Screening method of recombinase site variant

Abstract

The invention relates to the field of molecular biology, and discloses a method for rapidly screening recombinase site variants. An expression vector pUCBN comprising a Bxb1 recombinase expression cassette, a 35S promoter and an attP site located at the downstream of the 35S promoter is constructed, the plasmid and an attB site fragment subjected to PCR amplification are co-transformed into a protoplast, the attB site and the attP site are specifically recognized by utilizing serine recombinase Bxb1 to generate site-specific recombination, recombination between the vector and the fragment is achieved, and the expression vector pUCBN is obtained. Therefore, the recombinase recognition site variant is rapidly screened. Compared with a conventional method for screening recombinase sites by respectively constructing an attB site and an attP site on two vectors, the method has the advantages that the step of frequently constructing the vectors is omitted, a large amount of time and cost are saved, the method is also suitable for high-throughput screening research, recognition sites of Bxb1 recombinase can be rapidly screened in cotton, and the method is suitable for popularization and application. And a basis is provided for widening the application of the serine recombinase Bxb1 in cotton.

Description

Technical Field

[0001] The present application belongs to the field of molecular biology, and specifically relates to a method for screening recombinase site variants. Background Art

[0002] In the prior art, site-specific recombinases can recognize two specific sequences to catalyze the recombination between two DNA fragments. Site-specific recombinases are divided into serine recombinases and tyrosine recombinases, both of which have two specific recombinase recognition sites. The recombinase binds to the two recombination sites to form a synaptic complex with juxtaposed cross-sites, and then the recombinase catalyzes the cutting, chain exchange and reconnection of the DNA in the synaptic complex. Finally, the synaptic complex decomposes, releasing the recombination product to achieve site-specific recombination. At present, the more commonly used tyrosine recombinases are: Cre, Flp, Dre, etc.; the more commonly used serine recombinases are: Bxb1, phiC31, phiRV1, etc.

[0003] The serine recombinase Bxb1 recognizes two recombinase recognition sites, attB and attP. The recombinase binds to the two recognition sites to form a tetramer, and recombination occurs around the central dinucleotide of the recognition site, generating attL and attR sites, thereby achieving excision, inversion or integration. This reaction is irreversible, unless the associated recombinase directional factor (RDF) participates, the reaction of attL and attR sites to attB and attP sites can be achieved.

[0004] The study found that the two recombinase sites of Bxb1 can be divided into a conservative base part and a non-conservative base part, wherein the conservative base part is related to the specific recognition of the recombinase, while the non-conservative base part can introduce mutations without changing the recombination process, and the length of the attP site and the attB site can be changed without affecting the recombination process, so mutations can be introduced into the recognition site to produce recombinase recognition site variants to improve the recombination efficiency or recombination rate of the recombinase. However, there is currently no method for screening recombinase site variants in plants, which limits the application of recombinase in plant genome cutting and rearrangement. The present invention establishes a method for rapid screening of recombinase site variants in cotton protoplasts, which provides a basis for accelerating the application of recombinase in cotton. Summary of the invention

[0005] The present invention provides a method for screening recombinase site variants. In the traditional screening method, two recognition sites need to be constructed on two vectors, which is labor-intensive and cannot achieve high-throughput screening. However, the present invention realizes the screening of recombinase Bxb1 recombination sites in cotton, providing a basis for the application of recombinase Bxb1 in cotton.

[0006] In order to achieve the above object, the present invention proposes the following technical solutions: The present invention provides the use of Bxb1 recombinase in plants; The nucleotide sequence of the Bxb1 recombinase is shown in SEQ ID NO.1:

[0007] In the present invention, the plant includes cotton.

[0008] The present invention also provides a method for screening recombinase site variants, the screening method comprising the following steps: (1) Vector construction; (2) Primer annealing; (3) Protoplast transformation; (4) PCR amplification of the product to obtain the recombinase site variant.

[0009] In the present invention, in step (1) vector construction, the constructed vector is pUCBN containing Bxb1 recombinase; The vector backbone of the pUCBN vector is pUC-EGFP; The promoter of the pUCBN vector is 35S, and the terminator is CaMV.

[0010] In the present invention, in step (2) primer annealing, the primers include a forward primer attB F and a reverse primer attB R; In the present invention, the nucleotide sequences involved in attB F and attB R are shown in SEQ ID NO.2 and SEQ ID NO.3: attB F:acggcagggtacctcggccggcttgtcgacgacggcggtctccgt; attB R: aaaacgacggccagtgaattcgcccggatgatcctgacgacggagaccgccgtcgtcga.

[0011] In the present invention, in step (4) amplifying the product PCR, the amplification method comprises the following steps: After the protoplast transformation is completed, a DNA extraction operation is performed to obtain DNA, and the extracted DNA is subjected to a PCR reaction; When the length of the PCR reaction product is 294 bp, it indicates that a recombination reaction has occurred, and a DNA extraction kit is used to recover the DNA fragment, that is, the recombinase site variant is obtained; When the length of the PCR reaction product is less than 294 bp or exceeds 294 bp, it indicates that no recombination reaction has occurred.

[0012] In the present invention, the PCR reaction includes a forward primer pm F and a reverse primer pm R; The nucleotide sequences of the forward primer pm F and the reverse primer pm R are shown in SEQ ID NO.4: atggcaaaggatgtggaagccg and SEQ ID NO.5: attcagaagtgctgccaacgtc.

[0013] In the screening method provided by the present invention, the purpose of rapid screening of recombinase sites can be achieved by co-transforming the fragments and the vector into cells.

[0014] It is found through research that the two recombinase sites of Bxb1 can be divided into a conservative base part and a non-conservative base part, wherein the conservative base part is related to the specific recognition of the recombinase, and the non-conservative base part can introduce mutations and will not change the recombination process, and the length of the attP site and the attB site can be changed and will not affect the recombination process, so mutations can be introduced in the recognition site to produce recombinase recognition site variants to improve the recombination efficiency or recombination rate of the recombinase. However, there is no method for screening recombinase site variants in plants at present, which limits the application of recombinase in plant genome cutting and rearrangement. The present invention, through the above-mentioned method provided, constructs an expression vector pUCBN including a Bxb1 recombinase expression cassette and a 35S promoter and an attP site located downstream thereof, the plasmid and the attB site fragment amplified by PCR are co-transfected into protoplasts, the serine recombinase Bxb1 specific recognition attB site and attP site are utilized to generate site-specific recombination, the recombination between the carrier and the fragment is realized, thereby rapidly screening the recombinase recognition site variants. EGFP was split into N-terminus and C-terminus, where the N-terminus was placed behind the 35S promoter of the pUCBN plasmid and connected to the recombinase attP recognition site through the intron, and the C-terminus was connected to the intron and the recombinase attB recognition site, and amplified into a single fragment by PCR. The two were co-transfected into protoplasts, and the C-terminus of EGFP was recombined to the attP site using the Bxb1 recombinase system, and the expression of EGFP was restored under the action of the intron. This method provides a basis for accelerating the application of recombinase in cotton. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The middle left picture shows the schematic diagram of the serine recombinase Bxb1 and the recognition site attP vector (pUCBN); the right picture shows the schematic diagram of the attB site fragment; Figure 2 Schematic diagram of vector pUCBN and attB site fragment recombination; Figure 3 This is the electrophoresis diagram of Bxb1 after recombinant; Figure 4The figure shows the recombinant vector (pUCBN-EGFP) containing the serine recombinase Bxb1, the recognition site attP and N-EGFP (1-158aa) and the fragment containing the attB site and C-EGFP (159-240aa). The recognition site and EGFP are connected by an intron.

[0016] Figure 5 This is a microscopic observation of cotton protoplast cells that restored EGFP expression after recombination under the action of Bxb1 recombinase. The left is bright field, the middle is fluorescence, and the right is the effect after chimerism. DETAILED DESCRIPTION

[0017] The present application is further explained below with reference to the embodiments.

[0018] Biomaterials: pUC-EGFP vector backbone E. coli strain DH5α Chemically Competent Cell, purchased from Shanghai Weidi Biotechnology Co., Ltd.; The relevant sequence synthesis and sequencing work were provided and completed by GenScript Biotech Co., Ltd. and Sangon Biotech (Shanghai) Co., Ltd.

[0019] Main reagents: PCR products and vectors were recovered using an agarose gel DNA recovery kit (enhanced) and an ultrathin DNA product purification kit, purchased from Beijing Tiangen Biotechnology Co., Ltd.; Kits for DNA extraction: Polysaccharide and polyphenol plant genomic DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; The recombination reaction kit, ClonExpress ® II One Step Cloning Kit, was purchased from Nanjing Novozyme Co., Ltd.; Related restriction endonucleases are all products of New England Biolabs (NEB); Plasmid extraction was performed using an endotoxin-free plasmid extraction kit purchased from Beijing Tiangen Biotechnology Co., Ltd.

[0020] Embodiment 1 In this embodiment, the gene sequence of the Bxb1 enzyme was first optimized according to the codon preference of cotton species and synthesized by GenScript Biotech Co., Ltd. The optimized Bxb1 enzyme sequence and the recognition site attP sequence were constructed on the same vector, and the attB recognition site fragment was amplified into a single fragment by PCR.

[0021] The specific implementation process is briefly described as follows: 1. Construction of pUCDN vector The attP site was 62 bp in length. The target fragment was generated by complementary pairing of overlapping PCR primers and then connected with pUC-EGFP to construct the pUCDN vector.

[0022] The following primers were used for the attP site: attP F: taaaatccagatctcgagctggtaccctaggtcgtggtttgtctggtcaaccaccgcgg, SEQ ID NO.6; attP R: ccaccgcggtctcagtggtgtacggtacaaaccccgacggtaccggtttgctgtttgat, SEQ ID NO.7.

[0023] The PCR reaction system is shown in Table 1.

[0024] Table 1 PCR reaction system The PCR amplification program is shown in Table 2.

[0025] Table 2 PCR amplification program The amplified PCR product was recovered using an agarose gel DNA recovery kit.

[0026] The backbone plasmid of the vector was pUC-EGFP, and the vector was linearized using restriction endonuclease Xba I; The enzyme digestion system is shown in Table 3.

[0027] Table 3 Enzyme digestion system The reaction system was placed in a 37°C incubator for overnight digestion.

[0028] Recover the linearized vector using the Ultrathin DNA Product Purification Kit; Use ClonExpress ® II One Step Cloning Kit to reconstitute the linearized vector and PCR fragment according to the kit instructions; The recombinant product was transformed into E. coli strain DH5α. After overnight growth on the plate, single clones were picked for colony PCR identification to screen positive transformants; Using the Sanger sequencing method, it was confirmed that the attP site was correctly inserted into the pUC-EGFP plasmid, and the vector was named pUCDN.

[0029] 2. Construction of pUCBN vector The optimized serine recombinase Bxb1 fragment was synthesized by GenScript Biotech Co., Ltd. into the pUC-EGFP vector and the following primer pairs were used to amplify the fragment: Bxb1 F: tgattatttcttgcagctcgagatgcctaagaaaaagcggaaagttatgagag, SEQ IDNO.8; Bxb1 R: ctaaaattggtagccatctcgagctcgaggaattcagacattcccg, SEQ ID NO.9.

[0030] The PCR reaction system is shown in Table 4.

[0031] Table 4 PCR reaction system The PCR amplification program is shown in Table 5.

[0032] Table 5 PCR amplification program The amplified PCR product was recovered using an agarose gel DNA recovery kit.

[0033] The restriction endonuclease Hind-III was used to linearize the vector pUCDN. The restriction enzyme system is shown in Table 6.

[0034] Table 6 Enzyme digestion system The reaction system was placed in a 37°C incubator for overnight digestion.

[0035] Recover the linearized vector using the Ultrathin DNA Product Purification Kit; Use ClonExpress ® II One Step Cloning Kit and insert the PCR product into the linearized vector according to the kit instructions; The recombinant product was transformed into Escherichia coli strain DH5α; after overnight growth on the plate, a single clone was picked for colony PCR identification to screen positive transformants; Using the Sanger sequencing method, it was confirmed that the Bxb1 gene was correctly inserted into the pUCDN plasmid and named pUCBN.

[0036] 3. Preparation of attB site fragment The attB site fragment was amplified by overlapping PCR to obtain a double-stranded fragment. The sequence of the attB site fragment was: acggcagggtacctcggccggcttgtcgacgacggcggtctccgtcgtcaggatcatccgggcgaattcactggccgtcgtttt, SEQ ID NO.10. Protective bases were added at both ends to prevent degradation after protoplast transformation. The following primer pairs were used: attB F: acggcagggtacctcggccggcttgtcgacgacggcggtctccgt, SEQ ID NO.11; attB R: aaaacgacggccagtgaattcgcccggatgatcctgacgacggagaccgccgtcgtcga, SEQ ID NO. 12.

[0037] The PCR reaction system is shown in Table 7.

[0038] Table 7 PCR reaction system The PCR amplification program is shown in Table 8.

[0039] Table 8 PCR amplification program A PCR product with a length of 84 bp was amplified and recovered using an agarose gel DNA recovery kit.

[0040] Embodiment 2 1. Protoplast transformation

[0041] The pUCBN plasmid was extracted using an endotoxin-free plasmid miniprep kit.

[0042] Add 10 μg pUCBN and 1 μg attB fragment to 100 μL extracted and separated cotton protoplasts (about 10,000 cells), flick to mix, and place in the dark for 10 minutes. Then add protoplast transformation solution, flick to mix, and place in the dark for 30 minutes. Add W5 solution to terminate the reaction, centrifuge to discard the transformation solution, and resuspend the transformed protoplasts with W5 solution (for the specific steps of cotton protoplast preparation and transformation, see the patent "A method for preparing protoplasts and a method for transforming protoplasts and their application").

[0043] (II) Observation of recombination results After the transformed protoplasts were incubated at room temperature overnight, the protoplast DNA was extracted and amplified by PCR using primers pmF and pmR to obtain fragments, which were then detected by agarose gel electrophoresis. If a 294 bp PCR product was obtained, it indicated that a recombination reaction had occurred, and the PCR product was verified by Sanger sequencing.

[0044] The PCR reaction system of protoplast products is shown in Table 9.

[0045] Table 9 Protoplast product PCR reaction system

[0046] Embodiment 3 In this example, N-EGFP and intron were constructed into pUCBN vector, and co-transfected with a fragment containing C-EGFP, intron and attB site into protoplasts, and fluorescence was observed under a microscope to determine whether recombination occurred.

[0047] 1. Vector construction The N-EGFP fragment was amplified from the pUC-EGFP vector using the following primer pair: EGFP-N F: tttacgaacgatagactagtgtacatggtgagcaagggcgag, SEQ ID NO.13; EGFP-NR:ggagaggagaagcagcgtacctgcttgtcggccatgatatagacg, SEQ ID NO. 14.

[0048] The PCR reaction system is shown in Table 10.

[0049] Table 10 PCR reaction system

[0050] The PCR amplification program is shown in Table 11.

[0051] Table 11 PCR amplification program

[0052] The amplified PCR product was recovered using an agarose gel DNA recovery kit.

[0053] The intron length is 52 bp. The above PCR product was used as a template for the second round of amplification to connect the intron. The following primer pairs were used: EGFP-N F: tttacgaacgatagactagtgtacatggtgagcaagggcgag, SEQ ID NO.15; intron R: tgccgtccgaaatcgaatcgaaacgaagcgaggagaggagaagcagcgtacc, SEQ ID NO. 16.

[0054] The PCR reaction system is shown in Table 12.

[0055] Table 12 PCR reaction system The PCR amplification program is shown in Table 13.

[0056] Table 13 PCR amplification program The amplified PCR product was recovered using an agarose gel DNA recovery kit.

[0057] The attP site is 62 bp long and the target fragment is generated by using overlapping PCR primers for complementary pairing. The following primers are used for the attP site: attP intron F: attcggacggcagggtaccctaggtcgtggtttgtctggtcaaccaccgcggtctcag, SEQ ID NO.17; attP intron R: gacggccagtgaattcgtcggggtttgtaccgtacaccactgagaccgcggtggttgac, SEQ ID NO. 18.

[0058] The PCR reaction system is shown in Table 14.

[0059] Table 14 PCR reaction system The PCR amplification program is shown in Table 15.

[0060] Table 15 PCR amplification program The amplified PCR product was recovered using an agarose gel DNA recovery kit.

[0061] The backbone plasmid of the vector was pUCBN, and the vector was linearized using restriction endonucleases SpeI and EcoR I; The enzyme digestion system is shown in Table 16.

[0062] Table 16 Enzyme digestion system The reaction system was placed in a 37°C incubator for overnight digestion.

[0063] Recover the linearized vector using the Ultrathin DNA Product Purification Kit; Use ClonExpress ® II One Step Cloning Kit and insert the PCR product into the linearized vector according to the kit instructions; The recombinant product was transformed into Escherichia coli strain DH5α; after overnight growth on the plate, a single clone was picked for colony PCR identification to screen positive transformants; Sanger sequencing was used to confirm whether the target sequence was correctly constructed into the pUC-EGFP plasmid, and the vector was named pUCBN-EGFP.

[0064] The fragment attB-C-EGFP containing attB, intron, and C-EGFP was synthesized by GenScript Biotech Co., Ltd. ctaggtcgtggtttgtctggtcaaccaccgcggtctcagtggtgtacggtacaaaccccgacggtaccggtttgctgtttgatccgttgttgtgtccttaatcttgtgctagttcttaccctatctgtttggtgattatttcttgcagaagaacggcatcaaggtgaacttcaaga The sequence of tccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa is SEQ ID NO. 19. The following primer pair was used to amplify the fragment: attB intron F: tcggccggcttgtcgac, SEQ ID NO.20; EGFP-C R: ggcatggacgagctgtacaagtaa, SEQ ID NO. 21.

[0065] The PCR reaction system is shown in Table 17.

[0066] Table 17 PCR reaction system The PCR amplification program is shown in Table 18.

[0067] Table 18 PCR amplification program The amplified PCR product was recovered using an agarose gel DNA recovery kit.

[0068] 2. Protoplast transformation The pUCBN-EGFP plasmid was extracted using an endotoxin-free plasmid miniprep kit.

[0069] Add 10 μg pUCBN-EGFP and 1 μg attB-C-EGFP fragments to 100 μL extracted and separated cotton protoplasts (about 10,000 cells), and transfer 10 μg pUCBN-EGFP and 1 μg attB fragments to 100 μL extracted and separated cotton protoplasts (about 10,000 cells), flick to mix, and place in the dark for 10 minutes. Then add protoplast transformation solution, flick to mix, and place in the dark for 30 minutes. Add W5 solution to terminate the reaction, centrifuge to discard the transformation solution, and resuspend the transformed protoplasts with W5 solution.

[0070] (III) Observation of Recombination Results After the transformed protoplasts were incubated at room temperature overnight, fluorescence was observed under an inverted microscope. Protoplasts co-transformed with the pUCBN-EGFP plasmid and attB-C-EGFP fragment showed fluorescence, while protoplasts transformed with the pUCBN-EGFP plasmid alone showed no fluorescence, indicating that recombination occurred.

[0071] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of Bxb1 recombinase in plants; The nucleotide sequence of the Bxb1 recombinase is shown in SEQ ID NO.1; The plant is cotton.

2. A method for screening recombinase site variants, characterized in that: The screening method comprises the following steps: (1) Vector construction; The constructed vector is a pUCBN vector containing Bxb1 recombinase; The vector backbone of the pUCBN vector is pUC-EGFP; The promoter of the pUCBN vector is 35S, and the terminator is CaMV; The nucleotide sequence of the Bxb1 recombinase is shown in SEQ ID NO.1; (2) Primer annealing; (3) Protoplast transformation; (4) PCR amplification of the product to obtain the recombinase site variant; The amplification method comprises the following steps: After the protoplast transformation is completed, a DNA extraction operation is performed to obtain DNA, and the extracted DNA is subjected to a PCR reaction; When the length of the PCR reaction product is 294 bp, it indicates that a recombination reaction has occurred, and a DNA extraction kit is used to recover the DNA fragment, that is, the recombinase site variant is obtained; When the length of the PCR reaction product is less than 294 bp or exceeds 294 bp, it indicates that no recombination reaction has occurred; The PCR reaction includes a forward primer pm F and a reverse primer pm R; The nucleotide sequences of the forward primer pm F and the reverse primer pm R are shown in SEQ ID NO.4 and SEQ ID NO.

5.

3. The screening method according to claim 2, characterized in that In step (2) primer annealing, the primers include a forward primer attB F and a reverse primer attB R; The nucleotide sequences of attB F and attB R are shown in SEQ ID NO.2 and SEQ ID NO.3.

Images