Digital LAMP-CRISPR / Cas12b kit for quantitatively detecting klebsiella pneumoniae

Abstract

The invention discloses a method and a kit for quantitatively detecting digital LAMP-CRISPR / Cas12b (LAMP-CRISPR / Cas12b) by Klebsiella pneumoniae. According to the method, the specificity of LAMP-CRISPR / Cas12b is combined with the absolute quantification advantage of a digital chip technology, accurate and rapid quantitative detection can be carried out on klebsiella pneumoniae within 60 minutes under a constant temperature condition, and the method has high sensitivity and specificity. The accurate quantification of the DNA of the klebsiella pneumoniae can be realized. The acid glycoprotein in the sputum is an inhibiting factor of Bst polymerase, and the negative influence of the inhibiting factor on the nucleic acid concentration is reduced by using the 0.5% bromhexine hydrochloride solution, so that the detection sensitivity of the digital LAMP-CRISPR / Cas12b method on a thermal cracking sample without nucleic acid extraction is increased.

Description

Technical Field

[0001] The present invention relates to the field of microbial detection technology, and in particular to a technology for quantitatively detecting Klebsiella pneumoniae based on digital LAMP-CRISPR / Cas12b and a corresponding detection kit. Background Art

[0002] Klebsiella pneumoniae is a Gram-negative conditional pathogen belonging to the Enterobacteriaceae family. It is one of the most common bacterial pathogens in hospital-acquired infections that can cause acute respiratory tract infections and even pneumonia. From 2009 to 2019, China found that Klebsiella pneumoniae was one of the three major bacterial pathogens in patients with acute respiratory tract infections and an important cause of bacterial pneumonia. According to CARSS data, in the past 10 years, the proportion of Klebsiella pneumoniae in clinical isolation has increased from about 15% to about 20% worldwide, and its related infections have become a serious public health burden.

[0003] In the field of precision medicine, the absolute quantification of pathogen-related nucleic acids has become increasingly critical. Quantifying target nucleic acids is very important for determining the severity of the disease and evaluating the effectiveness of treatment. First, accurate quantification of the load of Klebsiella pneumoniae helps determine the severity of the disease. Second, the dynamic changes in the load of Klebsiella pneumoniae during the infection process are closely related to the effectiveness of treatment. Therefore, accurate quantification of Klebsiella pneumoniae helps in clinical diagnosis and treatment.

[0004] Traditional bacterial culture detection methods are slow, complex, low in sensitivity, and have a long turnaround time. For hospitalized patients with bacterial infections, inappropriate initial antimicrobial treatment almost doubles the risk of 30-day mortality. However, the real-time fluorescence PCR (qPCR) method widely used in clinical practice requires precise thermal cycling, is easily affected by inhibitors, and has poor accuracy when the concentration of the target pathogen is very low. Current clinical detection methods cannot meet the requirements. Therefore, establishing a rapid, accurate, and quantitative method for detecting Klebsiella pneumoniae in sputum samples will help to screen, diagnose, and treat respiratory infections caused by Klebsiella pneumoniae at an early stage and control the spread of Klebsiella pneumoniae.

[0005] The loop-mediated isothermal amplification (LAMP) technique uses DNA polymerase with high displacement strand activity to efficiently and specifically amplify target DNA under constant temperature conditions, which has the advantages of being fast and low-cost. However, the LAMP technique is prone to false positive results caused by primer cross-reactions and has low specificity.

[0006] CRISPR (Clustered regularly interspaced short palindromic repeats) detection technology uses the trans-cleavage activity of Cas protein to guide the binding to the target and cut the probe to emit fluorescence through the guide RNA (gRNA), thereby achieving rapid and sensitive detection. In recent years, CRISPR / Cas-based biosensor technology has been used for nucleic acid detection. CRISPR / Cas12b is more thermally stable than other family members in the CRISPR system and can be activated by LAMP amplification products to produce fluorescent signals by non-specifically cutting the reporter molecule DNA. Therefore, it can make up for the shortcomings of false positive signals in LAMP. However, despite its excellent sensitivity, specificity and convenience, it still cannot absolutely quantify nucleic acids.

[0007] Digital nucleic acid analysis technology divides nucleic acid detection reagents into a large number of individual partitions. This compartmentalization gives nucleic acid amplification analysis the advantage of quantifying the absolute number of target nucleic acids, which has been proven to improve the sensitivity and quantitative accuracy of pathogen detection. Combined with digital nucleic acid analysis technology, the CRISPR / Cas system can have the potential for absolute quantification. Summary of the invention

[0008] The purpose of the present invention is to overcome the shortcomings and deficiencies in the prior art, to achieve absolute quantification of Klebsiella pneumoniae in sputum samples, and to improve the accuracy of early screening of Klebsiella pneumoniae infection. The digital LAMP-CRISPR / Cas12b method is used to improve the existing Klebsiella pneumoniae detection method, thereby achieving sensitive qualitative and absolute quantification of Klebsiella pneumoniae, and improving the accuracy of early screening of Klebsiella pneumoniae infection.

[0009] To solve the above technical problems, the present invention provides a group of nucleic acid molecules for detecting Klebsiella pneumoniae, and a kit comprising the above nucleic acid molecules. The present invention also provides a method for quantitatively detecting Klebsiella pneumoniae based on LAMP-CRISPR / Cas12b and digital chip technology.

[0010] The nucleic acid molecule comprises a LAMP primer set for detecting Klebsiella pneumoniae as well as gRNA and ssDNA reporter molecules;

[0011] The LAMP primer set comprises primers with nucleotide sequences as shown in SEQ ID NO.1-6;

[0012] The gRNA targets a DNA fragment of the Klebsiella pneumoniae Khe gene, the DNA fragment is amplified using the LAMP primer set, and its nucleotide sequence is shown in SEQ ID NO.7;

[0013] The nucleotide sequence of the ssDNA reporter molecule is shown in SEQ ID NO.8.

[0014] The digital LAMP-CRISPR / Cas12b kit for quantitative detection of Klebsiella pneumoniae prepared by the nucleic acid molecule, wherein the kit comprises the 0.5% bromhexine hydrochloride solution for Klebsiella pneumoniae detection, WarmStart ® LAMP premix, LAMP primer set, Cas12b, gRNA, ssDNA reporter, RNase inhibitor, Mg 2+ , DEPC water and digital chip.

[0015] The digital LAMP-CRISPR / Cas12b kit for quantitative detection of Klebsiella pneumoniae is characterized in that the digital chip of the kit is a solid phase separation chip, and the configured LAMP-Cas12b reaction system is added to the sample loading well of the scraper; the reaction system is loaded from the scraper to the solid phase in each unit of the chip; then a layer of oil phase is covered on the system so that the reaction system in each unit is separated by the solid phase chip and the oil phase to form a digital array; the chip is placed in a 60°C water bath for incubation for 1 hour, and the endpoint fluorescence of 15,000 partitions is detected by a biochip analyzer and a threshold is determined according to the fluorescence distribution of the partition, and the positive partition percentage and the input nucleic acid concentration are calculated according to the threshold.

[0016] The digital LAMP-CRISPR / Cas12b kit for quantitative detection of Klebsiella pneumoniae is characterized in that the digital chip is one or more of a solid phase separation chip, a microfluidic droplet chip and other chips that can achieve digital separation.

[0017] The digital LAMP-CRISPR / Cas12b kit for quantitative detection of Klebsiella pneumoniae is characterized by: 0.5% bromhexine hydrochloride solution for Klebsiella pneumoniae detection, 1×WarmStart® LAMP premix, 1×LAMP primer, 250nM Cas12b, 250nM gRNA, 3μM ssDNA reporter molecule, 1000U / mL RNase inhibitor, 4mM Mg 2+ DEPC water is mixed with the sample to be tested to form a reaction system, and then the LAMP-CRISPR / Cas12b reaction is carried out under constant temperature conditions.

[0018] The digital LAMP-CRISPR / Cas12b kit for quantitative detection of Klebsiella pneumoniae is characterized in that, in the reaction system, the concentration of primers with nucleotide sequences such as SEQ ID NO.3 and SEQ ID NO.4 is 1 μM, the concentration of primers with nucleotide sequences such as SEQ ID NO.5 and 6 is 0.1 μM, the concentration of primers with nucleotide sequences such as SEQ ID NO.1 and SEQ ID NO.2 is 0.2 μM, the concentration of gRNA with nucleotide sequences such as SEQ ID NO.7 is 250 nM, and the concentration of ssDNA with nucleotide sequences such as SEQ ID NO.8 is 3 μM.

[0019] The digital LAMP-CRISPR / Cas12b kit for quantitative detection of Klebsiella pneumoniae is characterized in that the constant temperature condition is incubation at 60°C for 60 min.

[0020] In a first aspect, the present invention provides a LAMP primer set sequence for detecting Klebsiella pneumoniae, wherein the sequence is shown as SEQ ID NO. 1-6.

[0021] The nucleotide sequence of each primer in the above LAMP primer set is as follows (5'-3'):

[0022] Upstream external primer Khe-F3 (SEQ ID NO. 1):

[0023] ACGGCTATCTCTGGAAGCT

[0024] Downstream external primer Khe-B3 (SEQ ID NO. 2):

[0025] GTGTGGACCGAAGAACTGC

[0026] Upstream internal primer Khe-FIP (SEQ ID NO. 3):

[0027] GACGAACTTCCTGCTCGGTGTT-TGGGTTTTCCCGCTGGTA

[0028] Downstream internal primer Khe-BIP (SEQ ID NO. 4):

[0029] GGCCAACAAGAAGTACAACCGC-GTCAACCCAACGATCCTGG

[0030] Upstream loop primer Khe-LF (SEQ ID NO. 5):

[0031] GAGAAAGGTGTGGCAGATGC

[0032] Downstream loop primer Khe-LB (SEQ ID NO. 6):

[0033] ATTTATTACCCGCTCAATCCCG

[0034] The LAMP primer set for Klebsiella pneumoniae detection described above is suitable for digital LAMP-CRISPR / Cas12b technology.

[0035] In a second aspect, the present invention provides a set of nucleic acid molecules for detecting Klebsiella pneumoniae, wherein the nucleic acid molecules comprise the above-mentioned LAMP primer set for detecting Klebsiella pneumoniae, as well as gRNA and ssDNA reporter molecules. The sequences of the gRNA and ssDNA reporter molecules are shown in SEQ ID NO.7-8;

[0036] gRNA (SEQ ID NO. 7):

[0037] Gtctagaggacagaatttttcaacgggtgtgccaatggccactttccaggtggcaaagcccgttgagcttctcaaatctgagaagtggcaccatagccgggattgagcgggtaa

[0038] ssDNA (SEQ ID NO. 8):

[0039] FAM-TTATTATTAT-BHQ1

[0040] Wherein, the gRNA targets a DNA fragment of the Klebsiella pneumoniae Khe gene, and the DNA fragment is amplified using the LAMP primer set;

[0041] Preferably, the nucleotide sequence of the gRNA is as shown in SEQ ID NO. 7. The gRNA can efficiently guide the CRISPR / Cas protein to recognize the target sequence, which is beneficial to improve the cutting efficiency of the CRISPR reaction, thereby improving the specificity and sensitivity of the detection.

[0042] In a third aspect, the present invention provides a kit, the kit comprising the following reaction system: 10 μL 1×WarmStart ®LAMP premix, 1×LAMP primers (including 1μM SEQ ID NO.3 and 4, 0.1μM SEQ ID NO.5 and 6, 0.2μM SEQ ID NO.1 and 2), 500 nM Cas12b, 250 nM gRNA, 3μM ssDNA reporter gene, 1000 U / mL RNase inhibitor, 4 mM Mg 2+ , 1 μM 0.5% bromhexine hydrochloride solution, DEPC water and digital chip;

[0043] In a fourth aspect, the present invention provides use of the above-mentioned LAMP primer set, nucleic acid molecule or kit for detecting Klebsiella pneumoniae in detecting Klebsiella pneumoniae.

[0044] Preferably, the Klebsiella pneumoniae detection is a precise quantitative application.

[0045] In a fifth aspect, the present invention provides a method for non-diagnostic detection of Klebsiella pneumoniae based on digital LAMP-CRISPR / Cas12b technology, the method using the above-mentioned kit for detection, comprising: mixing 0.5% bromhexine hydrochloride solution 1×WarmStart® LAMP premix for Klebsiella pneumoniae detection, 1×LAMP primer, 250nM Cas12b, 250nM gRNA, 3μM ssDNA reporter gene, 1000U / mL RNase inhibitor, 4mM Mg2+ and DEPC water with the sample to be tested to form a reaction system, and then performing LAMP-CRISPR / Cas12b reaction under constant temperature conditions.

[0046] The digital chip of the kit is one or more of a solid phase separation chip, a microfluidic droplet chip and other chips capable of realizing digital separation; preferably, the chip is a solid phase separation chip.

[0047] The digital separation and detection principle of the solid phase separation chip is as follows Figure 1 As shown, the configured LAMP-Cas12b reaction system is added to the sample well of the scraper; the reaction system is loaded from the scraper into the solid phase in each unit of the chip; then a layer of oil phase is covered on the system so that the reaction system in each unit is separated by the solid phase chip and the oil phase to form a digital array. The chip is placed in a 60°C water bath for 1 hour, and the endpoint fluorescence of about 15,000 partitions is detected by a biochip analyzer and the threshold is determined based on the fluorescence distribution of the partitions, and the percentage of positive partitions and the input nucleic acid concentration are calculated based on the threshold.

[0048] Compared with the existing technology, it has the following advantages:

[0049] (1) The specific binding of Cas12b reduces the false positive signals of primer dimers and false amplification products in traditional LAMP, and provides secondary recognition of amplification products. In the test, digital LAMP-CRISPR / Cas12b can distinguish Klebsiella pneumoniae from seven common pathogens of respiratory tract infection, including Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae, Legionella pneumophila, and Mycoplasma pneumoniae. It has high specificity.

[0050] (2) The solid phase separation chip has absolute quantitative performance, and the quantitative range of Klebsiella pneumoniae DNA can reach 5 to 50,000 copies / μL (R 2 ≈0.93).

[0051] (3) Acidic glycoproteins in sputum are inhibitory factors for Bst polymerase. This method uses 0.5% bromhexine hydrochloride solution to remove acidic glycoproteins, which reduces the negative impact of inhibitory factors on nucleic acid concentration and increases the detection sensitivity of the digital LAMP-CRISPR / Cas12b method for thermal lysis samples without nucleic acid extraction.

[0052] (4) Compared with the isolation and culture method and qPCR commonly used in clinical practice, the digital LAMP-CRISPR / Cas12b method has better quantitative and qualitative detection performance for sputum samples. Compared with the isolation and culture results, the sensitivity of this method is 100%, while the sensitivity of qPCR compared with the isolation and culture method is 96%.

[0053] (5) The activity and non-specific cutting effect of Cas12b are easily affected by DNA concentration. We combined it with a digital chip. The number of DNA in each unit was considered to be 0 or 1. The detection method was to perform an independent reaction in each unit, and then calculate the original concentration based on the total number of negative and positive units. Therefore, in theory, the stability of digital chip detection is not affected by DNA concentration within a certain range.

[0054] (6) The present invention provides a kit and method for quantitatively detecting Klebsiella pneumoniae based on digital LAMP-CRISPR / Cas12b. This method combines the specificity of LAMP-CRISPR / Cas12b with the absolute quantitative advantage of digital detection technology, and can accurately and rapidly perform quantitative detection of Klebsiella pneumoniae under constant temperature conditions within 60 minutes, with high sensitivity and specificity.

[0055] Compared with qPCR, this method has the following advantages: (1) Simple reaction conditions: qPCR technology requires precise temperature control equipment, and the operation process is relatively complex, with high requirements for experimental conditions. The digital LAMP-CRISPR / Cas12b technology developed by this method only needs to be carried out under a constant temperature of 60°C, without the need for complex temperature cycling equipment; (2) Faster detection speed: This method completes the detection within 60 minutes, showing greater advantages in detecting large quantities of samples and those that require urgent testing; (3) Higher accuracy: This method achieves secondary amplification and secondary recognition of the target through the rapid amplification of LAMP and the high specificity detection of the CRISPR / Cas12b system, further realizing high-sensitivity and high-specificity nucleic acid detection. In addition, our results also support that compared with qPCR, digital LAMP-CRISPR / Cas12b has better sensitivity and specificity in clinical sample detection. Therefore, the advantages of the digital LAMP-CRISPR / Cas12b method, such as speed, simplicity, high specificity and high sensitivity, can provide patients with more timely and accurate treatment options, thereby improving prognosis, reducing the occurrence of complications, and reducing overall medical costs.

[0056] (7) The present invention provides a rapid, stable and accurate solution for the sensitive qualitative and absolute quantitative analysis of Klebsiella pneumoniae in clinical sputum samples, and provides a useful means for early screening, disease monitoring and treatment evaluation of early Klebsiella pneumoniae infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 This is the digital array formation principle of the chip in the present invention.

[0058] Figure 2 It is the real-time reaction of LAMP and LAMP-Cas12b with target DNA or NTC respectively in the present invention.

[0059] Figure 3 It is a test of the specificity of the digital LAMP-CRISPR / Cas12b method of the present invention.

[0060] Figure 4 This is a test of the digital LAMP-CRISPR / Cas12b method of the present invention on target DNA of different concentrations.

[0061] Figure 5 This is a test of the detection performance of the digital LAMP-CRISPR / Cas12b method in the present invention on clinical sputum samples. DETAILED DESCRIPTION

[0062] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention.

[0063] Example 1 Primer and gRNA design

[0064] LAMP primers were designed based on the Khe gene of Klebsiella pneumoniae in GenBank according to the design principles of LAMP primers and gRNA.

[0065] Since the LAMP-CRISPR / Cas12b method involves Cas protein reactions, many LAMP primers directly designed using primer design software are not suitable for LAMP-CRISPR / Cas12b detection. Therefore, the present invention combines the detection strategy of LAMP-CRISPR / Cas12b technology to adjust and optimize LAMP primers. First, LAMP primers should avoid complementarity with gRNA; secondly, LAMP primers and gRNA should minimize overlap. Primers that meet the above conditions are specifically analyzed by Blast on the NCBI website, and the LAMP primer set with the best specificity is selected and sent to Beijing Qingke Biotechnology Co., Ltd. for synthesis. The above-mentioned LAMP primer set is obtained by continuous optimization and screening of the present invention, which can achieve high amplification efficiency, sensitivity and specificity, and is also suitable for the LAMP-CRISPR / Cas12b detection method.

[0066] Five specific primers were designed for the six regions of the target gene: two outer primers (F3 and B3), two inner primers (FIP and BIP), and additional upstream loop primers (LF) and downstream loop primers (LB) were added. Khe gene-specific gRNA was designed near the PAM site (5'-TTN-3') of the LAMP amplification product. The sequences of the primers and gRNA used in this study are shown in Table 1.

[0067] Table 1

[0068] Example 2 Removal of inhibitors from sputum

[0069] The components of sputum samples after thermal lysis mainly include water, acidic glycoproteins, and nucleic acids. Acidic glycoproteins can inhibit the activity of Bst DNA polymerase by binding to the active site of Bst DNA polymerase. Therefore, in order to reduce the negative impact of acidic glycoproteins on nucleic acid concentration, we added 0.5% bromhexine hydrochloride solution to the sample to cleave the polysaccharide fibers in acidic glycoproteins. 6The Klebsiella pneumoniae khe gene plasmid stock solution diluted by 100 times was divided into 4 parts, respectively labeled as S1, S2, S3, and S4. Among them, S2 added 0.5% bromhexine hydrochloride solution, S3 added water and acidic glycoprotein, and S4 added 0.5% bromhexine hydrochloride solution, water, and acidic glycoprotein. The digital LAMP-CRISPR / Cas12b method (see Example 3 for specific description) was used for detection.

[0070] The experimental results are shown in Table 2. The deviation of the S1 and S2 test results is small, indicating that 0.5% bromhexine hydrochloride solution has no significant effect on the LAMP-CRISPR / Cas12b reaction system.

[0071] Taking the test result of S1 as the standard, the test results of S3 and S4 were compared, and S4 was closer to the test result of S1, indicating that in sputum samples, the samples with bromhexine hydrochloride added had higher sensitivity than the samples with simple thermal lysis.

[0072] The introduction of bromhexine hydrochloride not only has no effect on the reaction system, but also can specifically cleave the acidic glycoprotein structure in the sputum sample, especially its polysaccharide fiber part, thereby effectively protecting the nucleic acid molecules from the influence of inhibitory substances. This process optimizes the nucleic acid extraction efficiency of the sample, and can achieve efficient and accurate amplification and detection even when the target nucleic acid copy number is low.

[0073] Table 2

[0074] Example 3 Digital LAMP-Cas12b method

[0075] A method for detecting Klebsiella pneumoniae based on a digital LAMP-CRISPR / Cas12b method, wherein the method uses the above-mentioned kit for detection, and specifically comprises the following steps:

[0076] Step 1: The sample was thermally cracked at 80°C for 10 min.

[0077] The method for using the kit described in step 2 is to mix 0.5% bromhexine hydrochloride solution for Klebsiella pneumoniae detection, 1×WarmStart® LAMP premix, 1×LAMP primer, 250nM Cas12b, 250nM gRNA, 3μM ssDNA reporter gene, 1000U / mL RNase inhibitor, 4mM Mg 2+ and DEPC water with 1μL of the sample to be tested to form a reaction system.

[0078] In the digital LAMP-CRISPR / Cas12b reaction system, the concentration of primers with nucleotide sequences such as SEQ ID NO.3 and 4 is 1 μM, the concentration of primers with nucleotide sequences such as SEQ ID NO.5 and SEQ ID .6 is 0.1 μM, and the concentration of primers with nucleotide sequences such as SEQ ID NO.1 and SEQ ID NO.2 is 0.2 μM.

[0079] The 20 μL digital LAMP-CRISPR / Cas12b reaction system includes the following components: 10 μL 1×WarmStart ® LAMP premix, 1×LAMP primers (including 1μM SEQ ID NO.3 and SEQ ID 4, 0.1μM SEQ ID NO.5 and SEQID.6, 0.2μM SEQ ID NO.1 and 2), 500 nM Cas12b, 250 nM gRNA, 3 μM ssDNA reporter gene, 1000 U / mL RNase inhibitor, 4 mM Mg 2+ , 1 μM 0.5% bromhexine hydrochloride solution and DEPC water.

[0080] Step 3: Place the mixed system in a constant temperature water bath to carry out the digital LAMP-CRISPR / Cas12b reaction. The constant temperature condition is 60°C and the reaction time is 60 minutes.

[0081] Step 4: Using the ZZBio Digital PCR System, take 20 μL of the LAMP-CRISPR / Cas12b reaction system solution and add it to the sample well of the scraper. Then load it from the scraper to the solid phase in each unit of the chip; then cover the system with a layer of oil phase ( Figure 1 );

[0082] Step 5: Use a fluorescence microscope to collect fluorescence images after the reaction using the FAM fluorescence channel; after incubation, transfer the chip to a confocal microscope (Leica TCS SP5, Leica Microsystems, Germany) and use a 10× objective lens for fluorescence detection. Under excitation at a wavelength of 486 nm, the emission light of the FAM channel passes through a 500 nm long-pass filter and is then measured by a CCD camera.

[0083] Step 6: Quantify and analyze the fluorescence image collected by the FAM fluorescence channel to obtain a fluorescence intensity scatter plot, and then distinguish it by threshold to obtain the number of negative microchambers and positive microchambers in the fluorescence intensity scatter plot. Use MATLAB software to analyze the collected fluorescence images. Convert the color fluorescence image to an 8-bit grayscale image, and identify the droplets using the Hough algorithm. Then, record the grayscale value of each identified droplet and classify it as negative or positive. The threshold is set to 1.5 times the fluorescence intensity emitted by the negative control.

[0084] Step 7: Calculate the sample copy number concentration according to Poisson distribution. The copy number concentration is calculated as follows:

[0085]

[0086] In the formula: Assume that the total number of target gene copies in the test product is (M), the total number of partition units is (N), and the percentage of negative units in the partition is (E).

[0087] Example 4 LAMP and CRISPR / Cas12b system testing

[0088] (1) Feasibility test

[0089] To test the performance of the LAMP-CRISPR / Cas12b system (Example 3) in detecting Klebsiella pneumoniae, we used a positive sample (Positive) of the Klebsiella pneumoniae genomic DNA standard to test the fluorescence signal changes of the simple fluorescence LAMP reaction and the LAMP-CRISPR / Cas12b reaction. The results of the simple fluorescence LAMP experiment showed that the positive sample produced an amplification signal in 15-30 minutes, while the control group (NTC) began to produce non-specific amplification signals at 40 minutes of reaction ( Figure 2 a). This is because LAMP requires multiple primers, and non-template amplification is difficult to avoid completely. Therefore, in order to improve specificity, we introduced the CRISPR / Cas12b system into the LAMP system and performed the LAMP-CRISPR / Cas12b test. The results showed that the fluorescence signal intensity of the positive sample gradually increased over time and gradually saturated after 60 minutes. Compared with the positive sample, the NTC sample did not show a fluorescent signal, which proves that the LAMP-CRISPR / Cas12b system can effectively avoid the signal generated by non-template amplification ( Figure 2 b).

[0090] (2) Method specificity test

[0091] To evaluate specificity, Klebsiella pneumoniae genomic DNA was used as a target and tested with the genomic DNA of the seven most common bacteria in acute respiratory tract infections. We compared the results of digital LAMP-CRISPR / Cas12b (Example 3) detection of Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae, Legionella pneumophila, and Mycoplasma pneumoniae. The experimental data showed that the positive signal was only detected in the Klebsiella pneumoniae DNA sample ( Figure 3 a), in the control group ( Figure 3 b, 3c, 3d, 3e, 3f, 3g), indicating that the method has high specificity.

[0092] (3) Quantitative performance test

[0093] In order to evaluate the quantitative performance and sensitivity of the digital LAMP-CRISPR / Cas12b method (Example 3), this method was used to quantitatively detect different concentrations of Klebsiella pneumoniae DNA (500,000 to 5 copies / μL). The test results showed that ( Figure 4 a and Figure 4 b, Table 3), the number of positive partitions gradually decreased with the dilution of the sample, and no positive partitions were detected in the NTC (no template control). The target DNA concentration was calculated based on the number of positive partitions, and the linear model showed that the concentration quantified by the digital LAMP-CRISPR / Cas12b method showed a strong linear relationship with the target input concentration (R 2 ≈0.93). The dynamic range of the digital LAMP-CRISPR / Cas12b method was 5 to 50,000 copies / μL.

[0094] Table 3

[0095]

[0096] (4) Testing of clinical quantitative performance

[0097] To test the efficacy of the digital LAMP-CRISPR / Cas12b method, 72 clinical sputum samples from patients with respiratory tract infections were quantitatively detected for Klebsiella pneumoniae using the digital LAMP-CRISPR / Cas12b method. Figure 5 a and Figure 5 b lists representative clinical samples, and the quantitative result is 2379 copies. Among the 72 samples, 50 samples were positive for Klebsiella pneumoniae by digital LAMP-CRISPR / Cas12b method, 51 samples were positive by qPCR, and 50 samples were positive by isolation culture ( Figure 5c). Linear regression and correlation analysis were performed on 50 samples that were positive by both the digital LAMP-CRISPR / Cas12b method and qPCR, and the correlation coefficient was 0.9170 ( Figure 5 d). Digital LAMP-CRISPR / Cas12b detected all sputum samples of Klebsiella pneumoniae that were positive for isolation and culture, with a sensitivity of 100% and a specificity of 100%. Taking the isolation and culture method as the gold standard, the sensitivity of qPCR was 96% and the specificity was 83%. The sensitivity and specificity of this method were higher than those of the qPCR method. These results show that the digital LAMP-CRISPR / Cas12b method has good quantitative detection performance for clinical sputum samples. This advantage means that under the same conditions, the digital LAMP-CRISPR / Cas12b method can more accurately identify the presence of Klebsiella pneumoniae and reduce the possibility of missed detection. Accurate quantification of the load of Klebsiella pneumoniae helps to determine the severity of the disease, and the dynamic changes in the load of Klebsiella pneumoniae during the infection process are closely related to the treatment effect. Therefore, this method can provide a more reliable basis for clinical diagnosis and treatment.

[0098] In addition, compared with qPCR, this method has the following advantages: (1) Simple reaction conditions: qPCR technology requires precise temperature control equipment, and the operation process is relatively complex, with high requirements for experimental conditions. The digital LAMP-CRISPR / Cas12b technology developed by this method only needs to be carried out under a constant temperature of 60°C, without the need for complex temperature cycling equipment; (2) Faster detection speed: This method completes the detection within 60 minutes, showing greater advantages in detecting large quantities of samples and those that require urgent testing; (3) Higher accuracy: This method achieves secondary amplification and secondary recognition of the target through the rapid amplification of LAMP and the high specificity detection of the CRISPR / Cas12b system, further realizing high-sensitivity and high-specificity nucleic acid detection. In addition, our results also support that compared with qPCR, digital LAMP-CRISPR / Cas12b has better sensitivity and specificity in clinical sample detection. Therefore, the advantages of the digital LAMP-CRISPR / Cas12b method, such as speed, simplicity, high specificity and high sensitivity, can provide patients with more timely and accurate treatment options, thereby improving prognosis, reducing the occurrence of complications, and reducing overall medical costs.

Claims

1. A group of nucleic acid molecules for detecting Klebsiella pneumoniae, characterized in that: The nucleic acid molecule comprises a LAMP primer set for detecting Klebsiella pneumoniae as well as gRNA and ssDNA reporter molecules; The LAMP primer set comprises primers with nucleotide sequences as shown in SEQ ID NO.1-6; The gRNA targets a DNA fragment of the Klebsiella pneumoniae Khe gene, the DNA fragment is amplified using the LAMP primer set, and its nucleotide sequence is shown in SEQ ID NO.7; The nucleotide sequence of the ssDNA reporter molecule is shown in SEQ ID NO.

8.

2. The digital LAMP-CRISPR / Cas12b kit for quantitative detection of Klebsiella pneumoniae prepared by nucleic acid molecules according to claim 1, characterized in that: The kit comprises the 0.5% bromhexine hydrochloride solution for the detection of Klebsiella pneumoniae, WarmStart ® LAMP premix, LAMP primer set, Cas12b, gRNA, ssDNA reporter, RNase inhibitor, Mg 2+ , DEPC water and digital chip.

3. The digital LAMP-CRISPR / Cas12b kit for quantitative detection of Klebsiella pneumoniae according to claim 2, characterized in that: The digital chip of the kit is a solid phase separation chip. The configured LAMP-Cas12b reaction system is added to the sample loading hole of the scraper; the reaction system is loaded from the scraper into the solid phase in each unit of the chip; then a layer of oil phase is covered on the system so that the reaction system in each unit is separated by the solid phase chip and the oil phase to form a digital array; the chip is placed in a 60°C water bath for incubation for 1 hour, the endpoint fluorescence of 15,000 partitions is detected by a biochip analyzer, and the threshold is determined according to the fluorescence distribution of the partitions, and the percentage of positive partitions and the input nucleic acid concentration are calculated according to the threshold.

4. The digital LAMP-CRISPR / Cas12b kit for quantitative detection of Klebsiella pneumoniae according to claim 2, characterized in that The digital chip is one or more of a solid phase separation chip, a microfluidic droplet chip and other chips that can realize digital separation.

5. The digital LAMP-CRISPR / Cas12b kit for quantitative detection of Klebsiella pneumoniae according to claim 2, characterized in that: 0.5% bromhexine hydrochloride solution for Klebsiella pneumoniae detection, 1×WarmStart® LAMP premix, 1×LAMP primer, 250nM Cas12b, 250nM gRNA, 3μM ssDNA reporter molecule, 1000U / mL RNase inhibitor, 4mM Mg 2+ DEPC water is mixed with the sample to be tested to form a reaction system, and then the LAMP-CRISPR / Cas12b reaction is carried out under constant temperature conditions.

6. The digital LAMP-CRISPR / Cas12b kit for quantitative detection of Klebsiella pneumoniae according to claim 5, characterized in that In the reaction system, the concentration of primers with nucleotide sequences such as SEQ ID NO.3 and SEQ ID NO.4 is 1 μM, the concentration of primers with nucleotide sequences such as SEQ ID NO.5 and 6 is 0.1 μM, the concentration of primers with nucleotide sequences such as SEQ ID NO.1 and SEQ ID NO.2 is 0.2 μM, the concentration of gRNA with nucleotide sequence such as SEQ ID NO.7 is 250 nM, and the concentration of ssDNA with nucleotide sequence such as SEQ ID NO.8 is 3 μM.

7. The digital LAMP-CRISPR / Cas12b kit for quantitative detection of Klebsiella pneumoniae according to claim 6, characterized in that The constant temperature condition is incubating at 60°C for 60 min.

Images