Method for creating ear-increasing corn germplasm and application thereof

Abstract

The invention discloses a method for creating ear growth corn germplasm and application of the method. Belongs to the technical field of plant genetic engineering. The invention firstly provides sgRNA for creating ear growth corn germplasm. The sgRNA comprises sgRNA of a specific targeting corn transcription factor ZmGHD7, wherein the sequence of the sgRNA is shown as SEQ ID NO. 1. According to the sgRNA and CRISPR / Cas9 knockout vector provided by the invention, the targeting efficiency of the corn transcription factor ZmGHD7 can be remarkably improved, and the ear length of corn can be effectively increased, so that ear growth corn germplasm can be quickly created.

Description

Technical Field

[0001] The present invention relates to the technical field of plant gene engineering, and more particularly to a method for creating corn germplasm with increased ear size and its application. Background Art

[0002] Gene editing is a technology for targeted and precise modification of genes, mainly including zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats / CRISPR-associated nuclease (CRISPR / Cas). The CRISPR / Cas system is roughly divided into three types: type I, type II and type III. Among them, the type II system is relatively simple in composition, requiring only three components: Cas9 protein, tracrRNA and crRNA to function, and is highly efficient and easy to operate, making it the most widely used genome editing system. The characteristic protein of the type II CRISPR / Cas system is Cas9, which has two nuclease domains, RuvC and HNH, which are responsible for cutting the two strands of the target DNA, thereby causing double-strand breaks in the target DNA. The HNH domain is responsible for cutting the DNA chain complementary to crRNA, and the cutting site is located 3bp upstream of the protospacer adjacent motif (PAM), while the RuvC domain is responsible for cutting the non-complementary chain, and the cutting site is located 3 to 8bp upstream of PAM. The Cas9 protein has the function of processing and producing crRNA and cutting exogenous nucleic acids. crRNA binds to tracrRNA through base pairing to form a tracrRNA / crRNA complex. Researchers can use tracrRNA and crRNA as two guide RNAs (gRNAs) or fuse the two together to form a single guide RNA (sgRNA). sgRNA can bind to the Cas9 nuclease and guide Cas9 to the genome to cut the target site. The CRISPR / Cas9 system causes double-strand breaks in the target gene DNA, activates the DNA damage repair mechanism in the cell, and then produces mutations such as deletions and knock-ins. At present, the CRISPR / Cas9 system has been rapidly used in the targeted editing research of the genomes of different plants, such as Arabidopsis, tobacco, sorghum, rice, wheat, and corn, and has obtained a high induced mutation rate and stably inherited genome-edited plants.

[0003] Corn is one of the most widely planted cereal crops in the world. It has a wide range of application values. It is not only a raw material for food and animal feed, but also an industrial raw material for producing a series of high value-added products such as starch, beverages, medicines and alcohol. With the development of social economy and the continuous improvement of people's living standards, there is an increasing demand for the yield and quality of corn.

[0004] At present, the increase in my country's total corn production is mainly due to the increase in the cultivated area, but the increase in yield per unit area is not large. However, the growth space for corn cultivated area is already very limited. Therefore, increasing the yield per unit area is the main goal of corn breeding. There is still a lot of room for improvement in my country's corn yield per unit area.

[0005] How to increase corn yield per unit area is the core issue of corn breeding for a long time to come. The main components of corn yield per unit area include effective ear, grain weight and number of grains per row. As an important yield component, ear length plays an important role in improving yield traits. Properly increasing ear length can promote yield increase, thereby achieving large-scale corn yield per unit area and improving national food security.

[0006] In the process of corn breeding, yield traits have always been the traits that breeders pay the most attention to. However, yield is a complex quantitative trait with low heritability, and it is difficult to improve it through direct selection. Dividing corn yield into different yield components for genetic analysis, and then clarifying the genetic regulation mechanism of the synergistic construction of each yield component, has important guiding significance for improving corn yield traits through molecular breeding. A large number of studies have been conducted at home and abroad on the relationship between yield-related traits and yield and their genetic characteristics. Studies have found that the number of kernels per row has the greatest positive effect on yield, followed by 1000-grain weight, ear length and number of rows of ears, while ear height is negatively correlated with yield. Nemati (2009)'s study showed that the number of kernels per ear has the highest correlation with yield (r = 0.53), and has a greater effect on the selection of corn varieties than other traits. The number of kernels per row and kernel depth also have an important impact on yield. Pavan et al. (2011) found that traits such as plant height, ear length, ear thickness, number of rows of ears, number of kernels per row, and 100-grain weight have a significant positive correlation with yield. It can be seen that the ear traits of corn, mainly including ear length, number of ear rows, number of kernels per row and 100-kernel weight, are traits closely related to yield. Improving ear traits is of great significance to increasing yield. Among them, ear length determines the number of kernels per row that a corn ear can carry, and is one of the important components of corn yield.

[0007] In summary, how to provide a method for creating corn germplasm with increased ear size is an urgent problem that technicians in this field need to solve. Summary of the invention

[0008] In view of this, the present invention provides a method for creating corn germplasm with increased ear growth and application thereof.

[0009] The present invention targets the corn transcription factor ZmGHD7 (Zm00001eb023220) and utilizes gene editing technology to cause a frameshift mutation in the gene, thereby rapidly creating long-ear corn germplasm.

[0010] In order to achieve the above object, the present invention adopts the following technical solution:

[0011] sgRNAs for creating ear-growth corn germplasm, including:

[0012] The sequence of the sgRNA specifically targeting maize transcription factor ZmGHD7 is shown in SEQ ID NO.1.

[0013] AGGACCACGACAGCGTCACG, SEQ ID NO.1.

[0014] The present invention further provides a CRISPR / Cas9 gene knockout vector containing the sgRNA.

[0015] Preferably, the CRISPR / Cas9 gene knockout vector is a CPB-Cas9 vector connected to the sgRNA.

[0016] The present invention further provides a kit for creating corn germplasm with increased ear size, comprising any one of the following:

[0017] (1) the sgRNA;

[0018] (2) a DNA molecule encoding the sgRNA;

[0019] (3) The CRISPR / Cas9 gene knockout vector.

[0020] The present invention further provides use of the sgRNA or the CRISPR / Cas9 gene knockout vector or the kit in knocking out maize transcription factor ZmGHD7.

[0021] The present invention further provides the use of the sgRNA or the CRISPR / Cas9 gene knockout vector or the kit in creating corn germplasm with increased cob size.

[0022] The present invention also provides a method for creating corn germplasm with increased ear growth, comprising:

[0023] The CRISPR / Cas9 gene knockout vector is introduced into BMEHA105 Agrobacterium competent cells to obtain recombinant Agrobacterium; the recombinant Agrobacterium is used to infect corn callus tissue; and then the obtained positive callus tissue is induced and cultured to obtain regenerated plants.

[0024] The present invention further provides a primer combination for detecting the mutation effect of genes related to ear growth corn germplasm, including: primers with sequences shown in SEQ ID NOs. 2-3.

[0025] 5'-ACGTCAAGAGAGCGAGTTCATT-3', SEQ ID NO.2;

[0026] 5'-GACTTGTCCAGGGGCGATCATG-3', SEQ ID NO. 3.

[0027] It can be seen from the above technical solution that, compared with the prior art, the beneficial effects achieved by the present invention are:

[0028] The sgRNA and CRISPR / Cas9 knockout vector provided by the present invention can significantly improve the targeting efficiency of the maize transcription factor ZmGHD7, effectively increase the length of the corn cob, and thus quickly create corn germplasm with increased cob length. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0030] Figure 1 This is the mutant detection in Example 1 of the present invention, wherein A is the Bar detection in the corn field, C represents the Bar test strip Control quality control line, and T represents the Test detection result; B is the Cas9 gene PCR detection result; 1 to 8 represent different mutant corn plants, 9 represents the negative control, and 10 represents the positive control;

[0031] Figure 2 This is the gene editing vector and mutation identification in Example 1 of the present invention, wherein Figure A and Figure B are gene editing vectors; Figure C is the mutation occurring in the region bound by sgRNA;

[0032] Figure 3This is a comparison of corn ear morphology before and after knocking out the corn transcription factor ZmGHD7 (Zm00001eb023220) in Example 1, wherein Figure A is an appearance diagram; Figure B is a statistical result; in the figure, ** indicates P<0.01, and the difference is extremely significant. DETAILED DESCRIPTION

[0033] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0034] The drugs required for the present invention are conventional experimental drugs, which are purchased from commercial channels; the experimental methods not mentioned are conventional experimental methods and will not be described in detail here.

[0035] The corn inbred line KN5585 in the following embodiments has been recorded in: Weimi Biotechnology Co., Ltd., Huazhong Agricultural University. Transformation method of corn inbred line KN5585: CN202111129055.9[P].2023-03-31. The public can obtain the biological material from the applicant. The biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0036] The CPB-Cas9 in the following embodiments has been recorded in: Dong Le. Gene editing to create a haploid induction system for maize maternal parthenogenesis and the construction of an efficient dual fluorescent protein haploid identification system [D]. Beijing: Chinese Academy of Agricultural Sciences, 2018. The public can obtain the biological material from the applicant. The biological material is only used to repeat the experiments of the present invention and cannot be used for other purposes.

[0037] Example 1

[0038] 1 Materials and methods

[0039] 1.1 Receptor materials

[0040] The genetic transformation recipient was the maize inbred line KN5585.

[0041] 1.2 Vectors, strains and main reagents

[0042] The basic vector for gene editing is CPB-Cas9. -BluntSimple Cloning Vector, Escherichia coli strain Trans1-T1 were purchased from Beijing Quanshijin Biotechnology Co., Ltd. Hind III restriction endonuclease (NEB), KODPlus and KOD FX high-fidelity PCR amplification enzymes were mainly purchased from Beijing Bailingke Biotechnology Co., Ltd., Beijing Liuhetong Economic and Trade Co., Ltd. and other companies.

[0043] 1.3 Construction of CRISPR / Cas9 knockout vector

[0044] CRISPR / Cas9 knockout vectors such as Figure 2 A, 2B. The endogenous U6-2 promoter of maize was used to initiate sgRNA expression. sgRNA was designed based on the Zm00001eb023220 gene in the reference genome sequence B73_RefGen_v5. The sgRNA sequence was verified by Sanger sequencing in the KN5585 recipient.

[0045] The nucleotide sequence of the Zm00001eb023220 gene is as follows:

[0046]

[0047] The CRISPR / Cas9 knockout vector includes: LB, CaMVpolyA, Bar, CaMV 35S, Nos, NLS, Cas9, NLS, 3×FLAG, Ubi, 3896peomoter, DsRcd, Nos, U6-2, sgRNA, scaffold, RB.

[0048] The sequence of the elements is as follows:

[0049] CaMV polyA:

[0050] TTTCCCATAATAATGTGTGAGTAGTTCCCAGATAAGGGAATTAGGGTTTCCTATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTATTTGTAAAATACTTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCCAGTACTAAAATCCAGATC, SEQ ID NO.5.

[0051] Bar:

[0052]

[0053] CaMV 35S:

[0054] TGAGACTTTTCAACAAAGGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCAAAAGGACAGTAGAAAAGGAAGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGAACATGGTGGAGCACGACACTCTCGTCTACTCCAAGAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAACAAAGGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCAAAAGGACAGTAGAAAAGGAAGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGA,SEQ ID NO.7。

[0055] Nos:

[0056]

[0057] NLS(left)

[0058] 1 AAAAGGCCGG CGGCCACGAA AAAGGCCGGC CAGGCAAAAA AGAAAAAG,SEQ ID NO.9。

[0059] Cas9:

[0060]

[0061] <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0062] <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0063] <h2 style=";text-align:left;direction:ltr"> NLS(right)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0064] <h2 style=";text-align:left;direction:ltr"> 1 ATGGCCCCAA AGAAGAAGCG GAAGGTCGGT ATCCACGGAG TCCCAGCAGC<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0065] <h2 style=";text-align:left;direction:ltr"> 51 C, SEQ ID NO.11.<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0066] <h2 style=";text-align:left;direction:ltr"> 3×FLAG:<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0067] <h2 style=";text-align:left;direction:ltr"> GACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAG,SEQ ID NO.12。<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0068] <h2 style=";text-align:left;direction:ltr"> Ubi:<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0069] <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0070] <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0071] <h2 style=";text-align:left;direction:ltr"> 3896 peomoter:<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0072]

[0073] DsRed:

[0074] ATGGCCTCCTCCGAGAACGTCATCACCGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCCAGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTACAAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGCGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGACGGCCCCGTGATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCGCCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGACCCACAAGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATGGCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACGCCAAGCTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGCGCACCGAGGGCCGCCACCACCTGTTCCTGTAG,SEQ ID NO.15。

[0075] U6-2:

[0076] CTAATTGGCCCTTACAAAATAGCTAGACGTGCAGGTGGCTGGATGTGCGCTCCCTGAATATCAACTTGTGTCTCCCCGATTCAGTCCGCAGATGAAACTTGGTAATAACTGCAGCTGATCCGTCGTCATTCATGCTATGCAGGGGATTCGATCTTCAGCATGTGCAGTGCAGGCAACAACAATCTACGTTGTCTGGGCT TGCGATAGGTACACGACCACGAGGGAAGGCAACGCGTGATGTATGGGCCGCGCCTAAGCATCCAGCCCACGCGGGCGTGCGTCGTCGCTACGGCTTGCGGGGGAAGGGATCAAGGGACGAACCGAGAACTAGTACCAGACCGGCCAGCGAGCATTGCAGACACCGGCTTATAAGTTCAGCTGCGACCACCGCTCC, SEQ. ID NO.16.

[0077] sgRNA:

[0078] AGGACCACGACAGCGTCACG, SEQ ID NO.1.

[0079] scaffold:

[0080] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT, SEQ ID NO. 17.

[0081] 1.4 Maize genetic transformation

[0082] (1) Construct a CRISPR / Cas9 knockout vector and introduce it into BMEHA105 Agrobacterium competent cells (Beijing Bomade Gene Technology Co., Ltd., catalog number: BC303-01) to obtain the recombinant bacteria EHA105 / CRISPR / Cas9.

[0083] (2) The recombinant bacteria EHA105 / CRISPR / Cas9 obtained in step (1) were cultured in N6 liquid medium to obtain a bacterial solution OD 600nmThe recombinant Agrobacterium liquid was centrifuged at 5000r / min for 10min, the bacteria were collected, and the bacteria were suspended in the prepared infection buffer (1L infection buffer is prepared by mixing 4g of N6 salt containing N6 vitamin, 2mg 2,4-D, 100mg inositol, 0.7g L-proline, 68.4g sucrose, 36g glucose, 1mL AgNO3 (10mg / mL), 1mL As (100mol / L) and water, pH 5.2) to make OD 600nm The value is about 0.5, and then it is shaken at 28℃ and 150r / min for 0.5h to obtain the infection solution.

[0084] (3) Soak the well-growing callus of the corn inbred line KN5585 in the infection buffer for 1 hour, then transfer it to the infection solution prepared in step (2) and soak it for 15 minutes, and then dry it.

[0085] (4) The callus infected in step (3) was placed in a co-culture medium (1 L of co-culture medium was prepared by mixing 4 g of N6 salt containing N6 vitamin, 2 mg of 2,4-D, 30 g of sucrose, 8 g of agar, 1 mL of AgNO3 (10 mg / mL), 1 mL of As (100 mol / L), 3 mL of L-cysteine ​​(100 mg / mL) and water, pH 5.8), cultured at 20°C for 3 days, and then transferred to a recovery medium (1 L of recovery medium was prepared by mixing 4 g of N6 salt, 1 ml of N6 vitamin 1000×, 1.5 mg of 2,4-D, 0.7 g of L-proline, 30 g of sucrose, 5 μM AgNO3, 0.5 g of MES, 100 mg of cefotaxime, 100 mg of vancomycin, 8 g of agar and water, pH 5.8). 5.8), cultured at 28°C for 10 days, then transferred to recovery medium containing 1.5 mg / L glufosinate-ammonium, cultured in the dark at 28°C for 7 days, and positive callus was selected.

[0086] (5) The positive callus obtained in step (4) is transferred to an embryoid induction medium (1L embryoid induction medium is prepared by mixing 4.43g of MS salt containing MS vitamin (containing inositol), 0.25mg 2,4-D, 30g sucrose, 5mg 6-BA, 4g plant gel, 1mL Cefo (250mg / mL) and water, pH 5.8), cultured in the dark for 2 weeks, and then transferred to a differentiation medium (1L differentiation medium is prepared by mixing 4.43g of MS salt containing MS vitamin (containing inositol), 30g sucrose, 4g plant gel, 1mL Cefo (250mg / mL) and water, pH 5.8). After green seedlings grow, the culture medium is transferred to a rooting medium (1L rooting medium is prepared by mixing 2.215g 1 / 2MS, 30g sucrose, 51.55mgMS vitamin, 4g plant gel mixed with water, pH5.8) to take root, grow to a certain height, expose to the air for 3 days, and transplant seedlings.

[0087] (6) Take a leaf of about 3 cm from the plant, put it into a tube and grind it thoroughly, add 500 μl of Buffer (from Bar gene test strip), insert it into the Bar gene test strip (Beijing Aochuang Jinbiao Biotechnology Co., Ltd., catalog number: A07-13-413), and the plant with a positive band is the T0 generation positive plant ( Figure 1 A). The results showed that 1, 2, 4, 5, 6, 7, and 8 were positive plants.

[0088] 1.5 Verification of genetically modified ingredients

[0089] DNA was extracted and purified using a plant genomic DNA extraction kit (Tiangen, China).

[0090] Detection of T-DNA by PCR of SpCas9 gene ( Figure 1 B).

[0091] SpCas9 PCR amplification used the forward primer 5′-CAACCGGAAAGTGACCGTGA-3′, SEQ ID NO. 18 and the reverse primer 5′-CACCACCTTCACTGTCTGCA-3′, SEQ ID NO. 19.

[0092] The PCR program included 94°C for 3 min; 35 cycles of 95°C for 30 s, 58°C for 30 s, and 68°C for 20 s; and a final extension at 68°C for 10 min.

[0093] The results showed that 1, 2, 4, 5, 6, 7, and 8 were positive plants, which was consistent with the results of the Bar gene test strip.

[0094] 1.6 Mutation Detection

[0095] Primers 5'-ACGTCAAGAGAGCGAGTTCATT-3', SEQ ID NO.2 and 5'-GACTTGTCCAGGGGCGATCATG-3', SEQ ID NO.3 were designed according to the target position of the knockout vector, and the target gene of the corresponding plants was amplified by PCR, and the mutation type was analyzed by DSDecode software after sequencing. The PCR reaction system and reaction procedure were the same as those for the transgenic component verification.

[0096] 1.7 Identification of ear morphology

[0097] After all the ears of the mutant were harvested, they were dried naturally. The ears with normal and uniform growth were selected for photographing and observation. Broken, bent, and underdeveloped ears were removed, and the phenotype of full and mature ears was measured. The length from the base to the top of the corn ear (including the convex tip) was measured using a vernier caliper (accuracy 0.02mm) as the phenotypic value of the ear length. Statistical analysis of the phenotypic data of all materials was completed using SPSS26 and R software.

[0098] 2 Results and analysis

[0099] 2.1 CRISPR / Cas9 knockout vector construction and genetic transformation

[0100] The present invention successfully constructed a knockout vector of maize transcription factor ZmGHD7 (Zm00001eb023220) Figure 2 A, Figure 2 B). Through Agrobacterium-mediated genetic transformation, three positive transformation events were obtained. Centered on the location where sgRNA binds, upstream and downstream primers of this site were designed. Through PCR amplification and Sanger sequencing, it was found that a mutation occurred in the region where sgRNA binds ( Figure 2 C), and a frameshift mutation was generated.

[0101] The types of mutations include the insertion of an adenine, named event 2, and two types of base deletions that are not integer multiples of three, specifically the deletion types: four nucleotide deletions between positions 557 and 560 in the ZmGHD7 gene (corresponding to positions 557 to 560 of the Zm00001eb023220 sequence) and seven nucleotide deletions between positions 554 to 560 in the ZmGHD7 gene (corresponding to positions 554 to 560 of the Zm00001eb023220 sequence), which are named event 1 and event 3. Among them, since the bases deleted in zmghd7-3 include four bases in zmghd7-2, materials with frameshift mutations in both zmghd7-1 and zmghd7-3 were selected for identification of corn ear length.

[0102] 2.2 Identification of ear morphology

[0103] The mutants selected normal and uniform fruit ears for photographing and observing, and the phenotype of full and mature fruit ears was measured. The experimental results showed that ( Figure 3 ), through gene editing, knocking out the maize transcription factor ZmGHD7 (Zm00001eb023220) can quickly create long-ear maize germplasm.

[0104] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0105] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A sgRNA for creating corn germplasm with ear growth, characterized in that: include: The sequence of the sgRNA specifically targeting maize transcription factor ZmGHD7 is shown in SEQ ID NO.

1.

2. A CRISPR / Cas9 gene knockout vector containing the sgRNA according to claim 1.

3. The CRISPR / Cas9 gene knockout vector according to claim 2, characterized in that It is a CPB-Cas9 vector connected with the sgRNA according to claim 1.

4. A kit for creating corn germplasm with increased ear growth, characterized in that: Includes any of the following: (1) the sgRNA according to claim 1; (2) a DNA molecule encoding the sgRNA; (3) The CRISPR / Cas9 gene knockout vector according to claim 2 or 3.

5. Use of the sgRNA according to claim 1, the CRISPR / Cas9 gene knockout vector according to claim 2 or 3, or the kit according to claim 4 in knocking out maize transcription factor ZmGHD7.

6. Use of the sgRNA according to claim 1, the CRISPR / Cas9 gene knockout vector according to claim 2 or 3, or the kit according to claim 4 in creating corn germplasm with increased ear growth.

7. A method for creating corn germplasm with increased ear growth, characterized in that: include: The CRISPR / Cas9 gene knockout vector of claim 2 or 3 is introduced into BMEHA105 Agrobacterium competent cells to obtain recombinant Agrobacterium; the recombinant Agrobacterium is used to infect corn callus tissue; and then the obtained positive callus tissue is induced and cultured to obtain regenerated plants.

8. A primer combination for detecting the effect of mutation of a gene related to ear growth in corn germplasm, characterized in that: include: The primers have sequences as shown in SEQ ID NO. 2-3.

Images