Marek's disease virus double-gene editing deletion vaccine strain SQ01 [delta] meq [delta] M11 as well as construction and application thereof

Abstract

The invention provides a Marek's disease virus meq and miR-M11 double-gene editing deleted vaccine candidate strain SQ01 [delta] meq [delta] M11 as well as construction and application of the vaccine candidate strain SQ01 [delta] meq [delta] M11. The preservation number of the vaccine strain is CGMCC (China General Microbiological Culture Collection Center) NO.45874. The parent strain of the SQ01 [delta] meq [delta] M11 vaccine strain provided by the invention is an MDV ultra-strong Chinese variant strain HNSQ01. After a parent strain HNSQ01 is subjected to in-vitro passage, a CRISPR / Cas9 gene editing technology is utilized, and fragments with the sizes of 925bp and 295bp are respectively deleted on two meq alleles and two miR-M11 alleles of an HNSQ01 genome. Through PCR identification, gene clone sequencing, RT-qPCR analysis, IFA identification and the like, it is proved that meq and miR-M11 dialleles of the SQ01 [delta] meq [delta] M11 strain are completely deleted, and passage stability is good. The SPF chicken immune challenge protection evaluation experiment shows that SQ01 [delta] meq [delta] M11 has good immune protection performance, and the immune protection index of the SQ01 [delta] meq [delta] M11 to parent strains is as high as 94.4%. Therefore, the SQ01 [delta] meq [delta] M11 strain constructed by the invention not only can be used as a latest MD gene deletion vaccine candidate strain, but also can be used for development and utilization of subsequent MD novel genetic engineering vaccines.

Description

Technical Field

[0001] The present invention relates to a MD vaccine candidate strain SQ01ΔmeqΔM11 with double gene editing deletion of meq and miR-M11 based on a super-strong Chinese variant of Marek's disease virus, as well as its construction and application, belonging to the field of animal virology. Background Art

[0002] Marek's disease (MD) is one of the most important immunosuppressive and tumor diseases in poultry caused by early infection with Marek's disease virus (MDV), causing huge economic losses to the global poultry industry every year. The poultry herpesviruses associated with MD include three different serotypes, namely serotype Ⅰ (MDV-1) or fowl herpesvirus 2 (GaAHV-2), serotype Ⅱ (MDV-2) or fowl herpesvirus 3 (GaAHV-3), and serotype Ⅲ (MDV-3) or turkey herpesvirus (HVT) / (MeAHV-1). Among them, only MDV-1 isolates are pathogenic and tumorigenic. As the first viral tumor disease successfully controlled by vaccines, MD was well controlled in the last few decades of the last century. However, the long-term use of MD vaccines and super immune pressure have led to the continuous evolution and increasing virulence of MDV epidemic strains. In recent years, some extremely virulent MDV (vv+MDV) strains, especially the extremely virulent Chinese variant of MDV (HV-MDV) recently isolated from cases of disease in chickens immunized with MD vaccine, have been proven to have completely broken through the immune protection of the currently widely used classic MD vaccine. They are likely to be the main reason for the recent frequent outbreaks of MD cases in the global poultry industry, causing serious harm and huge losses to the poultry industry.

[0003] The meq gene is the main oncogenic gene of MDV. Some scholars used bacterial artificial chromosomes (BAC) and homologous gene recombination technology to knock out the meq gene of MDV virulent strains and found that the virus no longer had an oncogenic effect. This discovery revealed that the meq gene plays a key role in MDV oncogenicity. In subsequent studies, the meq gene was used as the main target to modify the viral genome to construct a series of MD gene-deficient vaccine candidate strains, such as rMd5Δmeq, Md5BACΔMeqΔLORF9, 686BAC-ΔMeqΔvIL8, rMSΔmeq and SC9-1, which have become the hot spots of new MD vaccine research in the last 20 years of this century. However, affected by many unknown factors, most of the meq gene-deficient candidate strains still have problems such as insufficient immunosuppression or immune protection of the host. Through previous studies, we found that MDV-1 encoded miRNA plays an important role in the formation of MD tumors, and the deletion of miR-M11 in the Mid gene cluster can significantly enhance the in vitro replication ability of MDV, which may be a key gene regulating MDV replication.

[0004] Therefore, using the latest isolated HV-MDV Chinese variant as the parent strain for the development of a new and highly effective MD vaccine, and combining it with CRISPR / Cas9 gene editing technology to construct a double-gene deletion vaccine candidate strain, and developing a new and more efficient MD vaccine can effectively solve the current dilemma of frequent MD outbreaks in chicken flocks immunized with the classic MD vaccine, and provide a safeguard for the effective prevention and control of MD. Summary of the invention

[0005] In view of the shortcomings of the prior art, the purpose of the present invention is to provide a double-gene edited MD vaccine candidate strain SQ01ΔmeqΔM11 based on the super-strong Chinese variant of Marek's disease virus, as well as its construction and application.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is:

[0007] A Marek's disease virus meq and miR-M11 double gene editing deletion vaccine candidate strain SQ01ΔmeqΔM11. The Marek's disease virus meq and miR-M11 double gene editing deletion vaccine candidate strain is SQ01ΔmeqΔM11, which has been deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number CGMCC NO.45874.

[0008] The parent strain of the vaccine candidate strain SQ01ΔmeqΔM11 is the extremely strong variant strain HNSQ01 of Marek's disease virus isolated from Chinese chickens. The full genome nucleotide sequence of the parent strain is 176043 bp in length, as shown in SEQID NO.1.

[0009] The vaccine candidate strain SQ01ΔmeqΔM11 is based on the Marek's disease virus super-strong Chinese variant HNSQ01 as the parent strain. The two meq alleles in its genome are edited to delete a fragment with the same length of 925bp, and the molecular marker sites of the gene deletion are: 4486-5411 and 133584-134509 respectively; on this basis, the two miR-M11 alleles in the genome are edited to delete a fragment with the same length of 295bp, and the molecular marker sites of the gene deletion are: 3980-4275 and 134720-135015 respectively.

[0010] The method for constructing the Marek's disease virus meq and miR-M11 double gene editing deletion vaccine candidate strain SQ01ΔmeqΔM11 uses CRISPR / Cas9 gene editing technology to first knock out two meq alleles and then knock out two miR-M11 alleles.

[0011] The application of the Marek's disease virus meq and miR-M11 double gene editing deletion vaccine candidate strain SQ01ΔmeqΔM11 in the preparation of a new and highly effective vaccine for chicken Marek's disease.

[0012] The novel and highly effective vaccine for Marek's disease in chickens is a genetically engineered Marek's disease vaccine, a combined Marek's disease vaccine or a multivalent Marek's disease vaccine constructed with SQ01ΔmeqΔM11 as the vaccine strain; or a genetically engineered Marek's disease vaccine, a combined Marek's disease vaccine or a multivalent Marek's disease vaccine constructed with SQ01ΔmeqΔM11 as the parent strain.

[0013] The chicken Marek's disease genetic engineering vaccine is a gene deletion, gene recombination or virus vector vaccine.

[0014] The application includes but is not limited to utilizing the virus particles, viral nucleic acid DNA and whole genome sequence information of the Marek's disease virus meq and miR-M11 double gene editing deletion vaccine candidate strain SQ01ΔmeqΔM11.

[0015] Beneficial effects of the present invention:

[0016] 1. The meq and miR-M11 double gene editing deletion strain SQ01ΔmeqΔM11 of the Marek's disease virus HNSQ01 of the present invention is a vaccine candidate strain with meq and miR-M11 double gene deletions, which is constructed using the latest popular HV-MDV Chinese variant in China as the parent strain and CRISPR / Cas9 gene editing technology. Through a series of experimental studies such as the construction and identification of meq and miR-M11 double gene deletion strains, and the evaluation of immune attack protection of 1-day-old SPF chickens, it is confirmed that SQ01ΔmeqΔM11 can be used as a new and efficient MD genetic engineering vaccine candidate strain, which can provide a comprehensive and reliable experimental basis. The present invention is aimed at the MDV dominant strains currently prevalent in domestic chickens, especially the HV-MDV Chinese variant, and has developed a new double gene deletion vaccine strain, which can provide good immune protection efficiency and fill the gap in the research and development of a new generation of MD genetic engineering vaccines in my country.

[0017] 2. The parent strain of the Marek's disease virus meq and miR-M11 double gene deletion vaccine candidate strain SQ01ΔmeqΔM11 provided by the present invention is HNSQ01, which was isolated from a flock of laying hens that were vaccinated but had an MD epidemic at a poultry farm in central China in 2021. It was defined as a very strong Marek's disease virus (HV-MDV) Chinese variant strain through a series of MDV pathogenicity analysis and pathotype identification experiments such as whole genome sequencing analysis of the virus, 1-day-old SPF chicken challenge experiment, and MD vaccine immune protection challenge experiment. This strain can well represent the dominant MDV strain currently prevalent in domestic chicken flocks, and the strain has a clear source and genetic background.

[0018] 3. The double gene editing deletion strain SQ01ΔmeqΔM11 of the present invention was confirmed to have complete deletion of meq and miR-M11 biallelic genes and good stability in passage through PCR identification, gene cloning sequencing, RT-qPCR analysis, IFA identification, etc. The results of the SPF chicken immune challenge protection experiment showed that SQ01ΔmeqΔM11 had good immune protection, and the immune protection index (PI) of the parent strain HNSQ01 was as high as 94.4%. Therefore, the SQ01ΔmeqΔM11 strain constructed by the present invention can not only be used as the latest MD gene deletion vaccine candidate strain, but also can be used for the subsequent development and utilization of new MD genetic engineering vaccines.

[0019] 4. The virus particles and viral nucleic acid DNA of the Marek's disease virus meq and miR-M11 double gene deletion vaccine candidate strain SQ01ΔmeqΔM11 provided by the present invention can continue to use CRISPR / Cas9 and other gene editing technologies on its basis to construct more Marek's disease genetic engineering vaccines, such as gene deletion, gene recombination or viral vector vaccines, etc., laying an important foundation for the creation of a new generation of MD high-efficiency vaccines, and can also provide vectors for genetic engineering recombinant vaccines of other poultry viruses. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Schematic diagram of the genome structure of the HV-MDV Chinese variant HNSQ01 and the gRNA targets of the meq and miR-M11 genes.

[0021] Among them: gRN / gRC represents the upstream and downstream gRNA targeting the meq gene; meq-9F / meq-2R represents the upstream and downstream primers for amplifying the meq gene; 4486 / 5411 and 133584 / 134509 are the sites where gRN / gRC cuts the two meq alleles of the HV-MDV Chinese variant HNSQ01 genome; gR3 / gR6 represents the upstream and downstream gRNA targeting the miR-M11 gene; Mid-5F / Mid-3R represents the upstream and downstream primers for amplifying the miR-M11 gene; 3980 / 4275 and 134720 / 135015 are the sites where gR3 / gR6 cuts the two miR-M11 alleles of the HV-MDV Chinese variant HNSQ01 genome.

[0022] Figure 2 PCR amplification and identification results of the SQ01ΔmeqΔM11 double gene editing deletion strain.

[0023] Among them: A, represents the PCR amplification identification results of the meq gene editing deletion and passage stability of the SQ01Δmeq strain; B, represents the PCR amplification identification results of the miR-M11 gene editing deletion and passage stability of the SQ01ΔmeqΔM11 strain;

[0024] M represents DNA molecular weight marker; HNSQ01 represents the parental strain; SQ01Δmeq represents the meq gene-edited deletion strain; SQ01ΔmeqΔM11 represents the meq and miR-M11 double-gene-edited deletion strain; gRN / gRC represents the meq gene-edited mixed sample; gR3 / gR6 represents the miR-M11 gene-edited mixed sample; CEF represents the chicken embryo fibroblast negative control; p1, p2, p3, p4, p5, p10 and p15 represent the different passage times of SQ01Δmeq or SQ01ΔmeqΔM11 on CEF.

[0025] Figure 3 Nucleotide sequence map of PCR amplification products of meq and miR-M11 genes of the SQ01ΔmeqΔM11 double gene editing deletion strain.

[0026] Among them: A, represents the nucleotide sequence map of the PCR amplification product of the meq gene of the SQ01ΔmeqΔM11 strain; B, represents the nucleotide sequence map of the PCR amplification product of the miR-M11 gene of the SQ01ΔmeqΔM11 strain; DSB and thick blue arrows represent double-stranded DNA gaps sheared by gene editing; gRN / gRC represent the upstream and downstream gRNAs targeting the meq gene; gR3 / gR6 represent the upstream and downstream gRNAs targeting the miR-M11 gene; dotted arrows represent the gRNA target sites in the meq or miR-M11 gene sequences; PAM represents the protospacer adjacent motif of the gRNA target gene.

[0027] Figure 4 Comparison analysis results of meq and miR-M11 gene sequencing between the SQ01ΔmeqΔM11 double gene editing deletion strain and the parental strain HNSQ01.

[0028] Among them: A, represents the comparison analysis results of the meq gene sequence of the SQ01ΔmeqΔM11 strain and the HNSQ01; B, represents the comparison analysis results of the miR-M11 gene sequence of the SQ01ΔmeqΔM11 strain and the HNSQ01; HNSQ01, represents the parental strain; SQ01ΔmeqΔM11, represents the meq and miR-M11 double gene editing deletion strain; DSB and blue thick arrows represent DNA double-strand gaps cut by gene editing; gRN / gRC, represent the upstream and downstream gRNAs targeting the meq gene; gR3 / gR6, represent the upstream and downstream gRNAs targeting the miR-M11 gene; dotted arrows represent the gRNA target sites in the meq or miR-M11 gene sequences; PAM, represents the protospacer adjacent motif of the gRNA target gene.

[0029] Figure 5 RT-qPCR analysis results of the relative expression levels of some viral protein-encoding genes and viral miRNAs in the SQ01ΔmeqΔM11 double-gene editing deletion strain.

[0030] Among them: A represents the relative expression level of some viral protein encoding genes of the SQ01ΔmeqΔM11 strain; B represents the relative expression level of some viral miRNAs genes of the SQ01ΔmeqΔM11 strain; HNSQ01 represents the parental strain; SQ01ΔmeqΔM11 represents the meq and miR-M11 double gene editing deletion strain.

[0031] Figure 6 IFA identification results of the SQ01ΔmeqΔM11 gene-edited deletion strain.

[0032] Among them: HNSQ01 represents the parental strain; SQ01ΔmeqΔM11 represents the meq and miR-M11 double gene editing deletion strain; gB represents the MDV-specific gB protein monoclonal antibody; Meq represents the MDV-1-specific Meq protein monoclonal antibody; Merge represents the overlap of pictures; the picture scale is 50μm.

[0033] Figure 7 Analysis results of body weight and immune organ index of chickens immunized with the SQ01ΔmeqΔM11 double gene-edited deletion strain.

[0034] Among them: A, represents the average weight of experimental chickens in each immune challenge group; B, represents the bursa of Fabricius / body weight ratio index of experimental chickens in each immune challenge group; C, represents the thymus / body weight ratio index of experimental chickens in each immune challenge group; D, represents the spleen / body weight ratio index of experimental chickens in each immune challenge group; CEF+CEF, represents the negative cell simulation control group, that is, immunization with CEF cells and then inoculation with CEF cells to simulate the challenge; CEF+HNSQ01, represents the challenge positive control group, that is, immunization with CEF cells and then challenge with HNSQ01 strain; SQ01ΔmeqΔM11+HNSQ01, represents the immune protection challenge group, that is, immunization with SQ01ΔmeqΔM11 vaccine strain and then challenge with HNSQ01 strain. The black asterisk * indicates the significant difference between the groups analyzed with the CEF+CEF negative cell simulation control group as the reference (P<0.05); the red asterisk * indicates the significant difference between the groups analyzed with the CEF+HNSQ01 challenge positive control group as the reference (P<0.05).

[0035] Figure 8 Survival curve of chickens immunized with the SQ01ΔmeqΔM11 double-gene edited deletion strain.

[0036] Among them: CEF+CEF, represents the negative cell simulation control group, that is, immunization with CEF cells and then inoculation with CEF cells to simulate the virus challenge; CEF+HNSQ01, represents the virus challenge positive control group, that is, immunization with CEF cells and then challenge with HNSQ01 strain; SQ01ΔmeqΔM11+HNSQ01, represents the immune protection virus challenge group, that is, immunization with SQ01ΔmeqΔM11 vaccine strain and then challenge with HNSQ01 strain. The black asterisk * indicates that there is a significant difference between the CEF+HNSQ01 virus challenge positive control group and the CEF+CEF negative cell simulation control group (P<0.05); the red asterisk * indicates that there is a significant difference between the CEF+HNSQ01 virus challenge positive control group and the SQ01ΔmeqΔM11+HNSQ01 immune protection virus challenge group (P<0.05).

[0037] Fig. 9 HE staining of pathological tissue sections of chickens immunized with the SQ01ΔmeqΔM11 double gene-edited deletion strain.

[0038] Among them: CEF+CEF represents the negative cell simulation control group, that is, CEF cells were inoculated after immunization with CEF cells to simulate the virus challenge; CEF+HNSQ01 represents the virus challenge positive control group, that is, the HNSQ01 strain was challenged after immunization with CEF cells; SQ01ΔmeqΔM11+HNSQ01 represents the immune protection virus challenge group, that is, the HNSQ01 strain was challenged after immunization with SQ01ΔmeqΔM11 vaccine strain; the picture scale is 20μm (magnification: 400×). DETAILED DESCRIPTION

[0039] The specific implementation methods of the present invention are further described in detail below in conjunction with the examples. Unless otherwise specified, the instruments and equipment involved in the examples are all conventional instruments and equipment; the reagents involved are all commercially available conventional reagents; and the test methods involved are all conventional methods.

[0040] Example 1: Virus isolation and whole genome sequencing and analysis of HNSQ01

[0041] In 2021, a suspected outbreak of MD occurred in a flock of 113-day-old laying hens immunized with CVI988 / Rispens vaccine at a farm in central China. Autopsy of dead chickens showed hepatosplenomegaly, and some chickens had focal tumors or diffuse tumor nodules in one or more internal organs. Conventional PCR and RT-PCR tests were used to exclude infectious anemia, avian leukemia and avian reticuloendotheliosis, and the disease was finally diagnosed as Marek's disease (MD).

[0042] Anticoagulated blood was collected aseptically from diseased live chickens, peripheral blood lymphocytes were extracted, and inoculated into pre-prepared CEF monolayer cells, blindly propagated for 1 to 2 generations, and when typical virus plaques appeared, single plaques were picked under a microscope for virus cloning, purification and PCR identification, and finally isolated and identified to obtain the HNSQ01 strain. After the 1-day-old SPF chicken animal challenge experiment and the MD vaccine immune challenge protection evaluation experiment, the pathogenic type of the strain was defined as the HV-MDV Chinese variant. The total DNA of HNSQ01-infected CEF cells was extracted and sent to Shanghai Paisonno Biotechnology Co., Ltd. for virus whole genome sequencing analysis. The final results showed that the full length of the viral genome of the HNSQ01 strain was 176043bp, and its nucleotide sequence was shown in SEQ ID NO.1.

[0043] Example 2: Construction and identification of SQ01ΔmeqΔM11 double gene deletion vaccine candidate strain

[0044] 1. HNSQ01 viral genome structure and meq and miR-M11 gene gRNA design

[0045] According to the HNSQ01 viral genome and its adjacent sequences of meq and miR-M11 genes, the primers meq-9F / meq-2R for PCR amplification of the meq gene and the primers Mid-5F / Mid-3R for amplification of the miR-M11 gene were designed using Primer Premier software; the gRNA sequences gRN / gRC targeting the conserved regions at the 5' and 3' ends of the meq gene and the gRNA sequences gR3 / gR6 targeting the conserved regions at the 5' and 3' ends of the miR-M11 gene were designed using Benchling online software; the meq gene and miR-M11 gene loci and the corresponding gRNA targets were as follows: Figure 1 shown.

[0046] 2. Construction and identification of the SQ01Δmeq single gene editing deletion strain

[0047] The gRNA oligo sequences (SEQ ID NO.2 to SEQ ID NO.5) targeting the 5' and 3' ends of the meq gene of the MDV-1 strain listed in Table 1 were artificially synthesized, renatured to form double strands, and then cloned into the pX459v2.0 plasmid, respectively, to construct gRNA expression plasmids pX459-meq-gRN and pX459-meq-gRC (abbreviated as gRN and gRC, respectively).

[0048] Table 1 gRNA oligo and PCR amplification primer sequences targeting meq gene

[0049] Oligo / Primer Name Sequence (5'-3') meq-gRN-F <![CDATA[ CACC GTCGACCCGAGAGAAAGATCG(SEQ ID NO.2)]]> meq-gRN-R <![CDATA[ AAAC CGATCTTTCTCTCGGGTCGAC(SEQ ID NO.3)]]> meq-gRC-F <![CDATA[ CACC GTACTCAGTCTACGGTCTGG(SEQ ID NO.4)]]> meq-gRC-R <![CDATA[ AAAC CCAGACCGTAGACTGAGTAC(SEQ ID NO.5)]]> meq-9F TGCTGGAATGTTAAGAATAAATTCCGCAC(SEQ ID NO.6) meq-2R TCAGGGGTCTCCCGTCACCTGGAAACCACCA(SEQ ID NO.7)

[0050] Note: The underline indicates the Bbs I restriction site.

[0051] According to Trans IT-X2 TM Dynamic Delivery System reagent instructions, the above gRNA expression plasmid gRN / gRC was co-transfected into a 24-well plate CEF monolayer cell, placed in a 38.5°C, 5% CO2 incubator for 24 hours, and the p25 parent strain HNSQ01 was taken out of liquid nitrogen, and the virus suspension was inoculated with a dose of 10,000 virus plaque forming units (PFU) / well to infect the cells. At the same time, CEFs that were not transfected with gRNA plasmids but inoculated with HNSQ01 were used as negative controls, and CEFs that were not transfected with gRNA plasmids and not inoculated with HNSQ01 were used as blank controls. 48 hours after infection, after trypsin digestion, the cells were suspended with 500 μL of culture medium, half of which was centrifuged to collect the cells, and total DNA was extracted. PCR detection was performed using meq-9F / meq-2R (SEQ ID NO.6 and SEQ ID NO.7) listed in Table 1 to analyze the editing effect of gRNA plasmids on the meq gene of HNSQ01 virus.

[0052] The PCR reaction system was: 10 μL of 2×EasyTaq PCR SuperMix, 0.5 μL of each 10 μM upstream and downstream primers, 1 μL of 100 ng / μL DNA template of the sample to be tested, and 8 μL of sterile ultrapure water.

[0053] The PCR reaction program was as follows: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1.5 min, for 30 cycles; extension at 72°C for 5 min; and insulation at 4°C until removal.

[0054] After the reaction was completed, 5 μL of PCR product was taken and analyzed and identified by 1% (w / v) agarose gel electrophoresis (150 V, 300 mA, 30 min).

[0055] The electrophoresis results showed that no bands were amplified in the CEF cell blank control group; only a 1121bp-sized wild-type band of the specific meq gene was amplified in the negative control group CEF samples infected with HNSQ01; and in addition to a 1121bp-sized wild-type band of the specific meq gene, a 196bp-sized small band of the expected gene editing was amplified in the CEF cell samples co-transfected with gRN / gRC plasmids and inoculated with HNSQ01 ( Figure 2 A).

[0056] The HNSQ01 infected CEF cell suspension (about 250 μL) samples confirmed by PCR amplification and sequencing to have undergone meq gene editing were transferred to 6-well plate CEF monolayer cells (5 μL / well, 10 μL / well, 20 μL / well, 40 μL / well) at different doses, and cultured in a 38.5°C, 5% CO2 incubator for 3-5 days. 72 virus single plaques were randomly picked under a microscope and transferred to 24-well plate CEF monolayer cell wells (1 / well), and the progeny virus continued to be cultured for 48 hours. After trypsin digestion, the cells were collected by centrifugation, and DNA was extracted and tested according to the above PCR method. The cell wells with positive PCR detection were cloned and purified in the second round of virus single plaques as above. After 2-3 rounds of cloning and purification, all virus clones were identified by PCR as being editing-positive. The virus was expanded and named SQ01Δmeq, and the seed was frozen in liquid nitrogen.

[0057] The SQ01Δmeq strain was continuously passaged on CEF, and the 1st, 2nd, 3rd, 4th, 5th, 10th and 15th generation virus samples were collected and PCR analysis was performed to detect the stability of the meq gene editing deletion. The results showed that in the SQ01Δmeq progeny virus samples of different generations from p1 to p15, only the mutant meq gene product with a size of 196 bp could be amplified using the meq-9F / meq-2R primers ( Figure 2 A), indicating that the meq gene editing of the SQ01Δmeq strain was stable and no reversion mutation occurred.

[0058] 3. Construction and identification of the SQ01ΔmeqΔM11 double gene editing strain

[0059] The gRNA oligo sequences targeting the 5' and 3' ends of the MDV-1 miR-M11 gene listed in Table 2 (SEQ ID NO.8 to SEQ ID NO.11) were artificially synthesized, renatured to form double strands, and then cloned into the pX459v2.0 plasmid, respectively, to construct gRNA expression plasmids pX459-meq-gR3 and pX459-meq-gR6 (abbreviated as gR3 and gR6, respectively).

[0060] Table 2 gRNA oligo and PCR amplification primer sequences targeting miR-M11 gene

[0061] Oligo / Primer Name Sequence (5'-3') miR-M11-gR3-F <![CDATA[ CACC TCTTCCGAGTCTAAGCTACA(SEQ ID NO.8)]]> miR-M11-gR3-R <![CDATA[ AAAC TGTAGCTTAGACTCGGAAGA(SEQ ID NO.9)]]> miR-M11-gR6-F <h2 style=";text-align:left;direction:ltr"><![CDATA[ <h2 style=";text-align:left;direction:ltr"> CACC <h2 style=";text-align:left;direction:ltr"> GATATGGACATCGCACATTA(SEQ ID NO.10)]]><h2 style=";text-align:left;direction:ltr"> miR-M11-gR6-R <![CDATA[ AAAC TAATGTGCGATGTCCATATC(SEQ ID NO.11)]]> Mid5F TCCGCATTGTGACTCTCAGCAG(SEQ ID NO.12) Mid3R ACATCGTAGAGAAAGCATAAGG(SEQ ID NO.13)

[0062] Note: The underline indicates the Bbs I restriction site.

[0063] According to Trans IT-X2 TM Dynamic Delivery System reagent instructions, gR3 / gR6 were co-transfected into CEF monolayer cells, and cultured in a 38.5°C, 5% CO2 incubator for 24 hours, and then inoculated with SQ01Δmeq strain to infect cells; at the same time, CEF cells that were not transfected with gRNA plasmids but infected with SQ01Δmeq were used as unedited negative controls, and CEF cells that were not transfected with gRNA plasmids and not infected with SQ01Δmeq were used as blank simulation controls. 48 hours after infection, cells were digested with trypsin, collected by centrifugation, and total DNA was extracted. PCR detection was performed using the miR-M11 gene-specific primers Mid5F / Mid3R (SEQ ID NO.12 and SEQ ID NO.13) listed in Table 2 to analyze the editing effect of the gRNA combination on the miR-M11 gene.

[0064] The PCR reaction system includes: 2×EasyTaq PCR SuperMix (+dye) 10 μL, 0.5 μL of 10 μM upstream and downstream primers, 1 μL of 10 ng / μL DNA template of the sample to be tested, and 7.5 μL of sterile ultrapure water.

[0065] The PCR reaction program was as follows: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, for 30 cycles; extension at 72°C for 5 min; and insulation at 4°C until removal.

[0066] After the reaction, 5 μL of PCR product was taken and analyzed and identified by 1% (w / v) agarose gel electrophoresis (150 V, 300 mA, 30 min).

[0067] The electrophoresis results showed that no bands were amplified in the blank control group of CEF cells; only a 1136bp-sized wild-type band of the specific miR-M11 gene was amplified in the negative control sample of CEF cells infected with SQ01Δmeq; in addition to the 1136bp-sized positive band of the specific miR-M11 gene, the expected gene editing small band of 841bp was amplified in the CEF cell sample co-transfected with gR3 / gR6 plasmids and infected with SQ01Δmeq ( Figure 2 B).

[0068] The cell samples confirmed by PCR amplification and sequencing to have undergone miR-M11 gene editing were cloned and purified according to the above SQ01Δmeq gene editing strain purification method. After 2 to 3 rounds of cloning and purification, PCR identification of miR-M11 gene editing positive virus plaques, sequencing analysis was performed again, and the culture was expanded and named SQ01ΔmeqΔM11, and the seed was frozen in liquid nitrogen.

[0069] The SQ01ΔmeqΔM11 strain was continuously passaged on CEF, and the 1st, 2nd, 3rd, 4th, 5th, 10th and 15th generation virus samples were collected and PCR analysis was performed to detect the stability of the miR-M11 gene editing deletion. The results showed that in the SQ01ΔmeqΔM11 progeny virus samples of different generations from p1 to p15, only the mutant miR-M11 gene product with a size of 841bp could be amplified using the Mid5F / Mid3R primers ( Figure 2 B), indicating that the miR-M11 gene editing of the SQ01ΔmeqΔM11 strain was stable and no reversion mutation occurred.

[0070] 4. Cloning and sequencing identification of the SQ01ΔmeqΔM11 gene-edited deletion strain

[0071] The 196 bp meq gene editing band and the 841 bp miR-M11 gene editing band of the SQ01ΔmeqΔM11 strain were recovered and purified by gel excision, and then connected to the pMD19-T vector for sequencing ( Figure 3 ) and compared with the meq gene and miR-M11 gene of the HNSQ01 parent strain ( Figure 4The results showed that the gRN / gRC plasmid and the gR3 / gR6 plasmid effectively edited the meq gene and the miR-M11 gene, respectively. The double-stranded nick (DSB) of the meq gene occurred precisely at the 3 bases inside the PAM sequence of gRN / gRC, and the resulting gene mutation was completely consistent with the expectation, that is, the 925 bp deletion fragment was edited at the 4486-5411th and 133584-134509th positions of the parental strain HNSQ01 genome, respectively; the double-stranded nick (DSB) of the miR-M11 gene occurred at the 4 bases inside the PAM sequence of gR3 / gR6, and the resulting gene mutation was completely consistent with the expectation, that is, the 295 bp deletion fragment was edited at the 3980-4275th and 134720-135015th positions of the parental strain HNSQ01 genome, respectively.

[0072] 5. RT-qPCR identification of SQ01ΔmeqΔM11 gene-edited deletion strain

[0073] HNSQ01 and SQ01ΔmeqΔM11 were inoculated into 6-well CEF monolayer cell plates, respectively, and cultured in a 38.5°C, 5% CO2 incubator for 3-5 days. After the appearance of virus plaques was observed under a microscope, the cells were digested with trypsin, collected by centrifugation, and total RNA was extracted using TRIzol reagent.

[0074] Utilize TaKaRa TM The total RNA was reverse transcribed to prepare cDNA using 5× PrimeScript RT Master Reverse Transcription Kit. The prepared cDNA was used as a template and the cDNA was purified by Fast Universal Green Master kit was used for qPCR amplification to measure the relative expression levels of the six MDV-encoded protein genes ICP4, meq, gB, pp38, RLORF4 and RLORF5a. The primers for the six MDV genes used for the determination are shown in Table 3 (SEQ ID NO.14 to SEQ ID NO.25). The results showed that: using ICP4 as an internal reference, it was found that in the virus-infected CEF cells, the above viral genes encoded by the parent strain HNSQ01 were all expressed normally; gB, pp38, RLORF4 and RLORF5a encoded by the double gene deletion strain SQ01ΔmeqΔM11 were also detected to be expressed normally, but the expression of the meq gene was not detected ( Figure 5 A) It was further confirmed that the meq gene was completely edited and deleted in the viral genome of SQ01ΔmeqΔM11.

[0075] Table 3 MDV gene RT-qPCR primer sequence list

[0076] Primer name Sequence (5'-3') yg-meq-F CGCAGGAAGCAGACGGACTA(SEQ ID NO.14) yg-meq-R CCATAGGGCAAACTGGCTCAT(SEQ ID NO.15) yg-gB-F TCTAGGGCATGGCACACGAC(SEQ ID NO.16) yg-gB-R GAATACGGAAACACAGAGCGG(SEQ ID NO.17) yg-pp38-F CCGAAAGACAAAACCCAAAT(SEQ ID NO.18) yg-pp38-R ATGTAACCAGCATATAAGAACGC(SEQ ID NO.19) yg-RLORF4-F TGCTTGTTTTGGGTAATTGGTC(SEQ ID NO.20) yg-RLORF4-R TACTGGAACACAAGACTATGAGGAC(SEQ ID NO.21) yg-RLORF5a-F AATAACCTCATCGCAGAGACGC(SEQ ID NO.22) yg-RLORF5a-R CTCGTTCCGTTCGCTCTTTC(SEQ ID NO.23) yg-ICP4-F GCACTGCATTCCGAGAGTCAT(SEQ ID NO.24) yg-ICP4-R TTGGGAATTTGGAGGGCG(SEQ ID NO.25)

[0077] Using TaqMan TM The total RNA was reverse transcribed with the MicroRNA Reverse Transcription Kit to prepare cDNA. The prepared cDNA was used as a template and Taqman probes and TaqMan TM Universal Master MixⅡ and MicroRNA Assays kit was used for qPCR amplification to measure the relative expression levels of six MDV-encoded miRNA genes, miR-M11-5p, miR-M11-3p, miR-M1-5p, miR-M4-5p, miR-M31-3p and miR-M13-3p. The results showed that with miR-M13-3p as the internal reference, the above miRNAs encoded by the parental strain HNSQ01 were all expressed normally in virus-infected CEF cells; miR-M31-3p, miR-M1-5p and miR-M4-5p encoded by the double gene deletion strain SQ01ΔmeqΔM11 were all expressed normally, but the expression of miR-M11-5p and miR-M11-3p was not detected ( Figure 5 B) further confirmed that the miR-M11 gene in the viral genome of SQ01ΔmeqΔM11 had also been completely edited and deleted.

[0078] 6. IFA identification of SQ01ΔmeqΔM11 gene-edited deletion strain

[0079] HNSQ01 and SQ01ΔmeqΔM11 were inoculated into CEF monolayers of 24-well plates, respectively, and cultured in a 38.5°C, 5% CO2 incubator for 3 days. The cells were fixed with precooled methanol / acetone (v:v=1:1) solution, 200 μL / well, at room temperature for 10 min; washed 3 times with PBST, blocked with PBST containing 5% (w / v) skim milk, 200 μL / well, at 37°C, 30 min; washed 3 times with PBST, incubated with 1:5000 diluted MDV-Meq monoclonal antibody (homemade), 100 μL / well, at 37°C, 30 min; washed 3 times with PBST, incubated with Dylight 594 goat anti-mouse IgG (1:1000) dilution, 100 μL / well, at 37°C, 30 min; washed 3 times with PBST, blocked with 1:1000 diluted Dylight Incubate with 488-labeled MDV-gB monoclonal antibody (homemade), 100 μL / well, 37°C, 30 min; finally wash 3 times with PBST and observe under a fluorescence microscope.

[0080] The results showed that both HNSQ01 and SQ01ΔmeqΔM11 infected CEF cells could form MDV virus plaques with similar morphology and could specifically bind to the green fluorescent labeled MDV-gB monoclonal antibody. The red fluorescent indicated MDV-Meq monoclonal antibody only bound to the virus plaques in HNSQ01 infected cells, while no specific red fluorescent stained virus plaques were observed in SQ01ΔmeqΔM11 infected cells. Figure 6 ), indicating that the meq gene of SQ01ΔmeqΔM11 has been completely edited and deleted, and Meq protein is no longer expressed.

[0081] In summary, the present invention uses the Marek's disease virus super-strong Chinese variant HNSQ01 as the parent strain, and uses the gene editing technology based on the CRISPR / Cas9 system to successfully construct the MDV vaccine candidate strain SQ01ΔmeqΔM11 with complete editing and deletion of the meq and miR-M11 double genes. The double-gene-deficient MDV vaccine candidate strain SQ01ΔmeqΔM11 has been deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration, with a deposit number of CGMCC NO.45874 and a deposit date of January 24, 2024.

[0082] Application Example 1: Immune protection evaluation test of SQ01ΔmeqΔM11 gene deletion vaccine candidate strain

[0083] 1. Virus titer determination of HNSQ01 and SQ01ΔmeqΔM11

[0084] The HNSQ01 and SQ01ΔmeqΔM11 virus seeds frozen in liquid nitrogen were revived and rapidly dissolved in a 37°C water bath. After centrifugation at 1000 r / min for 5 min, the cell freezing solution was discarded, and the cells were resuspended in 1 mL of M199 medium containing 1% (v / v) FBS (fetal bovine serum) and 10% (v / v) TPB (tryptone phosphate broth). After thorough mixing, 900 μL was aspirated and the two virus seeds were plated on a 24-well plate with M199 medium containing 1% (v / v) FBS and 10% (v / v) TPB at 24°C. -1 ~2 -12 Make serial dilutions; then -6 ~2 -12 The diluted virus solutions were transferred to CEF monolayer cells in a 48-well plate, 300 μL / well, and 3 replicates were performed for each dilution. The last column of cell wells was directly supplemented with M199 medium containing 1% (v / v) FBS and 10% (v / v) TPB as a negative control.

[0085] The cells were placed in a 38.5°C, 5% CO2 incubator for 3-4 days. After the typical virus plaques appeared under a microscope, three consecutive dilution wells with a moderate number of plaques (15-30 / well) were selected. Virus plaques were stained with MDV-pp38 monoclonal antibody and DyLight 488 goat anti-mouse IgG (1:1000) secondary antibody according to the IFA method described in Example 2. Finally, the virus plaques were counted under an inverted fluorescence microscope. The average number of virus plaques in the three replicate cell wells of each dilution was multiplied by the corresponding dilution multiple to calculate the virus titers of the two virus species HNSQ01 and SQ01ΔmeqΔM11, which were 1.53×10 4 PFU / 100 μL and 1.45×10 4 PFU / 100μL.

[0086] 2. SQ01ΔmeqΔM11 immune protection evaluation test plan

[0087] 82 1-day-old white Leghorn SPF chickens were randomly divided into 3 groups, the first group was a CEF+CEF negative cell simulation control group, the second group was a CEF+HNSQ01 challenge positive control group, and the third group was a SQ01ΔmeqΔM11+HNSQ01 immune protection challenge group. At 1 day old, all chickens were injected subcutaneously in the back of the neck, and the third group was vaccinated with the candidate vaccine strain SQ01ΔmeqΔM11 at a dose of 3000PFU / 200μL / chicken. At the same time, the first and second groups of chickens were inoculated with an equal amount of CEF cells and were raised in positive pressure chicken isolators. After 7 days of vaccine immunization, the experimental chickens in the second and third groups were intraperitoneally inoculated with HNSQ01 (1000PFU / 200μL / chicken), and the first group of negative cell simulation control group was intraperitoneally inoculated with an equal amount of CEF cells.

[0088] The above groups were separately raised in different positive pressure isolators, and the incidence and mortality of experimental chickens in each group were observed and recorded daily, and survival curves were drawn. Every week, 5 chickens (3 males and 2 females) were randomly taken from each group and weighed and recorded to observe growth. On the 14th and 21st days after the challenge, 5 chickens were weighed and recorded in each group, and then euthanized and immune organs such as thymus, bursa of Fabricius and spleen were collected, weighed and recorded, and the immune organ index was calculated. The immune organ index = [immune organ weight (g) / body weight (g)] × 100. At the same time, the dead chickens in each group were dissected in time throughout the experiment, and the occurrence of visceral organ tumors was observed with the naked eye. At the end of the 70d test period after the challenge, all experimental chickens that were still alive were euthanized, and the occurrence of visceral organ tumors in the chickens was observed and recorded. At the same time, 3 chickens were randomly taken from each experimental group to collect spleens, and tissue sections were prepared and HE staining was performed to observe tissue pathological changes.

[0089] 3. Results of body weight and immune organ index of chickens in the SQ01ΔmeqΔM11 immunization experiment

[0090] The weight and immune organ index of each group of experimental chickens at different time points after virus infection were statistically analyzed. The results showed that the statistical analysis results of the average weight of each group of chickens were as follows: Figure 7 As shown in A: From 7dpi to 70dpi, there were significant differences between the CEF+HNSQ01 challenge positive control group and the CEF+CEF negative cell simulation control group except for 21dpi, 28dpi and 63dpi at all other time points (P<0.05); there were also significant differences between the CEF+HNSQ01 challenge positive control group and the SQ01ΔmeqΔM11+HNSQ01 immune protection challenge group except for 21dpi and 70dpi at all other time points (P<0.05), while there were no significant differences between the SQ01ΔmeqΔM11+HNSQ01 immune protection challenge group and the CEF+CEF negative cell simulation control group at all 10 different time points in the entire experimental period (P>0.05). A comprehensive analysis of the body weight data throughout the entire animal experimental cycle showed that the effect of the SQ01ΔmeqΔM11+HNSQ01 immune protection challenge group on the weight gain of experimental chickens was significantly smaller than that of the CEF+HNSQ01 challenge positive control group, and there was no significant difference between the SQ01ΔmeqΔM11+HNSQ01 immune protection challenge group and the CEF+CEF negative cell simulation control group, indicating that SQ01ΔmeqΔM11 immunization significantly reduced the inhibitory effect of HNSQ01 challenge on the weight gain of experimental chickens.

[0091] The statistical results of the immune organ index of each group of experimental chickens are as follows: Figure 7 As shown in (B, C, D): at 14 dpi and 21 dpi, the bursal index, thymus index and spleen index of the CEF+HNSQ01 challenge positive control group were significantly different from those of the CEF+CEF negative cell simulation control group (P<0.05). Compared with the CEF+CEF negative cell simulation control group, the SQ01ΔmeqΔM11+HNSQ01 immune protection challenge group, except for the spleen index at 14 dpi, there were no significant differences in the bursal index and thymus index at the two detection time points (P>0.05). Compared with the CEF+HNSQ01 challenge positive control group and the SQ01ΔmeqΔM11+HNSQ01 immune protection challenge group, the bursal index, thymus index and spleen index at 14 dpi and 21 dpi were significantly different (P<0.05). These data indicate that challenge with HNSQ01 after immunization with SQ01ΔmeqΔM11 did not cause atrophy of the host's central immune organs (bursa of Fabricius and thymus).

[0092] 4. Analysis of the survival curve of chickens in the SQ01ΔmeqΔM11 immunization experiment

[0093] During the entire animal immunization and virus challenge experiment cycle, the early deaths of the experimental chickens in each group in the first week may be due to abdominal infection or other stressful situations, so these deaths were excluded and not included in the statistics. In addition, during the entire experimental cycle thereafter, the deaths of the experimental chickens in each group were observed and recorded daily, and the survival curves of the experimental chickens in each group were drawn. Figure 8 As shown: Until the end of the experiment 70 days after the challenge, no deaths were observed in the experimental chickens in the CEF+CEF negative cell simulation control group and the SQ01ΔmeqΔM11+HNSQ01 immune protection challenge group. One chicken died in the CEF+HNSQ01 challenge positive control group 1 week after the challenge, and then deaths occurred one after another 5 weeks after the challenge. Only 2 chickens survived 70 days after the challenge. The survival curve showed that the CEF+CEF negative cell simulation control group and the SQ01ΔmeqΔM11+HNSQ01 immune protection challenge group were significantly different from the CEF+HNSQ01 challenge positive control group (P<0.05).

[0094] 5. Analysis of tumor occurrence in chickens immunized with SQ01ΔmeqΔM11

[0095] During the entire animal immunization and challenge experiment period, the number of deaths of experimental chickens in each group was observed and recorded daily, and the chickens that died on the same day were promptly autopsied and the occurrence of visceral organ tumors was observed and recorded. At the end of the experiment 70 days after the challenge, the surviving chickens in each group were euthanized and autopsied, and the occurrence of visceral organ tumors was observed and recorded. The final statistical analysis results are shown in Table 4: By the end of the animal experiment 70 days after the virus attack, there was no death in the CEF+CEF negative cell simulation control group and the SQ01ΔmeqΔM11+HNSQ01 immune protection virus attack group, and no visceral tumors observable to the naked eye were found in all surviving chickens at autopsy, and the tumor incidence rate was 0%; while the tumor incidence rate of dead chickens in the CEF+HNSQ01 virus attack positive control group was 73.3%, the tumor incidence rate of surviving chickens was 100%, and the comprehensive tumor incidence rate of all experimental chickens was 76.5%; the tumor incidence rate of the SQ01ΔmeqΔM11+HNSQ01 immune protection virus attack group was significantly lower than that of the CEF+HNSQ01 virus attack positive control group (P<0.05).

[0096] Table 4 Statistical table of MD tumor incidence in chickens challenged with SQ01ΔmeqΔM11

[0097]

[0098] 6. Analysis of morbidity, mortality and immune protection index in chickens challenged with SQ01ΔmeqΔM11

[0099] The MD incidence, mortality and immune protection index (PI) of each group of experimental chickens were compared. The results are shown in Table 5: As of the end of the animal experiment 70 days after the challenge, the MD incidence and mortality of the CEF+CEF negative cell simulation control group were both 0%; the MD incidence and mortality of the CEF+HNSQ01 challenge positive control group were 100% and 88.2%, respectively; the MD incidence and mortality of the SQ01ΔmeqΔM11+HNSQ01 immune protection challenge group were 5.6% and 0%, respectively, which were significantly lower than those of the CEF+HNSQ01 challenge positive control group (P<0.05). The final calculated immune protection index (PI) of SQ01ΔmeqΔM11 immunization against HNSQ01 was 94.4%.

[0100] Table 5 Statistics of MD incidence, mortality and immune protection index of chickens challenged with SQ01ΔmeqΔM11

[0101]

[0102] 7. Results of histopathological changes in chickens challenged with SQ01ΔmeqΔM11

[0103] At the end of the experiment, in addition to visually observing the tumor occurrence of the chickens in the experimental group, spleens of three chickens were randomly selected from each group to prepare tissue sections and perform HE staining. The results are as follows: Fig. 9 As shown: the spleen tissue structure of the three chickens in the CEF+CEF negative cell simulation control group was normal; the spleen tissue of the three chickens in the CEF+HNSQ01 positive challenge control group showed varying degrees of lymphocyte infiltration, the spleen cells lost their original cell morphology, the cell nuclei were enlarged and multipolarized; and no obvious lymphocyte infiltration and other pathological phenomena were observed in the spleens of the three chickens in the SQ01ΔmeqΔM11+HNSQ01 immune protection challenge group.

[0104] In summary, the present invention successfully constructed a vaccine candidate strain SQ01ΔmeqΔM11 with double gene editing deletion of Marek's disease virus meq and miR-M11 based on HV-MDV Chinese variant HNSQ01 and CRISPR / Cas9 gene editing technology. As a MD candidate vaccine strain, the animal immune attack protection evaluation experiment of the strain showed a very good immune protection effect, and its immune protection index (PI) for the currently popular HV-MDV Chinese variant HNSQ01 attack challenge was as high as 94.4%, exceeding the MD vaccine new veterinary drug registration requirement of PI index reaching 75% or more, and has very good vaccine candidate strain potential and market application prospects. Therefore, the SQ01ΔmeqΔM11 strain constructed by the present invention can be used as a new MDV gene deletion vaccine candidate strain for the subsequent development and utilization of new and efficient MD genetic engineering vaccines.

[0105] Taking SQ01ΔmeqΔM11 as the parent strain, the above-mentioned technical route and method can also be used to construct a series of MDV vaccine strains with multiple MDV gene deletions, or even genetically engineered recombinant vaccines expressing other poultry disease antigen genes, to create a new generation of highly effective MD vaccines, which are not listed one by one in the present invention.

[0106] SEQ ID NO.1

[0107] The complete genome sequence of HNSQ01 is 176043 bp

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137]

[0138]

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149]

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

Claims

1. A Marek's disease virus meq and miR-M11 double gene editing deletion vaccine candidate strain SQ01ΔmeqΔM11, It is characterized in that The candidate strain of the Marek's disease virus meq and miR-M11 double gene editing deletion vaccine is SQ01ΔmeqΔM11, which has been deposited in the General Microbiology Center of the China Culture Collection Administration, with the deposit number CGMCCNO.45874.

2. The Marek's disease virus meq and miR-M11 double gene editing deletion vaccine candidate strain SQ01ΔmeqΔM11 according to claim 1, It is characterized in that The parent strain of the vaccine candidate strain SQ01ΔmeqΔM11 is the extremely strong variant strain HNSQ01 of Marek's disease virus isolated from Chinese chickens. The full genome nucleotide sequence of the parent strain is 176043 bp in length, as shown in SEQ ID NO.

1.

3. The Marek's disease virus meq and miR-M11 double gene editing deletion vaccine candidate strain SQ01ΔmeqΔM11 according to claim 1, It is characterized in that The vaccine candidate strain SQ01ΔmeqΔM11 is based on the Marek's disease virus super-strong Chinese variant HNSQ01 as the parent strain. The two meq alleles in its genome are edited to delete a fragment with the same length of 925bp, and the molecular marker sites of the gene deletion are: 4486-5411 and 133584-134509 respectively; on this basis, the two miR-M11 alleles in the genome are edited to delete a fragment with the same length of 295bp, and the molecular marker sites of the gene deletion are: 3980-4275 and 134720-135015 respectively.

4. A method for constructing the Marek's disease virus meq and miR-M11 double gene editing deletion vaccine candidate strain SQ01ΔmeqΔM11 according to claim 3, It is characterized in that Using CRISPR / Cas9 gene editing technology, the two meq alleles were first knocked out, and then the two miR-M11 alleles were knocked out.

5. Use of the Marek's disease virus meq and miR-M11 double gene editing deletion vaccine candidate strain SQ01ΔmeqΔM11 described in claim 1 in the preparation of a new and highly effective vaccine for Marek's disease in chickens.

6. The use according to claim 5, It is characterized in that The novel and highly effective vaccine for Marek's disease in chickens is a genetically engineered Marek's disease vaccine, a combined Marek's disease vaccine or a multivalent Marek's disease vaccine constructed with SQ01ΔmeqΔM11 as the vaccine strain; or a genetically engineered Marek's disease vaccine, a combined Marek's disease vaccine or a multivalent Marek's disease vaccine constructed with SQ01ΔmeqΔM11 as the parent strain.

7. The use according to claim 6, It is characterized in that The chicken Marek's disease genetic engineering vaccine is a gene deletion, gene recombination or virus vector vaccine.

8. The use according to claim 5, It is characterized in that The application includes but is not limited to utilizing the virus particles, viral nucleic acid DNA and whole genome sequence information of the Marek's disease virus meq and miR-M11 double gene editing deletion vaccine candidate strain SQ01ΔmeqΔM11.

Images