vertical axis. Fig.17 As shown: It can be seen that SPU_B4209 has poor tolerance at pH 2, good tolerance at pH 3-4, and the tolerance decreases as the pH becomes lower.

[0235] (4) Artificial intestinal fluid tolerance experiment: Take a single colony of SPU_B4209 and inoculate it in 20mL MRS liquid medium, and incubate it at 37℃ for 6h. Inoculate it in MRS liquid medium with 2% inoculum (v / v), and incubate it at 37℃ for 10h. Take five portions of bacterial solution, each 30mL, centrifuge at 8000rpm, 4℃ for 5min, and remove the supernatant. Take one portion, resuspend the bacteria with 30mL physiological saline, take 100μL to dilute and spread on the plate, and use it as the bacterial concentration of the bacterial solution at 0min. Take the remaining 4 centrifuge tubes with bacteria, add 30mL of artificial intestinal fluid, with bile salt concentrations of 0.03%, 0.1%, 0.2%, and 0.3%, respectively, mix well, and take 100μL from each gradient of artificial intestinal fluid containing SPU_B4209 strain at 2, 6, 10, 14, and 24h for dilution and spreading, and incubate it at 37℃ for 48h. Count the single colonies and draw a curve with time as the horizontal axis and CFU as the vertical axis. Fig.18As shown: It can be seen that SPU_B4209 has poor tolerance under the condition of 0.3% bile salt concentration, and has good tolerance under the condition of 0.03%-0.2% bile salt concentration, and the tolerance decreases with the increase of bile salt concentration.

[0236] Example 6 The improvement effect of strain SPU_B4209 at different feeding doses on the NAFLD model C57BL / 6 mice induced by a high-fat diet.

[0237] 1. Establishment of NAFLD model induced by high-fat diet

[0238] The NAFLD model induced by a high-fat diet was established by feeding mice with a high-fat diet-H10060 (a high-fat purified diet with a fat energy supply ratio of 60%) (purchased from Beijing Huafukang Biotechnology Co., Ltd.). Male C57BL / 6 mice were used as experimental animals and were raised at room temperature with free access to food. After 1 week of adaptive feeding, the model was established for 7 weeks.

[0239] 2. Improvement effect of oral intervention of strain SPU_B4209 on high-fat diet-induced NAFLD model C57BL / 6 mice After the establishment of the high-fat diet-induced NAFLD model, the mice were divided into 5 groups, 8 mice in each group. The experimental conditions of each group are shown in Table 2.

[0240] Table 2. Experimental conditions of mice in each group

[0241]

[0242] As described in Table 2, mice in the B4209L group and the B4209P group were fed with a high-fat diet all day long, and were gavaged with live and killed bacterial suspensions of the strain SPU_B4209, respectively, every morning for 12 weeks.

[0243] After the 12-week experiment, the body weight of mice in each group was Fig.19 As shown:

[0244] After oral intervention, the body weight of mice in the B4209L and B4209P groups was significantly lower than that in the HFD group, with the body weight decreasing from 39.05

[0245] ±4.880g (HFD) decreased to 31.46±1.767g (B4209L) and 30.77±1.341g (B4209P), indicating that it effectively reduced the body weight of mice.

[0246] 3. Determination of biochemical indicators

[0247] The blood was collected from the orbital venous plexus. The collected blood was centrifuged at 3000rpm for 10min to obtain serum. The levels of biochemical indexes in the serum of each group of mice were determined using a triglyceride (TG) detection kit (catalog number: A110-1 Nanjing Jiancheng Bioengineering Institute), a total cholesterol (T-CHO) detection kit (catalog number: A111-1 Nanjing Jiancheng Bioengineering Institute), a high-density lipoprotein (HDL) detection kit (catalog number: A112-1 Nanjing Jiancheng Bioengineering Institute), and a low-density lipoprotein (LDL) detection kit (catalog number: A113-1 Nanjing Jiancheng Bioengineering Institute).

[0248] After the 12-week intervention, the liver tissue was accurately weighed, and 9 volumes of physiological saline were added at a ratio of weight (g): volume (mL) = 1:9. The tissue was chopped and homogenized in an ice-water bath. The supernatant was centrifuged at 3000 rpm for 10 min and the 10% homogenate supernatant was taken for testing. The levels of biochemical indexes in the liver of each group of mice were determined using the aspartate aminotransferase (ALT) detection kit (Cat. No.: C010-2 Nanjing Jiancheng Bioengineering Institute), the alanine aminotransferase (AST) detection kit (Cat. No.: C009-2-1 Nanjing Jiancheng Bioengineering Institute), and the propylene glycol (MDA) detection kit (Cat. No.: A003-1 Nanjing Jiancheng Bioengineering Institute).

[0249] Statistical method for experimental results data: expressed as (x±s), analyzed using Graphpad prism8 statistical software, one-way analysis of variance (ANOVA) was used to compare the means among multiple groups, and independent t-test was used to compare the means between two groups. p<0.05 was considered statistically significant, and p<0.05 was considered significant compared with the HFD group.

[0250] After the 12-week experiment, the levels of TG, T-CHO, HDL, and LDL in the serum of mice in each group were as follows: Fig. 20 . Fig.21 . Fig. 22 . Fig.23 .As shown:

[0251] After oral intervention, the levels of TG, T-CHO, and LDL in the serum of mice in the B4209L and B4209P groups were significantly lower than those in the HFD group. The TG level in the serum of mice decreased from 1.394±0.1012mmol / L (HFD) to 0.6564±0.1236mmol / L (B4209L) and 0.7758±0.1371mmol / L (B4209P), and the T-CHO level decreased from 5.990±0.469 1mmol / L (HFD) decreased to 3.913±0.5321mmol / L (B4209L) and 4.052±0.6067mmol / L (B209P), and LDL level decreased from 2.723±0.6004mmol / L (HFD) to 1.501±0.5979 (B4209L) and 1.732±0.5154mmol / L (B4209P), which showed that it effectively reduced the blood lipid level of mice.

[0252] The levels of AST, ALT and MDA in the liver of mice in each group were as follows Fig.24 . Fig.25 . Fig.26 .As shown:

[0253] After oral intervention, the levels of AST, ALT, and MDA in the livers of mice in the B4209L and B4209P groups were significantly lower than those in the HFD group. The AST level in the livers of mice decreased from 36.42±3.755U / gprot (HFD) to 1.131±0.5728U / gprot (B4209L) and 2.264±0.8253U / gprot (B4209P), and the ALT level decreased from 66.93±6.547U / gprot (HFD) to 36.87±10.26U / gprot(B4209L) and 35.29±8.739U / gprot(B4209P), and MDA level decreased from 3.581±0.5944nmol / mgprot(HFD) to 10.16±4.844nmol / mgprot(B4209L) and 10.87±3.692nmol / mgprot(B4209P). It can be seen that after intervention, liver damage in mice was alleviated and returned to normal.

[0254] The fasting blood glucose levels of mice in each group were Fig. 27 As shown:

[0255] After oral intervention, the fasting blood glucose levels of mice in the B4209L and B4209P groups were significantly lower than those in the HFD group. The fasting blood glucose decreased from 7.950±1.548mmol / L (HFD) to 4.600±0.4427mmol / L (B4209L) and 6.133±1.025mmol / L (B4209P). It can be seen that after the intervention, the fasting blood glucose of mice was significantly restored.

[0256] 4. Glucose tolerance test (GTT)

[0257] After fasting for 12 hours, mice were intraperitoneally injected with 2.5 g / kg glucose solution according to their body weight. Blood samples were collected at 0 min, 15 min, 30 min, 60 min, and 120 min after intraperitoneal injection and the glucose content in the blood was measured using a blood glucose meter. Fig.28 As shown: from 0 to 120 minutes, the blood glucose reduction rate of the B4209L group and the B4209P group was significantly faster than that of the HFD group, and glucose tolerance was significantly improved.

[0258] 5. Insulin Resistance Test (ITT)

[0259] After 4 hours of fasting, mice were intraperitoneally injected with 0.75 U / kg insulin solution according to their body weight. Blood samples were collected at 0 min, 15 min, 30 min, 60 min, and 120 min after intraperitoneal injection and the glucose content in the blood was measured using a blood glucose meter. Fig.29 As shown: from 0 to 120 minutes, the blood glucose increase rate of the B4209L group and the B4209P group was significantly slower than that of the HFD group, and insulin resistance was significantly improved.

[0260] VI. Preparation and Observation of Liver Appearance and Histopathological Sections

[0261] See the record of above-mentioned embodiment 3, such as Fig.30 As shown: Compared with the CON group, the liver of mice in the HFD group was diffusely enlarged and the surface color was obviously yellow. The fat vacuoles in the liver tissue sections increased significantly, with inflammatory cell infiltration, proving the success of the model. After oral intervention, the liver appearance and color of mice in the B4209L group and the B4209P group were normal, the fat vacuoles in the liver tissue sections decreased significantly, and no obvious inflammatory cell infiltration was observed.

Claims

1. A bacterium capable of improving lipid metabolism diseases, characterized in that: The bacterium with the ability to improve lipid metabolism diseases is Lactobacillus gasseri SPU_B4211, which was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on October 30, 2023, with the deposit number: CGMCC NO.28809; Or, Lactobacillus gasseri SPU_B4209, was deposited in the General Microbiology Center of China Culture Collection Administration on October 30, 2023, with the deposit number: CGMCC NO.28808.

2. A use of the bacteria capable of improving lipid metabolism diseases according to claim 1, characterized in that: Application of the bacteria in improving lipid metabolism diseases.

3. The use of bacteria capable of improving lipid metabolism diseases according to claim 2, characterized in that: Application of Lactobacillus gasseri SPU_B4211 in improving hyperlipidemia; Application of Lactobacillus gasseri SPU_B4209 in improving non-alcoholic fatty liver disease.

4. The use of bacteria capable of improving lipid metabolism diseases according to claim 3, characterized in that: Application of Lactobacillus gasseri SPU_B4211 in the preparation of medicines or foods for improving hyperlipidemia; Application of Lactobacillus gasseri SPU_B4209 in the preparation of medicines or foods for improving non-alcoholic fatty liver disease.

5. A product capable of improving lipid metabolism diseases, characterized in that: The product contains the bacteria according to claim 1.

6. The product having the ability to improve lipid metabolism diseases according to claim 5, characterized in that: The product is a fermentation liquid, a bacterial suspension, or a freeze-dried powder of the bacteria; wherein the bacteria is Lactobacillus gasseri SPU_B4211 or Lactobacillus gasseri SPU_B4209.

7. The product having the ability to improve lipid metabolism diseases according to claim 6, characterized in that: The fermentation broth of Lactobacillus gasseri strain SPU_B4211 is prepared by inoculating the Lactobacillus gasseri strain into an MRS culture medium plate, inverting and anaerobic culturing at 37° C. for 48 hours to activate the strain, placing the activated strain into an MRS liquid culture medium, culturing to the logarithmic growth phase, and counting by the dilution plate method. The concentration of the fermentation broth is 1.0×10 11 CFU / mL; The bacterial suspension of Lactobacillus gasseri strain SPU_B4211 is obtained by centrifuging the fermented liquid of Lactobacillus gasseri obtained above at 4000 rpm to collect bacterial mud, and then diluting it with 0.9% physiological saline to obtain the bacterial suspension.

8. The product having the ability to improve lipid metabolism diseases according to claim 6, characterized in that: The Lactobacillus gasseri fermentation broth is prepared by inoculating the Lactobacillus gasseri strain SPU_B4209 in an MRS culture medium plate, inverting and anaerobic culturing at 37°C for 48 hours to activate the strain, placing the activated strain in an MRS liquid culture medium, culturing to a logarithmic growth phase, and counting by a dilution plate method. The concentration of the fermentation broth is 1.0×10 10 CFU / mL; The Lactobacillus gasseri SPU_B4209 bacterial suspension is prepared by centrifuging the fermented liquid of the Lactobacillus gasseri obtained above at 4000 rpm to collect bacterial mud, and then diluting the mixture with 0.9% physiological saline to obtain the bacterial suspension.

9. The product having the ability to improve lipid metabolism diseases according to claim 5, characterized in that: The product has the ability to improve hyperlipidemia or non-alcoholic fatty liver disease.

Images