Indel molecular marker for identifying ricefield eel strain in southwest region and application of Indel molecular marker

Abstract

The invention discloses an Indel molecular marker for identifying a ricefield eel strain in the southwest region. The nucleotide sequences of the Indel molecular marker are respectively shown as SEQ ID NO: 9-12 or SEQ ID NO: 13-16. The invention also provides a primer pair for amplifying the Indel molecular marker. By adopting the Indel molecular marker primer pair provided by the invention to amplify genome DNA of ricefield eel strains in different regions, the ricefield eel strains in the southwest region can be quickly screened out according to amplified fragments. When the Indel marker provided by the invention is applied to practice, the genetic identification of the ricefield eel strain in the southwest region can be quickly realized, the domestication breeding of wild germplasm resources can be accelerated, and the precise breeding can be realized.

Description

Technical Field

[0001] The invention belongs to the technical field of aquatic molecular breeding, and specifically relates to an Indel molecular marker for identifying yellow eel strains in southwest China and an application thereof. Background Art

[0002] Yellow field eel (Monopterus albus), Synbranchiformes, Synbranchidae, Monopterus, is widely distributed in rice fields, swamps and mud ponds in East Asia, South Asia and Southeast Asia. It has many advantages such as good taste, high nutritional value and outstanding flavor. It is known as one of the "special freshwater fish" with economic value in China due to its commercial importance and delicious meat. According to the 2024 China Fisheries Statistical Yearbook, the domestic production of yellow field eel has exceeded 355,000 tons, and the current resource production is in short supply and the price is high, so its market potential is huge. However, the habitat of wild yellow field eel is decreasing and its genetic resources are seriously damaged. Therefore, it is particularly necessary to accurately and targetedly screen high-quality wild resources. Southwest China is one of the seven major natural geographical divisions in China, with rich and diverse water systems and abundant high-quality germplasm resources.

[0003] Molecular markers are genetic markers based on nucleotide sequence variation within genetic material between individuals. They are specific DNA fragments that can reflect certain differences in the genome between populations. Compared with other morphological markers, cytological markers, microsatellite markers, etc., Indel markers have the advantages of simple operation, precision, high efficiency, and high repeatability. In addition, DNA from different tissues at different stages of biological development can be used for marker analysis. At present, there is no effective method for targeted screening of eel strains in different regions, so it is necessary to develop molecular markers for screening eel strains in specific regions. Summary of the invention

[0004] The purpose of the present invention is first to provide an Indel molecular marker A, B, C or D for identifying the strains of yellow eels in the southwest region.

[0005] wherein the nucleotide sequence of the Indel molecule marker A is as shown in SEQ ID NO:9 or SEQ ID NO:13; the nucleotide sequence of the Indel molecule marker B is as shown in SEQ ID NO:10 or SEQ ID NO:14; the nucleotide sequence of the Indel molecule marker C is as shown in SEQ ID NO:11 or SEQ ID NO:15; the nucleotide sequence of the Indel molecule marker D is as shown in SEQ ID NO:12 or SEQ ID NO:16;

[0006] If there is an insertion of the following sequence at the 31 bp base of the sequence shown in SEQ ID NO: 13: AACCGTGGTTTCACTTTAAGAGGCCCACTAT, then the corresponding sequence is SEQ ID NO: 9;

[0007] There is a deletion of the following sequence at 28-57 bp bases of the sequence shown in SEQ ID NO: 14: AAAAAAAAAACCCACAAGGTCTGATCTCTT, which corresponds to SEQ ID NO: 10;

[0008] There is a deletion of the following sequence at 73-101 bp bases of the sequence shown in SEQ ID NO: 15: CACATCAAATAAAATAAAAGGGCCAAGGT, which corresponds to SEQ ID NO: 11;

[0009] There is a deletion of the following sequence at the 184-204 bp base of the sequence shown in SEQ ID NO:16: CCAGTGAATACTAATAGCTTG, which corresponds to SEQ ID NO:12.

[0010] Another object of the present invention is to provide primer pair 1, primer pair 2, primer pair 3 and primer pair 4, which are respectively used to amplify the above-mentioned Indel molecular marker A, B, C or D, and the nucleotide sequences of the primer pairs are shown in SEQ ID NO: 1-8 in Table 1:

[0011] Table 1 Nucleotide sequences of four primer pairs

[0012]

[0013] When the primer pairs of SEQ ID NOs: 1-8 are used to amplify the genomic DNA of the eels in the tested area, the eel strains in the southwest region can be quickly screened out according to the amplified fragments. If the nucleotide sequences of the amplified products are shown in SEQ ID NOs: 9-12, the eel strains in the southwest region are identified; if the nucleotide sequences of the amplified products are shown in SEQ ID NOs: 13-16, the eel strains in non-southwest regions are identified.

[0014] The present invention also provides a kit for identifying yellow eel strains in the southwest region, comprising one or more of primer pair 1 as shown in SEQ ID NO: 1-2, primer pair 2 as shown in SEQ ID NO: 3-4, primer pair 3 as shown in SEQ ID NO: 5-6 or primer pair 4 as shown in SEQ ID NO: 7-8.

[0015] The present invention also provides the use of the above-mentioned Indel molecular marker, the primer pair of SEQ ID NO: 1-8 or a kit containing the primer pair shown in SEQ ID NO: 1-8 for identifying the strains of yellow eel in the southwest region.

[0016] The present invention also provides a method for identifying the strains of yellow eels in the southwest region, comprising the following steps:

[0017] (1) taking muscle tissue from the tail of the yellow eel to be tested, and using it to extract yellow eel genomic DNA;

[0018] (2) using the genomic DNA of the yellow eel as a template, and performing PCR amplification using one or more of the primer pairs shown in SEQ ID NOs: 1-2, 3-4, 5-6, or 7-8 to obtain an amplified product;

[0019] (3) The nucleotide sequences of the amplified products are compared with SEQ ID NOs: 9-12 or SEQ ID NOs: 13-16 for identification; if the nucleotide sequences of the amplified products are as shown in SEQ ID NOs: 9-12, the amplified products are identified as the yellow eel strain from the southwest region; if the nucleotide sequences of the amplified products are as shown in SEQ ID NOs: 13-16, the amplified products are identified as the yellow eel strain from outside the southwest region.

[0020] The innovative features of the present invention are as follows:

[0021] The present invention provides an Indel molecular marker for identifying the strains of yellow eels in the southwest region. The molecular marker primers required for detection provided by the present invention are used to perform PCR amplification on yellow eel strains in different regions, and whether the yellow eel strain is from the southwest region can be quickly identified according to the amplified fragment. The Indel marker provided by the present invention is applied in practice, which is conducive to rapid genetic identification, rapid screening of yellow eel strains in the southwest region, and accelerated domestication and breeding of wild yellow eel germplasm resources in the southwest region, and precise breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 :Gel electrophoresis of PCR amplification of DNA from 18 rice field eel strains using primer pair 1

[0023] Figure 2 :Gel electrophoresis of PCR amplification of DNA from 18 rice field eel strains using two pairs of primers

[0024] Figure 3 :Gel electrophoresis of PCR amplification of 18 rice field eel strains using three pairs of primers

[0025] Figure 4:Gel electrophoresis of PCR amplification of 18 eel strains using four pairs of primers

[0026] The numbers 1-18 represent the following 18 eel strains:

[0027] 1. Chongqing; 2. Yibin, Sichuan; 3. Kunming, Yunnan; 4. Hefei, Anhui; 5. Changsha, Hunan; 6. Weinan, Shaanxi; 7. Ankang, Shaanxi; 8. Ganzhou, Jiangxi; 9. Jiujiang, Jiangxi; 10. Zhanjiang, Guangdong; 11. Zhengzhou, Henan; 12. Nanning, Guangxi; 13. Dandong, Liaoning; 14. Dongying, Shandong; 15. Huai'an, Jiangsu; 16. Baoding, Hebei; 17. Sanya, Hainan; 18. Xiantao, Hubei DETAILED DESCRIPTION

[0028] The following examples are only used to further illustrate the content of the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and essence of the present invention, the modification or replacement of the method, steps or conditions of the present invention all belong to the scope of the present invention. The experimental methods without specifying specific conditions in the examples and the reagents and materials without specifying the formula are all in accordance with the conventional conditions in the art, and the reagents used can all be purchased.

[0029] The invention provides an Indel molecular marker for identifying whether a yellow eel is a yellow eel strain in the southwest region. The method for obtaining the molecular marker is as follows: based on the existing yellow eel genome sequence, yellow eels of strains in different regions are resequenced, and genome-wide association analysis is used to identify the genome region of the yellow eel strain in the southwest region that is different from the yellow eel strain in other regions, which is respectively located at the 82154891 site on chromosome 1 (Chr1) of the yellow eel, the 38387108-38387137 site on chromosome 8 (Chr8), the 12128106-12128124 site on chromosome 1 (Chr1), and the physical location of 13742169-13742189 on chromosome 1 (Chr1). The flanking sequences of 200 bp before and after the Indel mutation on the genome region are selected for primer development. After the Indel molecular marker is amplified by PCR using primers, the difference in the amplified fragments is used to identify whether the tested eel is a strain of the southwestern region. The amplified fragments that respectively conform to the nucleotide sequences of the Indel molecular marker SEQ ID NO: 9-12 of the present invention are strains of the southwestern region of the eel.

[0030] The present invention provides four pairs of primers for detecting the Indel molecular markers, and their forward and reverse primer sequences are shown in SEQ ID NOs: 1-8, respectively.

[0031] Example 1: Identification of Monopterus albus strains from 18 regions

[0032] (1) Extraction of genomic DNA from eel samples

[0033] A small piece of tail muscle of about 0.5 g was cut from the tested yellow eel, and the genomic DNA was extracted using a tissue genomic DNA extraction kit (brand: Tiangen, item number: 69504). The purity and concentration of the obtained DNA sample were detected using a NanoDrop2000 spectrophotometer. The extracted DNA can be stored at -20°C for a long time.

[0034] (2) PCR amplification of Indel molecular marker fragments

[0035] Using the above-obtained genomic DNA of yellow eel as a template, PCR amplification was performed using the primer pairs with nucleotide sequences shown in primer pair 1 SEQ ID NO: 1-2, primer pair 2 SEQ ID NO: 3-4, primer pair 3 SEQ ID NO: 5-6, or primer pair 4 SEQ ID NO: 7-8 in Table 1.

[0036] Use a premixed PCR kit with dye (brand: TaKaRa, item number: RR903A) to prepare the following 20 μl reaction system: Premix Taq 10 μl, 10 μM forward primer 0.5 μl, 10 μM reverse primer 0.5 μl, template DNA 1 μl, and add ddH2O to a total volume of 20 μl.

[0037] The PCR amplification program was as follows: pre-denaturation at 98°C for 10 min, denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, 35 cycles, and extension at 72°C for 5 min.

[0038] (3) Agarose gel electrophoresis of the amplified product

[0039] A 2% agarose gel was prepared, and the PCR amplification product was added and electrophoresed using a 50 bp DNA marker as a marker. The electrophoresis conditions were set to a voltage of 110 V and an electrophoresis time of 60 min. The bands were photographed using a gel imager to obtain gel images.

[0040] (4) Identification of amplification products

[0041] Identification was performed based on the bands on the gel image or the sequencing results of the PCR amplification products (sequencing was performed at Shanghai Sangon Biotechnology Co., Ltd.).

[0042] When a band is shown at 229 bp on the electrophoresis gel using primer pair 1 or the sequencing result of the amplified product is as shown in SEQ ID NO:9, the tested eel is a strain of eel from the southwest region; if a band is shown at 199 bp or the sequencing result of the amplified product is as shown in SEQ ID NO:13, the tested eel is a strain of eel not from the southwest region.

[0043] When a band is shown at 135 bp on the electrophoresis gel using primer pair 2 or the sequencing result of the amplified product is as shown in SEQ ID NO: 10, the tested eel is a strain of eel from the southwest region; if a band is shown at 165 bp or the sequencing result of the amplified product is as shown in SEQ ID NO: 14, the tested eel is a strain of eel not from the southwest region.

[0044] When a band is shown at 142 bp on the electrophoresis gel using primer pair 3 or the sequencing result of the amplified product is as shown in SEQ ID NO: 11, the tested eel is a strain of eel from the southwest region; if a band is shown at 171 bp or the sequencing result of the amplified product is as shown in SEQ ID NO: 15, the tested eel is a strain of eel not from the southwest region.

[0045] When a band is shown at 210 bp on the electrophoresis gel using primer pair 4 or the sequencing result of the amplified product is as shown in SEQ ID NO: 12, the tested eel is a strain of eel from the southwest region; if a band is shown at 231 bp or the sequencing result of the amplified product is as shown in SEQ ID NO: 16, the tested eel is a strain of eel not from the southwest region.

[0046] The experimental results are as follows Figure 1-Figure 4 shown.

[0047] Figure 1 The amplified product bands of samples 1-3 are located at 229 bp, and the amplified product bands of samples 4-18 are located at 199 bp.

[0048] Figure 2 The amplified product bands of samples 1-3 are located at 135 bp, and the amplified product bands of samples 4-18 are located at 165 bp.

[0049] Figure 3 The amplified product bands of samples 1-3 were located at 142 bp, and the amplified product bands of samples 4-18 were located at 171 bp.

[0050] Figure 4 The amplified product bands of samples 1-3 are located at 210 bp, and the amplified product bands of samples 4-18 are located at 231 bp.

[0051] from Figure 1-Figure 4 It can be clearly seen that eels No. 1-3 from Chongqing, Yibin, Sichuan, and Kunming, Yunnan are indeed from the southwest region, while eels No. 4-18 come from other regions.

[0052] The above results show that the use of the Indel molecular markers A, B, C, and D can effectively identify whether it is a yellow eel strain in the southwest region. Therefore, the Indel marker provided by the present invention is conducive to the rapid genetic identification of yellow eel strains, accelerates the domestication and breeding of wild yellow eel germplasm resources in the southwest region, and realizes precision breeding.

Claims

1. An Indel molecular marker A, B, C or D for identifying the strains of yellow eels in the southwest region, characterized in that The nucleotide sequence of the Indel molecule marker A is shown in SEQ ID NO: 9 or SEQ ID NO: 13; the nucleotide sequence of the Indel molecule marker B is shown in SEQ ID NO: 10 or SEQ ID NO: 14; the nucleotide sequence of the Indel molecule marker C is shown in SEQ ID NO: 11 or SEQ ID NO: 15; the nucleotide sequence of the Indel molecule marker D is shown in SEQ ID NO: 12 or SEQ ID NO:

16.

2. A primer pair for amplifying the Indel molecular marker A, B, C or D according to claim 1, which is used to amplify the Indel molecular marker A, B, C or D, respectively, characterized in that The nucleotide sequence of the primer pair 1 is shown in SEQ ID NO: 1-2; the nucleotide sequence of the primer pair 2 is shown in SEQ ID NO: 3-4; the nucleotide sequence of the primer pair 3 is shown in SEQ ID NO: 5-6; and the nucleotide sequence of the primer pair 4 is shown in SEQ ID NO: 7-8.

3. A kit for identifying the strains of yellow eels in the southwest region, characterized in that It comprises one or more of primer pair 1 as shown in SEQ ID NO: 1-2, primer pair 2 as shown in SEQ ID NO: 3-4, primer pair 3 as shown in SEQ ID NO: 5-6 or primer pair 4 as shown in SEQ ID NO: 7-8.

4. Use of the Indel molecular marker A, B, C or D according to claim 1 for identifying the strains of yellow eels in southwest China.

5. Use of primer pairs 1, 2, 3, and 4 described in claim 2 for identifying strains of yellow eels in southwest China.

6. Use of the kit according to claim 3 for identifying strains of yellow eels in southwest China.

7. A method for identifying the strain of yellow eel in the southwest region, comprising the following steps: (1) taking muscle tissue from the tail of the yellow eel to be tested, and using it to extract yellow eel genomic DNA; (2) using the genomic DNA of the yellow eel as a template, and performing PCR amplification using one or more of the primer pairs shown in SEQ ID NOs: 1-2, 3-4, 5-6, or 7-8 to obtain an amplified product; (3) The nucleotide sequences of the amplified products are compared with SEQ ID NOs: 9-12 or SEQ ID NOs: 13-16 for identification; if the nucleotide sequences of the amplified products are as shown in SEQ ID NOs: 9-12, the amplified products are identified as the yellow eel strain from the southwest region; if the nucleotide sequences of the amplified products are as shown in SEQ ID NOs: 13-16, the amplified products are identified as the yellow eel strain from outside the southwest region.

Images