Construction and application of targeting exosome chimeric antigen receptor molecule for treating HIV (Human Immunodeficiency Virus) infection

Abstract

The invention discloses construction and application of a targeted exosome chimeric antigen receptor molecule for treating HIV (human immunodeficiency virus) infection, and belongs to the technical field of biological medicines. According to the invention, the mRNA for coding the anti-HIV CAR is directionally packaged into the targeting exosome. Nanometer antibody sequences of CD3, CD4 and CD8 < + > T receptors on targeted T cells are fused to the N terminal of LAMP-2B to construct a specific targeting plasmid, so that targeting peptides are expressed on the surface of an exosome membrane, expression plasmids containing RNA binding protein L7A and exosome tag protein CD63 are constructed, and HEK293F cells are co-transfected by the expression plasmids and CAR plasmids containing C / D box to obtain the exosome loaded with CAR mRNA and targeted to the T cells. When the exosome is incubated with PBMC (peripheral blood mononuclear cells) in vitro or is transfused back into a humanized mouse body, human CAR-T cells can be constructed, and the exosome has remarkable activity of killing virus infected cells.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to the construction and application of a targeted exosome chimeric antigen receptor molecule for treating HIV infection. Background Art

[0002] Human immunodeficiency virus (HIV) is a pathogen that causes immune deficiency. It mainly attacks the human immune system, weakens its resistance to infection, and may eventually develop into acquired immunodeficiency syndrome (AIDS). As the terminal stage of HIV infection, AIDS is characterized by immune failure, which makes patients vulnerable to serious infections and tumors. Although progress has been made in treatment since the 1980s, especially the development of antiretroviral therapy, HIV / AIDS remains a major challenge in the field of global public health, especially in many developing countries, where its impact is particularly far-reaching. Therefore, prevention, treatment and strengthening of attention to HIV / AIDS have become the focus of international efforts.

[0003] Highly active antiretroviral therapy (HAART) is the mainstream treatment for AIDS. It significantly reduces the viral load of HIV-1 to an almost undetectable level. However, this treatment fails to eradicate the HIV reservoir and requires patients to take medication for life. Once the medication is stopped, the virus will relapse quickly. Although it has achieved great success in controlling HIV-1 infection and reducing the viral load to an undetectable level, it still cannot effectively eliminate the HIV reservoir. Antiviral drugs need to be taken for life, and the virus rebounds rapidly after stopping the medication. There are many problems such as poor medication compliance, drug resistance, and obvious side effects. CAR-T cell therapy (Chimeric Antigen Receptor T-cell Therapy) is mainly an innovative therapy for the treatment of hematological malignancies such as leukemia and lymphoma. CAR-T therapy transforms the patient's own T cells to have a stronger anti-tumor ability, thereby attacking and destroying malignant tumor cells. Although CAR-T therapy has achieved remarkable success in treating diseases such as leukemia, it still faces a series of challenges to use it in HIV treatment. Therefore, as of now, CAR-T therapy cannot be used as a mainstream method for treating HIV (human immunodeficiency virus).

[0004] There are significant limitations to using CAR-T cell therapy for HIV treatment, including:

[0005] 1. Although universal CAR-T cell therapy eliminates the need to extract T cells from the patient's body, reduces the risk of HIV exposure, and thus improves safety, this therapy also brings potential life-threatening risks, mainly manifested in the possibility that the patient's immune system may reject allogeneic T cells (host-graft response, HvGR) and that donor T cells may induce graft-versus-host disease (GvHD) against the host.

[0006] 2. Autologous CAR-T cells are collected from the patient, which can effectively avoid the immune system's rejection of allogeneic T cells. However, there are risks of HIV exposure during the collection process, high requirements for the patient's own T cells, and the entire preparation process is toxic, with high biosafety requirements, long experimental cycles, and high costs.

[0007] Moreover, both different CAR-T therapies prepare CAR-T cells through third-generation lentiviral transduction and then infuse them back into the patient's body, which poses a risk of viral homologous recombination and leads to viral evolution. Summary of the invention

[0008] The purpose of the present invention is to provide a construction and application of a targeted exosome chimeric antigen receptor molecule for treating HIV infection, so as to solve the problems existing in the above-mentioned prior art. The purpose of the present invention is to provide a new CAR-T treatment method that does not require extraction of T cells from the patient's body, is simple to operate, has high versatility, and is low in cost, which can be used in the development and treatment of HIV infection drugs in the future.

[0009] To achieve the above object, the present invention provides the following solutions:

[0010] One of the technical solutions of the present invention is a nano-antibody expression vector targeting CD3, CD4 or CD8, wherein the nano-antibody expression vector targeting CD3, CD4 or CD8 uses EF-1α as a promoter, and a Kozak sequence, a GNSTM glycosylation sequence, a target gene and Lamp2b are sequentially connected downstream of the promoter; the target gene is a CD3, CD4 or CD8 gene; wherein the nucleotide sequence of CD3 is shown in SEQ ID NO:4, the nucleotide sequence of CD4 is shown in SEQ ID NO:5, and the nucleotide sequence of CD8 is shown in SEQ ID NO:6.

[0011] The second technical solution of the present invention is a PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid, wherein the PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid carries a CAR structure + CDbox; the nucleotide sequence of the CAR structure + CDbox is shown in SEQ ID NO:7.

[0012] The third technical solution of the present invention is a PCDNA3.1CD63-L7Ae / ZSGreen plasmid, wherein the PCDNA3.1CD63-L7Ae / ZSGreen plasmid carries CD63-L7Ae or CD63-ZSGreen; wherein the nucleotide sequence of CD63-L7Ae is shown in SEQ ID NO:8, and the nucleotide sequence of CD63-ZSGreen is shown in SEQ ID NO:9.

[0013] A fourth technical solution of the present invention is a method for preparing exosomes, comprising the following steps:

[0014] The CD3, CD4 or CD8 targeting nanoantibody expression vector, the PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid and the PCDNA3.1CD63-L7Ae / ZSGreen plasmid were co-transfected into 293F cells, and the exosomes were purified to obtain the exosomes.

[0015] A fifth technical solution of the present invention is the exosomes obtained by the preparation method.

[0016] The sixth technical solution of the present invention is the use of the exosomes in the preparation of drugs for treating diseases caused by HIV.

[0017] The seventh technical solution of the present invention is a drug for treating diseases caused by HIV, comprising the exosomes.

[0018] Based on the above technical solution, the present invention has the following technical effects:

[0019] The present invention uses molecular docking to screen out bnabs with higher affinity for target HIV-1 strains from existing broad-spectrum neutralizing antibodies. The technical solution provided by the present invention can produce fully human antibodies. The prior art uses 293T cells for recombinant antibody expression, but due to the adhesion characteristics of 293T and contact inhibition, the yield is low. The present invention uses 293F cells and suspension culture, which can produce recombinant antibodies on a larger scale.

[0020] Compared with the traditional CAR-T cell therapy, which prepares CAR-T cells in vitro through third-generation lentiviral transduction, the treatment method established by the present invention does not require the acquisition of T cells and there is no viral transduction. CAR exo can achieve specific targeted preparation of CAR-T cells in the patient's body. Therefore, the method established by the present invention is more conducive to the development of new CAR-T drugs, which is very important for the treatment of AIDS. Another advantage of the method established by the present invention is that a broad-spectrum neutralizing antibody that can neutralize more than 98% of HIV-1 is selected as the scFv of the CAR structure, which has a wide coverage and high affinity. Another advantage of the method established by the present invention is that exosomes are selected as the carrier of CAR, which can pass through multiple barriers and has low immunogenicity.

[0021] The present invention uses the HEK293F exosome expression system to obtain high-purity exosomes that specifically target CD3, CD4, CD8+T cells and form CAR-T in vivo. The L7AE protein is coupled to the exosome marker protein CD63, and the CDbox structure on the CAR mRNA expression plasmid is specifically bound to the protein and mRNA, and then the nano-antibody expression plasmid that specifically targets CD3, CD4, CD8+T cells is co-transfected into HEK293F cells to obtain exosomes. The present invention realizes the in vivo construction of CAR-T by CAR-exo for the first time and has a significant antiviral effect on HIV-infected mouse models. The use of exosomes to prepare CAR-T in vivo can achieve mass production, does not carry viruses, and has no risk of homologous recombination. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0023] Figure 1 Schematic diagram for the construction of BRD-PTK-CD3 / CD4 / CD8-Lamp2b plasmid;

[0024] Figure 2 Schematic diagram of the construction of the PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid;

[0025] Figure 3 Schematic diagram of the construction of PCDNA3.1CD63-L7Ae / ZSGreen plasmid;

[0026] Figure 4 This is the result of flow cytometry detection of CAR molecule expression in HEK293F cells;

[0027] Figure 5 Schematic diagram of exosome purification results;

[0028] Figure 6 The results of NTA (A) and electron microscopy (B) analysis of exosomes are shown;

[0029] Figure 7 This is the result of nano-flow cytometry detection of exosomes;

[0030] Figure 8 The results of cell targeting were observed using laser confocal microscopy;

[0031] Fig. 9This is the result of the detection of exosomes targeting specificity into CAR-T cells in vitro;

[0032] Fig.10 The killing test results for calcein detection;

[0033] Fig.11 is the result of granzyme perforin detection; wherein A is granzyme B, and B is perforin;

[0034] Fig.12 To detect CAR+ results;

[0035] Fig.13 The antiviral effect of in vivo CAR exo in HIV humanized mouse model; A is a flow chart, B is the antiviral imaging result of CAR-exo in HIV-infected mice, and C is the quantitative imaging result of small animals;

[0036] Fig.14 Are the results of total DNA and RNA quantitative analysis; A is the quantitative result of total DNA of peritoneal macrophages and bone marrow viruses, and B is the quantitative result of total RNA of peritoneal macrophages and bone marrow viruses.

[0037] Fig.15 The results of quantitative analysis of provirus integration in mouse tissues; A is the fluorescence quantitative PCR amplification curve, B is the standard curve, and C is the quantitative results of provirus DNA integration in mouse spleen and blood tissues. DETAILED DESCRIPTION

[0038] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0039] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0040] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0041] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0042] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0043] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or are publicly available.

[0044] An embodiment of the present invention provides a CD3, CD4 or CD8 targeting nanoantibody expression vector, wherein the CD3, CD4 or CD8 targeting nanoantibody expression vector uses EF-1α as a promoter, and a Kozak sequence, a GNSTM glycosylation sequence, a target gene and Lamp2b are sequentially connected downstream of the promoter; the target gene is a CD3, CD4 or CD8 gene; wherein the nucleotide sequence of CD3 is shown in SEQ ID NO:4, the nucleotide sequence of CD4 is shown in SEQ ID NO:5, and the nucleotide sequence of CD8 is shown in SEQ ID NO:6.

[0045] In some specific embodiments, the CD3, CD4 or CD8 targeting nanobody expression vector uses the BRD-PTK plasmid as a backbone.

[0046] An embodiment of the present invention also provides a PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid, wherein the PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid carries a CAR structure + CDbox; the nucleotide sequence of the CAR structure + CDbox is shown in SEQ ID NO:7.

[0047] In some specific embodiments, the PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid uses the PCDNA3.1 plasmid as a backbone.

[0048] The embodiment of the present invention also provides a PCDNA3.1CD63-L7Ae / ZSGreen plasmid, wherein the PCDNA3.1CD63-L7Ae / ZSGreen plasmid carries CD63-L7Ae or CD63-ZSGreen; wherein the nucleotide sequence of CD63-L7Ae is shown in SEQ ID NO:8, and the nucleotide sequence of CD63-ZSGreen is shown in SEQ ID NO:9.

[0049] In some specific embodiments, the PCDNA3.1CD63-L7Ae / ZSGreen plasmid uses the PCDNA3.1 plasmid as a backbone.

[0050] The present invention also provides a method for preparing exosomes, comprising the following steps:

[0051] The CD3, CD4 or CD8 targeting nanoantibody expression vector, the PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid and the PCDNA3.1CD63-L7Ae / ZSGreen plasmid were co-transfected into 293F cells, and the exosomes were purified to obtain the exosomes.

[0052] In some specific embodiments, the 293F cells are in the mid-log phase, and the viable cell density reaches 2×10 6 ~3×10 6 .

[0053] In some specific embodiments, the purification is specifically as follows: centrifuge at 300g for 5 minutes to obtain the supernatant, centrifuge at 3000g for 30 minutes to obtain the supernatant, centrifuge at 10000g for 1 hour to obtain the supernatant, filter through 0.22μM, centrifuge at 100000g for 90 minutes, resuspend and wash with an equal volume of PBS, centrifuge at 100000g for 90 minutes again, and resuspend in 1640 complete culture medium.

[0054] The embodiments of the present invention also provide exosomes obtained by the preparation method.

[0055] In some specific embodiments, the exosomes contain amino acid sequences shown in SEQ ID NO.1 to SEQ ID NO.3.

[0056] The embodiments of the present invention also provide the use of the exosomes in preparing a drug for treating diseases caused by HIV.

[0057] An embodiment of the present invention further provides a drug for treating diseases caused by HIV, comprising the exosomes.

[0058] Example 1

[0059] Construction of exosome packaging system specifically targeting CD3, CD4, and CD8

[0060] The specific steps are as follows:

[0061] 1. Construction of Nano-antibody Expression Plasmids Targeting CD3, CD4, and CD8

[0062] The amino acid sequence of Anti-CD3-Lamp2b is shown in SEQ ID NO: 1:

[0063] MVCFRLFPVPGSGLVLVCLVLGAVRSYAGNSTMGSGEVQLVESGGGLVQPGGSLRLSCAASGFTFDDYGMSWVRQAPGKWLEWVSDISWNGGSTYYADSVKGRFTISRDNAENTLYLQMNSLKPDDTAVYYCAKMGEGGWGANDYWGQGTQVTVSSGSGSGSGGSSLELNLTDSENATCLYAKWQMNFTVRY etc KVASVINNPNTHSTGSCRSHTALLRLNSSTIKYLDFVFAVKNENRFYLKEVNISMYLVNGSVFSIANNNLSYWDAPLGSSYMCNKEQTVSVSGAFQINTFDLRVQPFNVTQGKYSTAQECSLDDDTILIPIIVGAGLSGLIIVIVIAYVIGRRKSYAGYQTLGSGYPYDVPDYA*;

[0064] The amino acid sequence of Anti-CD4-Lamp2b is shown in SEQ ID NO: 2:

[0065] MVCFRLFPVPGSGLVLVCLVLGAVRSYAGNSTMGSGEVQLLESGGGLVQPGGSLKLSCAASGFTFNTYAMNWVRQAPGKGLEWVARIRSKYNNYATYYADSVKDRFTISRDDSKNTAYLQMNNLKTEDTAVYYCVRHGNFGNSYVSWFAYWGQGTLVTVSSGGGGSGGGGSGGGGSELVVTQEPSLTVSPGGTVTLTCRSSTGAVTTSNYANWVQQKPGQAPRGLIGGTNKRAPGTPARFSGSLLGGKAALTLSGVQPEDEAEYYCALWYSNLWVFGGGTKLTVLGSGSGSGGSSLELNLTDSENATCLYAKWQMNFTVRYETTNKTYKTVTISDHGTVTYNGSICGDDQNGPKIAVQFGPGFSWIANFTKAASTYSIDSVSFSYNTGDNTTFPDAEDKGILTVDELLAIRIPLNDLFRCNSLSTLEKNDVVQHYWDVLVQAFVQNGTVSTNEFLCDKDKTSTVAPTIHTTVPSPTTTPTPKEKPEAGTYSVNNGNDTCLLATMGLQLNITQDKVASVININPNTTHSTGSCRSHTALLRLNSSTIKYLDFVFAVKNENRFYLKEVNISMYLVNGSVFSIANNNLSYWDAPLGSSYMCNKEQTVSVSGAFQINTFDLRVQPFNVTQGKYSTAQECSLDDDTILIPIIVGAGLSGLIIVIVIAYVIGRRKSYAGYQTLGSGYPYDVPDYA*;

[0066] The amino acid sequence of Anti-CD8-Lamp2b is shown in SEQ ID NO:3:

[0067] MVCFRLFPVPGSGLVLVCLVLGAVRSYAGNSTMGSGQLQLVESGGGLVQAGGSLRLSCAASGLTFEDYAIGWFRQAPGKEREGISCIRIYDGNTYSAESVKGRFTISSDNAKNQVYLQINTLKPEDTAVYYCAAGSYYSCSVYPDYDMDYWGKGTLVTVSSGSGSGSGGSSLELNLTDSENATCLYAKWQMNFTVRYETTNKTYKTVTISDHGTVTYNGSICGDDQNGPKIAVQFGPGFSWIANFTKAASTYSIDSVSFSYNTGDNTTFPDAEDKGILTVDELLAIRIPLNDLFRCNSLSTLEKNDVVQHYWDVLVQAFVQNGTVSTNEFLCDKDKTSTVAPTIHTTVPSPTTTPTPKEKPEAGTYSVNNGNDTCLLATMGLQLNITQDKVASVININPNTTHSTGSCRSHTALLRLNSSTIKYLDFVFAVKNENRFYLKEVNISMYLVNGSVFSIANNNLSYWDAPLGSSYMCNKEQTVSVSGAFQINTFDLRVQPFNVTQGKYSTAQECSLDDDTILIPIIVGAGLSGLIIVIVIAYVIGRRKSYAGYQTLGSGYPYDVPDYA*;

[0068] The nucleotide sequence of Anti-CD3-Lamp2b is shown in SEQ ID NO:4:

[0069]

[0070] The nucleotide sequence of Anti-CD4-Lamp2b is shown in SEQ ID NO:5:

[0071]

[0072] The nucleotide sequence of Anti-CD8-Lamp2b is shown in SEQ ID NO:6:

[0073]

[0074] Taking BRD-PTK plasmid as an example, the specific experimental method is described: the sequence CD3, CD4, and CD8 nanoantibodies were synthesized by Sangon Bioengineering Co., Ltd. When designing primers, homologous fragments of the expression vector were introduced at both ends of the nanoantibody fragments. The targeted expression vector BRD-PTK-Lamp2b was purchased from invivo, and the linearized vector was obtained by double enzyme digestion. The enzyme digestion sites of the vector BRD-PTK-Lamp2b are AgeI and BsrGI; the product was subjected to 0.7% agarose gel electrophoresis, and the gel was cut and recovered and placed in an Eppendorf tube. The corresponding fragments were recovered using Tiangen's agarose gel recovery kit, and the purity and concentration of the product were determined. The above-mentioned vector recovery fragments and the nanoantibody fragments were added to Eppendorf tubes at a molar ratio of 1:2 using homologous recombination technology, and ExnaseⅡ homologous recombination enzyme (Vazyme) and 5×CE buffer were added, and reacted at 37°C for 0.5 hours; 10 μL of the connection liquid was taken out and added to 100 μL Stbl3 competent cells, ice-bathed for 10 minutes, and then heat-shocked at 42°C for 45 seconds. After completion, 500 μL soc culture medium was added and cultured at 37°C and 220 rpm for 1 hour; after 1 hour, the Eppendorf tube was centrifuged at 4000 rpm for 1 minute to remove 400 μL of excess liquid. The remaining liquid was spread on an LB plate containing amp and cultured at 37°C for 12 hours; a single colony was picked from the plate and inoculated into 5 mL of LB liquid culture medium and cultured at 37°C, 220 rpm for 12 hours. The plasmid was extracted using the Tiangen small extraction kit to obtain the plasmid BRD-PTK-CD3 / CD4 / CD8-Lamp2b, which was sent to the Shanghai Biotechnology Co., Ltd. for first-generation sequencing verification. The schematic diagram of plasmid construction is shown below. Figure 1 shown.

[0075] 2. Construction of CAR mRNA expression plasmid and exosome packaging plasmid

[0076] The nucleotide sequence of the CAR structure + C / D box is shown in SEQ ID NO: 7:

[0077]

[0078] Taking PCDNA3.1 plasmid as an example, the specific experimental method is described: the single-chain antibody sequence of the broad-spectrum neutralizing antibody VRC01 was synthesized by Shanghai Bioengineering Co., Ltd. When designing primers, the homologous fragments of the expression vector were introduced at both ends of the CAR fragment, and the signal peptide, STREP2, Hinge, CD28TM+ICD, 4-1BB and CD3ζ of N6 were inserted to obtain the CARmRNA expression plasmid. The expression vector PCDNA 3.1 was purchased from invivo, and the linearized vector was obtained by double enzyme digestion. The enzyme digestion sites of the vector PCDNA3.1 are NheI and BamHI; the product was subjected to 0.7% agarose gel electrophoresis, and the gel was cut and recovered and placed in an Eppendorf tube. The corresponding fragments were recovered using Tiangen's agarose gel recovery kit, and the purity and concentration of the product were determined. Homologous recombination technology was used to add the above-mentioned vector recovery fragments and nano-antibody fragments to Eppendorf tubes at a molar ratio of 1:2, and ExnaseⅡ homologous recombination enzyme (Vazyme) and 5×CE buffer were added to react at 37°C for 0.5 hours; 10μL of the connection liquid was taken out and added to 100μL Stbl3 competent cells in an ice bath for 10 minutes and then heat-shocked at 42°C for 45s. After completion, 500μL soc medium was added and cultured at 37°C and 220rpm for 1 hour; 1 hour later, the Eppendorf tube was centrifuged at 4000rpm for 1min to remove 400μL of excess liquid. The remaining liquid was spread on the LB plate containing amp and cultured at 37°C for 12 hours; single colonies were picked on the plate, inoculated into 5mL LB liquid culture medium, cultured at 37°C and 220rpm for 12 hours, and the plasmid was extracted using the Tiangen small extraction kit to obtain the plasmid PCDNA3.1-N6SP-VRCO1 CAR-CDbox. The schematic diagram of plasmid construction is shown in the figure. Figure 2 shown.

[0079] 3. Construction of CD63 exosome packaging plasmid

[0080] The nucleotide sequence of CD63-L7Ae is shown in SEQ ID NO:8:

[0081] ATGGCGGTGGAAGGAGGAATGAAATGTGTGAAGTTCTTGCTCTACGTCCTCCTGCTGGCCTTTTGCGCCTGTGCAGTGGGACTGATTGCCGTGGGTGTCGGGGCACAGCTTGTCCTGAGTCAGACCATAATCCAGGGGGCTACCCCTGGCTCTCTGTTGCCAGTGGTCATCATCGCAGTGGGTGTCTTCCTCTTCCTGGTGGCTTTTGTGGGCTGCTGCGGGGCCTGCAAGGAGAACTATTGTCTTATGATCACGTTTGCCATCTTTCTGTCTCTTATCATGTTGGTGGAGGTGGCCGCAGCCATTGCTGGCTATGTGTTTAGAGATAAGGTGATGTCAGAGTTTAATAACAACTTCCGGCAGCAGATGGAGAATTACCCGAAAAATAACCACACTGCTTCGATCCTGGACAGGATGCAGGCAGATTTTAAGTGCTGTGGGGCTGCTAACTACACAGATTGGGAGAAAATCCCTTCCATGTCGAAGAACCGAGTCCCCGACTCCTGCTGCATTAATGTTACTGTGGGCTGTGGGATTAATTTCAACGAGAAGGCGATCCATAAGGAGGGCTGTGTGGAGAAGATTGGGGGCTGGCTGAGGAAAAATGTGCTGGTGGTAGCTGCAGCAGCCCTTGGAATTGCTTTTGTCGAGGTTTTGGGAATTGTCTTTGCCTGCTGCCTCGTGAAGAGTATCAGAAGTGGCTACGAGGTGATGGGAGGCGGAGGCGGAGGCGGAGGCATGTACGTGAGATTTGAGGTTCCTGAGGACATGCAGAACGAAGCTCTGAGTCTGCTGGAGAAGGTTAGGGAGAGCGGTAAGGTAAAGAAAGGTACCAACGAGACGACAAAGGCTGTGGAGAGGGGACTGGCAAAGCTCGTTTACATCGCAGAGGATGTTGACCCGCCTGAGATCGTTGCTCATCTGCCCCTCCTCTGCGAGGAGAAGAATGTGCCGTACATTTACGTTAAAAGCAAGAACGACCTTGGAAGGGCTGTGGGCATTGAGGTGCCATGCGCTTCGGCAGCGATAATCAACGAGGGAGAGCTGAGAAAGGAGCTTGGAAGCCTTGTGGAGAAGATTAAAGGCCTTCAGAAGTAA;

[0082] The nucleotide sequence of CD63-ZSGreen is shown in SEQ ID NO:9:

[0083]

[0084] Taking PCDNA3.1 plasmid as an example, the specific experimental method is described: the single-chain antibody sequence of the exosome marker protein CD63 was synthesized by Shanghai Bioengineering Co., Ltd. When designing primers, homologous fragments of the expression vector were introduced at both ends of the CD63 fragment, and L7Ae / ZSGreen was connected to obtain the CD63 expression plasmid. The expression vector PCDNA3.1 was purchased from invivo, and the linearized vector was obtained by double enzyme digestion. The enzyme digestion sites of the vector PCDNA3.1 are NheI and NotI; the product was subjected to 0.7% agarose gel electrophoresis, and the gel was cut and recovered and placed in an Eppendorf tube. The corresponding fragments were recovered using Tiangen's agarose gel recovery kit, and the purity and concentration of the product were determined. Homologous recombination technology was used to add the above-mentioned vector recovery fragments and nano-antibody fragments to Eppendorf tubes at a molar ratio of 1:2, and ExnaseⅡ homologous recombination enzyme (Vazyme) and 5×CE buffer were added to react at 37°C for 0.5 hours; 10μL of the connection liquid was taken out and added to 100μL Stbl3 competent cells in an ice bath for 10 minutes and then heat-shocked at 42°C for 45s. After completion, 500μL soc medium was added and cultured at 37°C and 220rpm for 1 hour; 1 hour later, the Eppendorf tube was centrifuged at 4000rpm for 1min to remove 400μL of excess liquid. The remaining liquid was spread on the LB plate containing amp and cultured at 37°C for 12 hours; single colonies were picked on the plate, inoculated into 5mL LB liquid culture medium and cultured at 37°C and 220rpm for 12 hours, and the plasmid was extracted using the Tiangen small extraction kit to obtain the plasmid PCDNA3.1CD63-L7Ae / ZSGreen. The schematic diagram of plasmid construction is shown in the figure. Figure 3 shown.

[0085] Example 2 Preparation and purification of CAR-targeted exosomes

[0086] The specific steps are as follows:

[0087] 1. 293F cell recovery and culture

[0088] Thaw quickly in a 37℃ water bath, transfer all the contents of the cryotube to a 15mL centrifuge tube, add 4mL F medium and blow gently to mix, centrifuge at 300*g for 5min, aspirate the supernatant, add 25mL fresh preheated HEK293F medium, blow evenly and add to a 125mL shake flask. Incubate in a constant temperature shaker at 120-140rpm at 37℃ and 5% CO2 incubator. When the viable cell density reaches 2×10 6 ~3×10 6 When the cell viability is ≥90% and the cells are in the mid-log phase, the cells can be subcultured.

[0089] 2. Exosome packaging

[0090] When the viable cell density reaches 2×10 6 ~3×10 6 At the same time, the targeting plasmid, CD63 expression plasmid and CAR plasmid were co-transfected into 293F. Use a 10mL pipette to gently blow the cell suspension about 20 times, blow and mix to obtain a single cell suspension, pipette 25μg of plasmid DNA mixture (PCDNA3.1CD63-L7Ae / ZSGreen, PCDNA3.1-N6SP-VRCO1 CAR-CDbox and BRD-PTK-anti CD3 / CD4 / CD8-Lamp2b co-transfection) into 1mL of HEK293F culture medium, pipette 75μL of filtered sterilized PEI (polyethyleneimine) solution (1mg / mL) into 1mL of F culture medium, use a pipette to mix thoroughly, and let it stand for 5min. After mixing, let it stand at room temperature for 30min, and slowly add the DNA / PEI mixture to the cells. 24 hours after transfection, 1 / 50 of the culture volume of L-glutamine and 1 / 20 of the culture volume of serum-free protein supplement were added. 1×10 6 After the cells were stained with FITC-G4S linker for 30 minutes, flow cytometry detected that HEK293F cells successfully expressed CAR molecules. The results are as follows Figure 4 shown.

[0091] 3. Exosome purification

[0092] 72 h after transfection, the supernatant was collected after centrifugation at 300 g for 5 min, the cell debris was removed after centrifugation at 3000 g for 30 min, the supernatant was collected after centrifugation at 10000 g for 1 h, filtered through 0.22 μM, centrifuged at 100000 g for 90 min, resuspended and washed with an equal volume of PBS, centrifuged at 100000 g for 90 min again, and resuspended in 1640 complete medium. The purification process was as follows Figure 5 shown.

[0093] 4. Exosome electron microscopy and NTA analysis

[0094] The sample pool was cleaned with deionized water, the instrument was calibrated with polystyrene microspheres (100 nm), and the sample pool was cleaned with 1×PBS buffer (Biological Industries, Israel); the sample was diluted with 1×PBS buffer and injected for detection. The NTA results showed that the purified exosomes were in the size range of 30-150 nm ( Figure 6A). Prepared suspension samples of exosomes, viruses, bacteria, etc., use a pipette to draw 20μl of the suspension and drop it on the copper mesh for natural adsorption for 5-10 minutes, then use a filter paper strip to absorb the excess droplets and dry it slightly; then use a pipette to draw 20μL of 2% phosphotungstic acid solution, drop it on the copper mesh, let it stand for 3-5 minutes; use a filter paper strip to absorb the excess droplets and dry it under an incandescent lamp; observe the purified exosomes under a transmission electron microscope and take pictures of the results as shown below Figure 6 Middle B.

[0095] 5. Exosome Nanoflow Detection

[0096] The exosome stock solution was diluted to 1×10 8 particles / mL, and 1 test of anti-human-CD63-PE and anti-G4S-linker-FITC were added for flow cytometry staining, and the samples were injected to detect the expression of exosome-specific marker protein CD63 and CAR. The results showed that CAR protein was successfully expressed on the exosome membrane. Figure 7 ).

[0097] Example 3 In vitro validation of the targeting of exosomes

[0098] 2×10 5 PBMC target cells were seeded at a density of 10 μg / mL in a 12-well plate. After 24 hours, the culture medium was removed and the ZSGreen exosomes were resuspended at a concentration of 1 mg / mL and incubated for 24 hours. The specific steps are as follows:

[0099] 1. Observation of cell targeting by laser confocal microscopy

[0100] Wash the cells with pre-cooled PBS buffer solution and remove the residual culture medium. Immediately add 4% paraformaldehyde (PFA) fixative. Fix at room temperature for 15 minutes. After washing the residual fixative with PBS, treat the cells with 0.5% Triton X-100 for 5 minutes, and wash away the permeabilization solution with PBS. Finally, remove the excess PBS on the glass slide and seal it with a sealing agent. After the sealing agent solidifies, laser confocal microscopy observation can be performed. The results show that the specifically targeted CAR-exo can successfully fuse with the target cell membrane ( Figure 8 ).

[0101] Example 4 Exosomes Target Specific CAR-T Cells in Vitro

[0102] 2×10 5The density of PBMC target cells was inoculated in a 12-well plate. After 24 hours, the medium was removed by centrifugation, and the concentration was resuspended to 1 mg / mL with exosomes containing CAR mRNA specifically targeting CD3, CD4, and CD8, and incubated for 24 hours. The supernatant was removed, and 1 mL of FBS washing solution (containing 2% FBS + PBS) was added to blow evenly, and after centrifugation at 500g for 5 minutes, the supernatant was removed. First, 100 μL of 1 μg / mL anti-G4S Linker-FITC was added to each centrifuge tube, and then anti-hu-CD3-APC-cy7, anti-hu-CD4-APC and anti-hu-CD8-BV421 with a final concentration of 1 μg / mL were added to each centrifuge tube to resuspend the cells. The cells were incubated at 4°C in the dark for 30 minutes, and washed three times. The cells were centrifuged at 500 g for 5 minutes, washed three times with 200 μL FBS cleaning solution, and analyzed by flow cytometry. The flow cytometry results showed that the exosomes purified by this method successfully targeted PBMCs in vitro and transformed into CAR-T cells.

[0103] Example 5 In vitro targeted transformation of T cells and killing

[0104] Take the cultured positive target cells 293T-trimer-NL4-EGFP and negative target cells MLV-293T, count them on a hemocytometer, and take the corresponding number of cells into a labeled 15 mL centrifuge tube. Add 10 mL of DMEM complete medium to each tube, centrifuge at 300 g for 5 minutes, and discard the supernatant. Add 0.3 mL of complete medium to each tube and resuspend the cells to a cell density of 1 × 10 6 / mL. Add 10μL 2.5mM Calcein-AM to 1mL of cell suspension to make the working solution concentration 25μM, and incubate in a 37℃ electric incubator for 30min. After 30min incubation, remove the target cells from the incubator, add 10mL tumor killing buffer to each tube of target cells, centrifuge at 300g for 5 minutes, and discard the supernatant. Repeat the washing three times, add 3mL complete culture medium to each tube to resuspend the cells. At this time, the cell suspension density is 1×10 5 / mL, 100 μL cells per well, three replicates. Take CAR-targeted CAR-T cells and untreated PBMCs, and calculate the effector cells in each well when the effector-target ratio is 100:1, 25:1, 5:1, 1:1, 0.1:1, and 0.01:1.

[0105] Mark the areas on the transparent U-well 96-well plate cover, and add 100 μL of target cells labeled with Calcein-AM to the corresponding wells.

[0106] Take 1μg / μL exosomes and add them to the corresponding wells. Make 3 duplicate wells for each dilution ratio, and finally fill the complete culture medium to 200μL; take 100μL lysis solution and 100μL tumor killing buffer and add them to the corresponding wells (3 duplicate wells each). Put the U-bottom 96-well plate into a 37℃ electric constant temperature incubator and incubate for 12 hours.

[0107] 1. Calcein detection

[0108] The 96-well plate was removed from the incubator and centrifuged at 500 g for 10 min. 150 μL of supernatant was taken from each well and transferred to a flat-bottom 96-well plate. The absorbance of each well was measured by fluorescence colorimetry in an ELISA reader. The spectrophotometer parameters were set as follows: excitation wavelength 485 / 20; emission wavelength: 530 / 25, and each well was scanned for 0.1 to 1 s. The calcein detection results showed that the CAR-exo targeted constructed CAR-T cells had a dose-dependent cytotoxic effect on the simulated HIV-infected cell model ( Fig.10 ).

[0109] 2. Granzyme perforin detection

[0110] The supernatant of the previous step was kept and the content of granzyme B and perforin in the supernatant was detected using the Solebao human granzyme B and human perforin Elisa detection kits. The results were consistent with the calcein killing results ( Fig.11 ).

[0111] Example 6 Mouse humanization modeling and in vivo targeted CAR-T cells

[0112] This part of the experiment was completed in an SPF animal room. Appropriate 6-week-old NPG mice were selected and adapted for 3 days and then divided into 4 groups of 5 mice each. The weight and condition of the four groups of mice were kept relatively consistent. In the SPF barrier environment, the four groups of mice were simultaneously injected with 5×10 human PBMCs resuspended in 200 μL of physiological saline through the tail vein. 6 cells / mouse for immune reconstruction of humanized mice. For mice transplanted with human PBMC cells, about 150μL / mouse of submandibular venous blood was collected at week 5 and anticoagulated with EDTA; then, red blood cell lysis buffer twice the volume of whole blood was added, lysed on ice for 10 minutes, centrifuged at 500g for 10 minutes, and the supernatant was removed, and the cells were resuspended in 100μL of normal saline. HuCD45+ antibody was added for staining at 4℃ for 30 minutes, and after washing 3 times, the proportion of surviving human lymphocytes CD45+ in the peripheral blood of mice was detected by flow cytometry. When the proportion of human CD45+ in peripheral blood was greater than 45%, 3×10 11Photons / mouse dose of CD3, CD4, CD8, and FLAG targeted exosomes were used for treatment. Two days after the injection, blood was collected from the submandibular vein of the mice, and flow cytometry was used to detect the number of CAR+ cells in the peripheral blood PBMC of the mice. The results showed that this study was the first to achieve the transformation of T cells into CAR-T cells in humanized mice by CAR exo exosomes. Fig.12 ).

[0113] Example 7 Targeted exosome therapy in vivo

[0114] 1. Small animal imaging to detect antiviral effects

[0115] This part of the experiment was conducted in a biosafety level 3 laboratory. The HIV-1NL4-3 virus strain is a wild-type virus of the X4 strain, which has the characteristics of infecting peripheral blood CD4+T cells. Four groups of 5 NPG mice were selected and intraperitoneally injected with 4×10 5 TCID 50 / mL / HIV-1NL4_3-nanoluc virus. Furimazine 50 μg / mouse was injected intraperitoneally IP every week after infection. Imaging was performed to detect the proliferation of the virus in vivo. When the fluorescence signal ROI value reached 10 6 ~10 7 photons / s can be used to determine whether the infection model has been successfully constructed.

[0116] Exosomes have a special ability to interact with receptor cells. Exosomes are extracellular vesicles composed of cell membranes (such as exosomes) that can attach to target cells through a series of surface adhesion proteins and carrier ligands (tetrapeptides, integrins, CD11b and CD18 receptors) and deliver their payload to target cells. Exosomes, depending on their characteristics and sources, have specific cell tropisms and can be used to target them for disease treatment.

[0117] HIV infection mouse model and treatment experimental design are shown in the schematic diagram Fig.13 A. Humanized mice were injected with 1×10 11 Photons / only treatment, CAR-exo exosome antiviral effect results Fig.13 As shown in B, the fluorescence quantitative results are as follows Fig.13 As shown in C. The results showed that CAR-exo has a significant antiviral effect in the HIV humanized mouse infection model.

[0118] 2. Molecular virology to detect antiviral effects

[0119] Quantification of viral DNA and RNA in mouse peritoneal macrophages and bone marrow:

[0120] Total DNA and RNA were extracted from peritoneal macrophages and bone marrow of mice 5 weeks after treatment. The gag gene copy number in the DNA of spleen and blood tissue of infected mice was quantified by real-time fluorescence quantitative PCR (Tables 3 and 4). Specific gag primers and probes (Table 2) were selected to quantify the gag gene copy number in the spleen and blood tissue of infected mice. β-globin was used as an internal reference gene, and specific β-globin primers and probes were selected to quantify the β-globin gene copy number per μL of infected mice. Then, the number of copies per 10 6 The copy number of gag gene DNA in tissue cells. After total RNA was reverse transcribed RT, the copy number of gag gene in RNA of spleen and blood tissues of infected mice was quantified by real-time fluorescence quantitative PCR, and specific gag primers and probes (Table 2) were selected. The human GADPH gene was used as an internal reference gene, and specific human GADPH primers and probes were selected to quantify the concentration of RNA per μL, and then standardized to calculate the copy number of gag gene RNA per μg RNA.

[0121] Table 1 Primers and probes for fluorescence quantitative PCR

[0122]

[0123] Table 2 Fluorescence quantitative PCR reaction system

[0124]

[0125] Table 3 Real-time fluorescence quantitative PCR reaction program

[0126]

[0127] The quantitative results of total DNA and RNA were as follows Fig.14 As shown in A and B. The results showed that CAR-exo significantly reduced the viral DNA and RNA loads in peritoneal macrophages and bone marrow cells of HIV humanized infected mice.

[0128] 3. Quantification of integrated proviral DNA in mice

[0129] In order to quantify the HIV copies of the integrated provirus in mouse cells, the present invention first prepared an integration standard curve and used a two-step PCR amplification, including a first round of 12 cycles of linear amplification (Table 5), followed by nested real-time fluorescence quantitative PCR detection (Table 3, Table 4).

[0130] The present invention adopts the genomic DNA of Jurkat-EGFP-mCherry double-labeled cells constructed in the laboratory as the HIV integration standard product. The Jurkat-EGFP-mCherry double-labeled cells are co-transfected with HIVNL4-3 plasmid with envelope gp120 defect and vesicular stomatitis virus (VSV-G) envelope plasmid to package pseudovirus infection. After the pseudovirus infects the cells, it cannot replicate and produce progeny viruses. After 20 generations of cell passage, the non-integrated HIV genome is reduced to extremely low copies or even does not exist. The total cell genome DNA after 20 generations is extracted, and the integrated HIV genome standard product is absolutely quantified and used as the standard product for detecting HIV-1 provirus integration.

[0131] The concentration of integrated HIV genomic DNA was 10 5 The standard with the copy number / μL was diluted 10 times in series and the genomic DNA of uninfected cells was added at the same time to ensure that the total concentration of the DNA of each concentration gradient standard was the same, ensuring the consistency of the amplification efficiency of each concentration. The integrated standard was pre-amplified with the first-round specific Alu-LTR pre-amplification primer (Table 2) for 12 cycles, and the samples to be tested were pre-amplified with the first-round specific Alu-LTR pre-amplification primer or LTR single primer. The amplified product was amplified by the second round of nested PCR with gag-specific primers (Table 2). The Alu-LTR pre-amplification of the sample to be tested minus the LTR single primer amplification was the copy number of the pre-integrated viral genome. At the same time, it was standardized according to the measured copy number of the β-globin gene per μL, and the number of copies per 10 was calculated. 6 The number of copies of HIV proviral DNA in cells. The integration standard curve results are as follows Fig.15 A and B show the results of measuring the integrated proviral load in the spleen and peripheral blood of HIV-infected mice. Fig.15 Middle C, D. The results showed that CAR-exo successfully reduced HIV proviral load in the spleen and peripheral blood of HIV-infected mice.

[0132] Table 4 First round pre-amplification PCR reaction program

[0133]

[0134] Obviously, the above embodiments of the present invention are merely examples for clearly explaining the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A nano-antibody expression vector targeting CD3, CD4 or CD8, It is characterized in that The CD3, CD4 or CD8 targeting nanobody expression vector uses EF-1α as a promoter, and the Kozak sequence, GNSTM glycosylation sequence, target gene and Lamp2b are sequentially connected downstream of the promoter; the target gene is CD3, CD4 or CD8 gene; wherein the nucleotide sequence of CD3 is shown in SEQ ID NO:4, the nucleotide sequence of CD4 is shown in SEQ ID NO:5, and the nucleotide sequence of CD8 is shown in SEQ ID NO:

6.

2. A PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid, It is characterized in that The PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid carries the CAR structure + CDbox; the nucleotide sequence of the CAR structure + CDbox is shown in SEQ ID NO:

7.

3. A PCDNA3.1CD63-L7Ae / ZSGreen plasmid, It is characterized in that The PCDNA3.1CD63-L7Ae / ZSGreen plasmid carries CD63-L7Ae or CD63-ZSGreen; wherein the nucleotide sequence of CD63-L7Ae is shown in SEQ ID NO:8, and the nucleotide sequence of CD63-ZSGreen is shown in SEQ ID NO:

9.

4. A method for preparing exosomes, It is characterized in that The following steps are involved: The CD3, CD4 or CD8 targeting nanoantibody expression vector of claim 1, the PCDNA3.1-N6SP-VRCO1 CAR-CDbox plasmid of claim 2 and the PCDNA3.1CD63-L7Ae / ZSGreen plasmid of claim 3 are co-transfected into 293F cells, and the exosomes are purified.

5. The preparation method according to claim 4, It is characterized in that The purification is specifically as follows: centrifuge at 300g for 5 minutes to obtain the supernatant, centrifuge at 3000g for 30 minutes to obtain the supernatant, centrifuge at 10000g for 1 hour to obtain the supernatant, filter through 0.22μM, centrifuge at 100000g for 90 minutes, resuspend and wash with an equal volume of PBS, centrifuge at 100000g for 90 minutes again, and resuspend in 1640 complete culture medium.

6. Exosomes obtained by the preparation method according to claim 4 or 5.

7. Use of the exosomes according to claim 6 in the preparation of a drug for treating diseases caused by HIV.

8. A drug for treating diseases caused by HIV, It is characterized in that Comprising the exosomes according to claim 6.

Images