Beta-glucosidase mutant D126T with improved activity and salt tolerance and application of beta-glucosidase mutant D126T

Abstract

The invention discloses a beta-glucosidase mutant D126T with improved activity and salt tolerance, the amino acid sequence of the mutant is shown as SEQ ID NO.1, and compared with a recombinant wild enzyme with the amino acid sequence shown as SEQ ID NO.3, the activity of the mutant in metal salts with low concentrations of 10.0 mM and 50.0 mM and the enzyme activity in NaCl and KCl with the concentrations of 0.1 M-3. 0 M are improved. The activity of the mutant can be activated to different degrees by low-concentration metal salt, NaCl and KCl, the enzyme specific activity of the mutant D126T is improved to 93.5 U / mg under the optimal NaCl condition of 0.5 M, and compared with a control group without salt, the specific activity is improved by about 4.3 times; and the enzyme specific activity of the mutant is obviously improved compared with that of a wild enzyme. The D126T can have better applicability in the biotechnology field of a salt-containing environment.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a beta-glucosidase mutant with improved activity and salt tolerance, and a preparation method and application thereof. Background Art

[0002] Cellulose is the main component of plant cell walls and is an abundant renewable resource in nature. Its utilization is of great significance. Cellulose is hydrolyzed into monosaccharides and oligosaccharides by cellulase under certain conditions. Monosaccharides can be fermented by microorganisms to produce various products, such as feed, fuel, chemical raw materials, food, and medicine. Cellulase is a general term for a group of enzymes that degrade cellulose to produce glucose. It is not a monomeric enzyme, but a multi-component enzyme system that works synergistically. It is a complex enzyme mainly composed of exo-β-glucanase, endo-β-glucanase, and β-glucosidase (β-D-Glucosidase, EC3.2.1.21). β-Glucosidase is a key member of cellulose hydrolysis monosaccharides, which can hydrolyze the β-D-glycosidic bond bound to the terminal non-reducing bond to release glucose.

[0003] Among the cellulase components, the low content and low activity of β-glucosidase have become the bottleneck of cellulose enzymatic hydrolysis. At present, β-glucosidase has been developed and utilized to a great extent, but there is still a lack of some high-quality and efficient β-glucosidase, or to reduce the production cost of enzymes. Therefore, it is of great significance to construct engineered bacteria through genetic recombination technology to secrete and express highly active β-glucosidase for the effective degradation of cellulose.

[0004] Highly active enzymes have faster catalytic rates. Salt is widely present in nature and various production practices, including food pickling and leather making. In the process of food and seafood processing, the use of salt-tolerant enzymes can improve the quality of processed products; sodium chloride has a good preservative effect and can inhibit the growth of bacteria and microorganisms in the production process to prevent product contamination, but the environment where salt exists will inhibit the activity and conversion efficiency of enzymes, such as food processing and preservation, sewage treatment, feed and medicine in salty environments. Therefore, highly active salt-tolerant enzymes can be better used in high-salt environments, which can greatly save costs and improve production efficiency. Summary of the invention

[0005] The purpose of the present invention is to provide a β-glucosidase mutant D126T with improved activity and salt tolerance, improve the physicochemical properties of existing β-glucosidase, enrich the β-glucosidase resource library, and have application value in the actual use of β-glucosidase.

[0006] In order to achieve the above object, the present invention provides a β-glucosidase mutant D126T, wherein the mutant D126T has an amino acid sequence as shown in SEQ ID NO.1.

[0007] The present invention also provides a gene encoding a β-glucosidase mutant D126T, wherein the gene encoding D126T has a nucleotide sequence as shown in SEQ ID NO.2.

[0008] The present invention also provides a recombinant expression vector comprising the above-mentioned coding gene D126T, wherein the recombinant expression vector is selected from a prokaryotic expression vector, preferably pET-28a(+).

[0009] The present invention also provides a recombinant expression bacterium comprising the coding gene D126T, wherein the recombinant expression bacterium is selected from Escherichia coli, preferably BL21 (DE3).

[0010] Another object of the present invention is to provide a β-glucosidase mutant D126T with improved activity and salt tolerance for use in the fields of food, feed, sewage treatment, leather making and medicine.

[0011] The β-glucosidase mutant D126T with improved activity and salt tolerance provided by the present invention solves the problems of low specific activity and poor salt tolerance of wild enzymes, and has the following advantages:

[0012] The present invention provides a beta-glucosidase mutant with improved activity and salt tolerance. Compared with the wild enzyme, the activity and salt tolerance of the mutant D126T of the present invention are improved. The optimum pH of the purified wild enzyme BglPcC1 and the mutant enzyme D126T are 4.5 and 5.0, respectively, and the optimum temperature is 45°C and 37°C, respectively. In a normal reaction system without adding salt, the enzyme activity of mutant D126T was 8U / mg higher than that of wild enzyme BglPcC1, which was 1.8 times higher than that of wild enzyme BglPcC1. In 10.0mM and 50.0mM MnCl2, MgCl2, LiCl, CaCl2, BaCl2, ZnCl2, MgSO4, CoSO4, and NiSO4 metal salts, the enzyme activity of mutant D126T was 0.6-36U / mg and 0.8-42U / mg higher than that of wild enzyme BglPcC1, respectively. In the optimum NaCl of 0.5M, the enzyme activity of mutant D126T reached 93.5U / mg, which is about 70U / mg higher than the wild enzyme, and 3.7 times that of the wild enzyme BglPcC1; in 0.7M-3M medium and high concentration NaCl, the mutant D126T enzyme specific activity is 21-61U / mg higher than the wild enzyme BglPcC1; in 0.5M optimal KCl, the mutant D126T enzyme specific activity reaches 81.5U / mg, which is about 51U / mg higher than the wild enzyme, and 2.6 times that of the wild enzyme BglPcC1; in 0.7M-3M medium and high concentration KCl, the mutant D126T enzyme specific activity is 14-48U / mg higher than the wild enzyme BglPcC1. The mutant β-glucosidase D126T of the present invention can be applied to food processing and feed additives, sewage treatment, leather making and pharmaceutical production in saline environments and other biotechnology fields, which can reduce pollution to a certain extent, reduce costs and improve production efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The SDS-PAGE analysis results of the recombinant wild enzyme BglPcC1 and the mutant D126T in the present invention.

[0014] Figure 2 These are the activity measurement results of the recombinant wild enzyme BglPcC1 and the mutant D126T in the present invention at different pH values.

[0015] Figure 3 These are the stability test results of the recombinant wild enzyme BglPcC1 and the mutant D126T in the present invention at different pH values.

[0016] Figure 4 The thermal activity test results of the recombinant wild enzyme BglPcC1 and the mutant D126T in the present invention are shown.

[0017] Figure 5The results of stability test of the recombinant wild enzyme BglPcC1 and mutant D126T at 25°C in the present invention are shown.

[0018] Figure 6 The results of the activity determination of the recombinant wild enzyme BglPcC1 and the mutant D126T in NaCl in the present invention are shown.

[0019] Figure 7 The results of the activity determination of the recombinant wild enzyme BglPcC1 and the mutant D126T in KCl in the present invention are shown. DETAILED DESCRIPTION

[0020] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0021] The materials and reagents used in the experiment of the present invention are as follows:

[0022] 1) Strains and vectors: Escherichia coli BL21 (DE3) was purchased from Beijing Biomed Gene Technology Co., Ltd.; pET-28a (+) expression vector was from Jiangsu Suzhou Hongxun Biotechnology Co., Ltd.

[0023] 2) Enzymes and other biochemical reagents: p-nitrophenyl-β-D-pyranoglucoside (pNPG) was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; Nickel-NTA protein purification resin was purchased from QIAGEN; QuickMutation TM The gene site-directed mutagenesis kit was purchased from Beyotime Biotechnology Co., Ltd.; Dpn1 digestive enzyme was purchased from Beyotime Biotechnology Co., Ltd.; the others were domestic reagents (all of which can be purchased from ordinary biochemical reagent companies).

[0024] 3) Culture medium: LB culture medium: Peptone 10g, Yeast extract 5g, NaCl 110g, add distilled water to 1000mL, pH natural (about 7); solid culture medium plus 2.0% (w / v) agar on this basis.

[0025] Note: The molecular biology experimental methods not specifically described in the following examples are all carried out with reference to the specific methods listed in the book Molecular Cloning Experiment Guide (3rd Edition) by J. Sambrook, or according to the kit and product instructions. The experimental methods involved are conventional methods unless otherwise specified, and the materials and reagents used are all commercially available unless otherwise specified.

[0026] Experimental Example 1 Construction and transformation of mutant D126T expression vector

[0027] 1) According to the wild enzyme BglPcC1 (patent number: ZL202310198967.4) mined and screened from the human feces metagenome, the amino acid sequence of the enzyme is shown in SEQ ID NO.3, which is the signal peptide sequence of the first 21 amino acids at the N-terminus removed, but the methionine at the N-terminus is retained. The amino acid sequence of the signal peptide sequence is shown in SEQ ID NO.5. The coding gene of the β-glucosidase BglPcC1 is bglPcC1-opt, and its nucleotide sequence is shown in SEQ ID NO.4. According to the conventional cloning construction method, bglPcC1-opt is constructed into the pET-28a(+) vector to obtain the recombinant plasmid pET-28a-bglPcC1-opt. After verification, the successfully constructed plasmid is transferred into Escherichia coli DH5α for glycerol storage.

[0028] 2) The glycerol bacteria containing the recombinant plasmid pET-28a-bglPcC1-opt were inoculated into LB medium (containing kanamycin at a final concentration of 50 μg / mL) at 0.1%, cultured overnight at 37°C, and the recombinant plasmid was extracted using a kit.

[0029] 3) Two mutation primers (F1 and R1) were designed by DNAMAN. The mutation primers used the sequence of the coding gene bglPcC1-opt as a template and could mutate the aspartic acid at the 126th amino acid encoded by the coding gene to threonine. The sequences of the mutation primers are as follows:

[0030] The mutation primer sequences are as follows (5'→3'):

[0031] F1 (SEQ ID NO.6):

[0032] AAACATTATGGCGTGACTGTGCTGCT

[0033] R1 (SEQ ID NO.7):

[0034] AGCACAGTCACGCCATAATGTTTCACTT

[0035] 4)Use QuickMutation TMThe gene site-directed mutagenesis kit uses the recombinant plasmid pET-28a-bglPcC1-opt as a template and F1 and R1 as mutation primers for PCR amplification and mutation. The PCR reaction parameters are: 95°C pre-denaturation for 3min; then 95°C denaturation for 30sec, 60°C annealing for 30sec, 68°C extension for 8min, 20 cycles; 68°C extension and complementation for 15min; 4°C temporary storage for 30min. PCR amplification obtains a linearized recombinant plasmid d126t-pET-28a containing a coding gene (denoted as d126t) with a nucleotide sequence as shown in SEQ ID NO.2, d126t encodes a mutant D126T, and the amino acid sequence of the mutant D126T is shown in SEQ ID NO.1. Among them, the coding gene d126t and d126t-pET-28a can also be obtained by gene synthesis. The PCR product was digested with Dpn1 enzyme. 10 μL of PCR product was added with 1 μL Dpn1 enzyme and digested at 37°C for 3 h.

[0036] 5) The digestion product was transferred into Escherichia coli BL21 (DE3) by heat shock to obtain the recombinant bacterium d126t-BL21 containing the gene d126t encoding the mutant enzyme D126T, and the recombinant bacterium bglPcC1-opt-BL21 containing the gene bglPcC1-opt was constructed.

[0037] Experimental Example 2 Preparation of recombinant wild β-glucosidase BglPcC1 and mutant D126T

[0038] 1) The two recombinant bacteria obtained in Experimental Example 1 were inoculated into LB culture medium (containing kanamycin at a final concentration of 50 μg / mL) at an inoculum size of 0.1%, and activated by shaking in a shaker at 37° C. and 180 rpm / min for 16 h.

[0039] 2) The activated bacterial solution in 1) was inoculated into fresh LB culture medium (containing kanamycin at a final concentration of 50 μg / mL) at a 1% inoculum volume, and cultured in a shaking incubator at 37°C and 180 rpm / min for about 2 to 3 h (OD 600 After reaching 0.6-1.0), IPTG with a final concentration of 0.7 mM was added for induction, and shaking culture was continued in a shaker at 20°C and 160 rpm / min for about 20 h to induce the production of recombinant protein.

[0040] 3) The cultured bacterial solution was centrifuged at 4°C and 6000rpm / min for 8min to collect the bacterial cells. After suspending the bacterial cells with an appropriate amount of McIlvaine buffer at pH=7.0, the bacterial cells were ultrasonically disrupted in a low-temperature water bath. After the above intracellular concentrated crude enzyme solution was centrifuged at 12000rpm / min for 10min, the supernatant was aspirated and the target protein was affinity purified using Nickel-NTA Agarose and 0-500mM imidazole respectively. The purified target protein was subjected to SDS electrophoresis to obtain the SDS-PAGE results of the two purified proteins as shown below. Figure 1 As shown, M is a protein marker, BglPcC1 is a wild enzyme, and D126T is a mutant. The results show that the recombinant wild enzyme BglPcC1 and the mutant D126T were expressed and purified, and the product was a single target band.

[0041] 4) Add the protein sample solution obtained by the above purification to the dialysis device (volume ratio of enzyme solution: McIlvaine buffer with pH = 7.0 is 1:100). First, cut the dialysis bag (MV: 14000) into small pieces of appropriate length (10-20cm), boil it in boiling water for 30 minutes, and then wash it thoroughly with distilled water. Put the purified recombinant wild enzyme BglPcC1 and mutant D126T obtained in 3) into the dialysis bag respectively, and clamp the two ends of the dialysis bag with 3-5cm of length reserved by dialysis clips. Place the dialyzed sample in the dialysis buffer and dialyze it at 4℃. Change the dialysis solution every 2 hours, and change it 3 times.

[0042] Experimental Example 3 Determination of properties of the recombinant wild enzyme BglPcC1 and mutant D126T

[0043] 1) Activity analysis of purified recombinant wild-type enzyme BglPcC1 and mutant D126T

[0044] The activity determination method adopts the p-nitrophenol (pNP) method: p-nitrophenyl-β-D-pyranoglucoside (pNPG) is used as a substrate to determine the activity of the recombinant wild enzyme BglPcC1 and the mutant D126T. pNPG is dissolved in a buffer solution to a final concentration of 5mM; the reaction system contains 10μL enzyme solution and 290μL substrate-containing buffer solution; the substrate is preheated at the reaction temperature for 5min, the enzyme solution is added, and the reaction is continued for another 10min, and then 300μL 1mol / L Na2CO3 is added to terminate the reaction, and the OD value is measured at a wavelength of 410nm after cooling to room temperature; 1 enzyme activity unit (U) is defined as the amount of enzyme required to decompose the substrate to produce 1μmol pNP per minute.

[0045] Determination method of enzyme specific activity: The calculation formula of enzyme activity (A) and enzyme specific activity (B) is as follows:

[0046] A(U / mL)=c×N / (t×V)

[0047] B(U / mg)=A / C

[0048] Wherein: c is the amount of p-nitrophenol after the enzyme reaction calculated by the p-nitrophenol standard equation (μmol); N is the enzyme solution dilution factor; t is the reaction time of the enzyme and the substrate (min); V is the volume of the enzyme solution involved in the reaction (mL); C is the protein mass concentration (mg / mL, the protein mass concentration is measured using the Yazyme BCA protein quantification kit).

[0049] 2) Activity determination of recombinant wild-type enzyme BglPcC1 and mutant D126T at different pH

[0050] The purified enzyme in Experimental Example 2 was placed in a pH = 2.5-10.0 buffer (McIlvaine buffer pH = 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 7.0, 8.0; Glycine-NaOH Buffer pH = 9.0, 10.0), and the enzymatic reaction was carried out at 37°C to determine the enzyme activities of the recombinant wild enzyme BglPcC1 and the mutant D126T.

[0051] The results of the activity assays of the recombinant wild-type enzyme BglPcC1 and mutant D126T at different pH values ​​were obtained as follows: Figure 2 As shown, the results showed that compared with the recombinant wild enzyme BglPcC1, the optimal pH value of the recombinant mutant D126T shifted to the alkaline region by 0.5 units. The optimal pH of the recombinant wild enzyme BglPcC1 was 4.5, and the optimal pH of the recombinant mutant D126T was 5.0. The enzyme activity was maintained at more than 60% in the range of pH = 3.5 to 6.0.

[0052] 3) Determination of the stability of the recombinant wild enzyme BglPcC1 and the mutant D126T at different pH The purified enzyme in Experimental Example 3 was placed in a pH = 2.5-10.0 buffer (McIlvaine buffer pH = 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 7.0, 8.0; Glycine-NaOH Buffer pH = 9.0, pH 10) and treated at 30°C for 60 min. According to the enzyme activity determination method, the enzymatic reaction was carried out at the corresponding optimal pH (pH 4.5 or pH 5.0) and 37°C, with pNPG as the substrate, and the reaction was carried out for 10 min to determine the enzyme activity of the recombinant wild enzyme BglPcC1 and the mutant D126T.

[0053] The results of stability test of recombinant wild enzyme BglPcC1 and mutant D126T at different pH are shown in Figure 3As shown, the results showed that the recombinant wild enzyme BglPcC1 was relatively stable at pH = 5.0-8.0, and the residual enzyme activity could be maintained at more than 75%; the mutant D126T was relatively stable at pH 5.5-8.0, and the residual enzyme activity could be maintained at more than 60%.

[0054] 4) Thermal activity assay of the recombinant wild-type enzyme BglPcC1 and its mutant D126T

[0055] The reaction system was prepared so that the recombinant wild enzyme and the mutant were in the optimal pH system, and the enzymatic reaction was carried out at 10, 20, 30, 37, 40, 45, 50, and 60° C. pNPG was used as a substrate, and the reaction lasted for 10 min to determine the enzyme activity of the recombinant wild enzyme BglPcC1 and the mutant D126T.

[0056] The results of thermal activity determination of recombinant wild enzyme BglPcC1 and mutant D126T were obtained as follows Figure 4 As shown, the results showed that compared with the recombinant wild enzyme BglPcC1, the optimal temperature of the mutant D126T dropped to 37°C, and the mutant D126T still had 22.28% enzyme activity at 10°C; the optimal temperature of the wild enzyme BglPcC1 was 45°C, and both the wild enzyme and the mutant enzyme were inactivated at 60°C.

[0057] 5) Thermal stability determination of recombinant wild-type enzyme BglPcC1 and mutant D126T

[0058] Two enzyme solutions with the same enzyme amount were placed at 25°C for 60 minutes, and the enzymatic reaction was carried out at their optimal pH (pH = 4.5 and pH = 5.0) and 37°C, and the enzyme activity was measured every 10 minutes, with the untreated enzyme solution as a control. pNPG was used as a substrate, and the reaction was carried out for 10 minutes to measure the remaining enzyme activity of the recombinant wild enzyme BglPcC1 and the mutant D126T.

[0059] The results of the thermal stability test of the recombinant wild enzyme BglPcC1 and the mutant D126T after treatment at 25°C were as follows: Figure 5 As shown, the results showed that after treatment at 25°C for 60 minutes, the purified recombinant wild enzyme BglPcC1 and mutant D126T maintained more than 80% of the enzyme activity. When treated for 10-30 minutes, the enzyme activity was improved compared to that of the untreated state, and the enzyme activity reached the highest level when treated for 20 minutes.

[0060] 6) Activity determination of recombinant wild-type enzyme BglPcC1 and mutant D126T in NaCl

[0061] 0.1M~3M (0.1, 0.3, 0.5, 0.7, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0 mol / L, respectively) of NaCl was added to the enzymatic reaction system of the two enzymes. The enzymatic reaction was carried out at their optimal pH and 37°C with pNPG as substrate for 10 min. The effects of different concentrations of NaCl (0.1M~3.0M) on the enzyme activity of the purified recombinant wild enzyme BglPcC1 and mutant D126T were determined.

[0062] The results of the activity assay of the recombinant wild-type enzyme BglPcC1 and the mutant D126T in NaCl were obtained as follows: Figure 6 As shown, the results show that the specific activities of the recombinant wild enzyme BglPcC1 and the mutant D126T are improved to varying degrees when 0.1M to 3M NaCl is added to the reaction system, and the activity of the mutant D126T is higher than that of the wild enzyme BglPcC1. When there is no NaCl in the reaction system, the specific activities of the wild enzyme BglPcC1 and the mutant D126T are 9.8U / mg and 17.8U / mg, respectively. After adding 0.1M to 3M NaCl to the reaction system, the specific activity of the wild enzyme BglPcC1 is improved and the maximum specific activity is 25.4U / mg in 0.5M NaCl; and the specific activity of the mutant enzyme D126T is increased from 17.8U / mg to 93.5U / mg after adding 0.5M NaCl, which is about 4.3 times higher than that without salt. In 0.7M ~ 3.0M NaCl, the wild enzyme BglPcC1 had specific activities of 22.4U / mg, 20.3U / mg, 20.6U / mg, 16.6U / mg, 12.9U / mg, 9.4U / mg and 7.3U / mg, respectively; the mutant D126T maintained a higher specific activity in 0.7M ~ 3.0M NaCl, with specific activities of 83.3U / mg, 80.1U / mg, 70.5U / mg, 64.9U / mg, 49.8U / mg, 37.9U / mg and 28.1U / mg, respectively. Compared with the wild enzyme BglPcC1, the specific activity was increased by 21 to 61U / mg.

[0063] 7) Activity determination of recombinant wild-type enzyme BglPcC1 and mutant D126T in KCl

[0064] 0.1M~3M (0.1, 0.3, 0.5, 0.7, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0 mol / L, respectively) of NaCl was added to the enzymatic reaction system of the two enzymes. The enzymatic reaction was carried out at their optimal pH and 37°C with pNPG as substrate for 10 min. The effects of different concentrations of KCl from 0.1M to 3.0M on the enzyme activity of the purified recombinant wild enzyme BglPcC1 and mutant D126T were determined.

[0065] The results of the activity assay of the recombinant wild-type enzyme BglPcC1 and mutant D126T in KCl were obtained as follows: Figure 7 As shown, the results show that the specific activities of the recombinant wild enzyme BglPcC1 and the mutant D126T are improved to varying degrees when 0.1M to 3M KCl is added to the reaction system, and the activity of the mutant D126T is higher than that of the wild enzyme BglPcC1. When 0.1M to 3M KCl is added to the reaction system, the specific activity of the wild enzyme BglPcC1 is improved and the maximum specific activity is 31.0U / mg in 0.5M KCl; and the specific activity of the mutant enzyme D126T is increased from 17.8U / mg to 81.5U / mg after adding 0.5M KCl, which is about 3.6 times higher than that without salt. In 0.7M ~ 3.0M NaCl, the wild enzyme BglPcC1 had specific activities of 28.4U / mg, 27.2U / mg, 25.5U / mg, 20.9U / mg, 16.4U / mg, 14.1U / mg and 11.2U / mg, respectively; while the mutant D126T maintained a higher specific activity in 0.7M ~ 3.0M NaCl, with specific activities of 76.0U / mg, 68.7U / mg, 67.0U / mg, 53.4U / mg, 48.2U / mg, 36.3U / mg and 25.2U / mg, respectively. Compared with the wild enzyme BglPcC1, the specific activity was increased by 14 to 48U / mg.

[0066] 8) Activity determination of recombinant wild-type enzyme BglPcC1 and mutant D126T in different metal salts

[0067] 10.0 mM and 50.0 mM of MnCl2, MgCl2, LiCl, CaCl2, BaCl2, ZnCl2, MgSO4, CoSO4, NiSO4, AgNO3, and Pb(NO3)2 were added to the enzymatic reaction systems of the two enzymes, respectively. The enzymatic reactions were carried out with pNPG as substrate at their optimal pH and 37°C for 10 min, and the effects of low concentrations of metal salts on the enzyme activities of the purified recombinant wild enzyme BglPcC1 and mutant D126T were determined.

[0068] The activity test results of the recombinant wild enzyme BglPcC1 and mutant D126T in different metal salts at low concentrations are shown in Table 1 below. The results show that 10.0mM and 50.0mM AgNO3 and Pb(NO3)2 completely inhibited the enzyme activities of BglPcC1 and D126T; in the other 10.0mM and 50.0mM metal ions tested, the enzyme specific activity of the mutant D126T was higher than that of the wild enzyme BglPcC1, which were increased by 0.6~36U / mg and 0.8~42U / mg respectively.

[0069] Table 1 Effects of different metal ions on the enzyme activity of mutant D126T and recombinant wild enzyme BglPcC1

[0070]

[0071] In summary, the β-glucosidase mutant D126T with improved activity and salt tolerance provided by the present invention has an optimum pH of 5.0 and an optimum temperature of 37°C, and its activity can be activated by low concentrations of MgCl2, LiCl, CaCl2, BaCl2, MgSO4 and 0.1M to 0.3M NaCl and KCl, thereby increasing the enzyme specific activity. In a normal salt-free reaction system, the specific activity of the mutant is 1.8 times that of the wild enzyme; after adding NaCl and KCl, the enzyme specific activity of the mutant is increased, and at a concentration of 0.5M, the maximum specific activity is 93.5U / mg and 81.5U / mg, respectively, which is 4.3 and 3.6 times higher than that of the salt-free control group, and 2.7 and 1.6 times higher than that of the wild enzyme containing the same concentrations of NaCl and KCl, respectively; in medium and high concentrations of 0.7M to 3.0M NaCl and KCl, the enzyme specific activity of the mutant D126T is higher than that of the wild enzyme. The mutant characteristics make it possible to increase or control the reaction rate of the enzyme in practical applications by adjusting the concentration of added salt, which is beneficial to accelerate or regulate enzymatic reactions and is more convenient for practical applications, especially in food processing and preservation, sewage treatment, feed and medicine in salty environments. The increase in enzyme activity can promote food processing efficiency, sewage treatment efficiency, etc., and has specific and significant practical application value.

[0072] The present invention provides a β-glucosidase mutant D126T with increased specific activity and improved salt tolerance, which is more efficient in practical applications, and the high specific activity can reduce enzyme dosage and reduce costs to a great extent, thus providing an effective guarantee for improving efficiency in the production of food, brewing, feed, medicine, and the like.

[0073] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

Claims

1. A β-glucosidase mutant D126T with improved activity and salt tolerance, characterized in that: The amino acid sequence of the mutant D126T is obtained by mutating the aspartic acid at position 126 of the recombinant wild β-glucosidase BglPcC1 to threonine, and the amino acid sequence is shown in SEQ ID NO.

1.

2. The gene D126T encoding the β-glucosidase mutant D126T according to claim 1, characterized in that: The nucleotide sequence of the D126T encoding gene is shown in SEQ ID NO.

2.

3. A recombinant expression vector comprising the gene encoding D126T as claimed in claim 2.

4. The recombinant expression vector according to claim 3, characterized in that The recombinant expression vector adopts pET-28a(+).

5. A recombinant expression bacterium comprising the coding gene D126T as claimed in claim 2.

6. The recombinant expression bacteria according to claim 5, characterized in that: The recombinant expression bacteria are selected from BL21 (DE3).

7. Use of the β-glucosidase mutant D126T as claimed in claim 1 in the fields of food processing and preservation, sewage treatment, leather making, feed and medicine.

Images